Human serum albumin and p53-derived peptide fusion protein

Subscriber access provided by UNIV OF NEW ENGLAND

Article

Human serum albumin and p53-derived peptide fusion protein promotes cytotoxicity irrespective of p53 status in cancer cells Ivana Roscoe, Michelle Parker, Daoyuan Dong, Xun Li, and Zhiyu Li Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.8b00647 • Publication Date (Web): 18 Sep 2018 Downloaded from http://pubs.acs.org on September 19, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

Human serum albumin and p53-derived peptide fusion protein promotes cytotoxicity irrespective of p53 status in cancer cells Ivana Roscoe*‡, Michelle Parker*‡, Daoyuan Dong†, Xun Li# and Zhiyu Li*& *Department of Pharmaceutical Sciences, Philadelphia College of Pharmacy, †Department of Chemistry & Biochemistry, Misher College of Arts and Sciences, University of the Sciences, 600 S. 43rd Street, Philadelphia, PA 19104, USA #

Key Laboratory of Chemical Biology (Ministry of Education), School of Pharmaceutical Sciences, Shandong University, 44 West Culture Road, 250012 Ji’nan, Shandong, P. R. China

Running Title: Activing p53 transcription-dependent/independent pathways Keywords: albumin fusion protein, p53, Bcl-2 proteins, apoptosis, synergistic cancer therapy

&

Corresponding Author

Zhiyu Li Address: Department of Pharmaceutical Sciences, Philadelphia College of Pharmacy, University of the Sciences, Philadelphia, PA 19104. E-mail: [email protected] ‡

These authors contributed equally

1 ACS Paragon Plus Environment

Molecular Pharmaceutics 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 41

Abstract Human serum albumin (HSA) fusion protein is a viable and effective approach to target and inhibit essential intracellular pathways. It has previously been shown that an HSA fusion protein containing a p53-reactivating peptide (rHSA-p53i) retains the binding activity to MDM2 and MDMX, resulting in p53 transcription-dependent apoptosis. Here, we demonstrate that rHSA-p53i is able to bind and neutralize anti-apoptotic Bcl-2 family proteins, Bcl-xL and Mcl-1. This interaction displaces proapoptotic Bak and subsequently leads to intrinsic apoptosis via mimicking a p53 transcriptionindependent pathway. Cytotoxicity induced by rHSA-p53i, via p53 transcription dependent and independent apoptotic pathways, is irrespective of p53 status in MDA-MB-231, HeLa, and SJSA-1 cells possessing either mutant, deficient or wild-type p53. The therapeutic potential is also confirmed by treating SJSA-1 and MDA-MB-231 xenograft mouse tumors with rHSA-p53i. These data reveal that rHSAp53i interferes with at least four intracellular targets, making it a viable therapeutic protein for the treatment of a variety of cancers, as well as a carrier to deliver fatty acid-modified chemotherapeutics.


Page 3 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction

HSA is the most abundant plasma protein fulfilling a variety of physiological functions, such as binding and transporting a number of endogenous and exogenous molecules, especially long chain fatty acids (LCFA)1. Its biochemical properties and physiological functions also make HSA an ideal pharmaceutical protein with an optimal pharmacokinetic profile including prolonged plasma circulation, broad biodistribution, and low immunogenicity

2-4

. Fusing therapeutic peptides to HSA is a well-

established strategy to gain these pharmacokinetic benefits

5, 6

. More importantly, HSA also tends to

accumulate in tumors and inflamed tissues 7, 8, which suggests that HSA fusion proteins are an effective approach to deliver sufficient amount of fused therapeutic peptides into to cells to target essential intracellular mechanisms of cancers. Inhibiting the interactions between p53 and MDM2/MDMX is a common strategy to develop anticancer therapeutics

9, 10

. MDM2 and MDMX both bind to p53 at the transactivation domain (TAD).

rHSA-p53i has been constructed previously by fusing a p53-activating peptide derived from the p53 TAD (E17-E28 of p53) to the C-terminal of HSA. In studies performed in osteosarcoma SJSA-1 cells with wildtype p53 and overexpressed MDM2, rHSA-p53i was shown to disrupt p53-MDM2/MDMX interactions, increase the pool of p53, and promote apoptosis. At the time these studies were conducted, functional p53 was assumed to be a pre-requisite for p53-based anticancer therapy, thus limiting the scope of treatable cancers 11. The most versatile and therapeutically effective anticancer therapies should be those functioning in a context irrespective of p53 status. p53 was long believed to function solely as a potent nuclear transcription factor for genes involved in initiating the apoptotic cascade 12, 13. Research over the last decade, however, has revealed a transcription-independent pro-apoptotic function of the



cytoplasmic pool of p53

Page 4 of 41

14, 15

. p53 itself participates in the intrinsic apoptosis pathway via direct

interaction with members of the Bcl-2 family to induce mitochondrial outer membrane permeabilization (MOMP). Members of the anti-apoptotic Bcl-2 family exercise the monumental task of maintaining the integrity of mitochondrial membrane. As such, strategies to inhibit these proteins have been extensively studied in the hopes of developing novel anticancer therapeutics. The anti-apoptotic family members include Bcl-2, Bcl-xL, Mcl-1, Bcl-b, and Bcl-w, each of which contains four BH domains (BH1-4). Of particular importance is a hydrophobic pocket, commonly referred to as the ‘BH3 binding groove’. This region functions as a point of interaction with members of the pro-apoptotic multi-domain Bcl-2 proteins (Bax, Bak, and Bok) by sequestering the pro-apoptotic proteins to oligomerize and form lethal pores within the mitochondrial membrane 16, 17. Studies also revealed physical interactions between the TAD of p53 and the BH3 binding groove of both Bcl-xL and Mcl-1. Thus, p53 is able to orchestrate apoptosis through both transcription-dependent and independent pathways

14, 18

. It is expected that

rHSA-p53i is capable of participating in both pathways to free more p53 in cancer cells and mimic the transcription-independent roles of p53 in apoptosis. There is a noticeable association between the expression of the anti-apoptotic Bcl-xL, and the development of chemoresistance 19. The most prominent (BH3)-mimetic inhibitor ABT-263 is currently being evaluated in clinical trials. It induces apoptosis by inhibiting pro-survival Bcl-2 proteins. While it demonstrate efficacy in a subset of cancers that primarily rely on Bcl-2/Bcl-xL for survival, the presence of Mcl-1 complicates this treatment strategy 20, 21. Recent studies have observed considerable functional overlaps among members of the Bcl-2 family. Therefore, an effective BH3 mimetic must engage with the Mcl-1 sub-class of Bcl-2 proteins in addition to neutralizing Bcl-2/Bcl-xL. BH3 peptide mimetics offer an alternative strategy for the dual-targeting of both Bcl-xL and Mcl-1 22.


Page 5 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Since delivering of functional p53 proteins or genes into cells is not a viable clinical approach, many strategies, such as stapling peptide, cell penetrating peptide, cationic peptide, liposome, polymer, and nanoparticle, have been developed to formulate and deliver therapeutic peptides which target intracellular p53 or Bcl-2-related pathways 23. However, sophisticated procedures and modifications are involved. Moreover, due to lacking specificity and favorable pharmacokinetic properties, the accumulations of peptide drug inside cells are not sufficient for reasonable therapeutic efficacy 24. On the other hand, small molecule inhibitor also face the problems of drug resistance and adverse effect. To resolve these issues, rHSA-p53i has been developed for potential pharmaceutical and pharmacokinetic benefits. In addition to binding to MDM2/MDMX, as shown in previous work, this study demonstrates that rHSA-p53i interacts with Bcl-xL and Mcl-1 in cells (SJSA-1, HeLa, and MDA-MB231) possessing either deficient or mutant p53. rHSA-p53i displaced Bak from complexes with Bcl-xL or Mcl-1 and promoted the release of cytochrome c. The cytotoxicity induced by rHSA-p53i at low µM rang was irrespective of p53 status in vitro and the therapeutic application has been confirmed by xenograft SJSA-1 and MDA-MB-231 mouse tumor models.



Page 6 of 41

Experimental Section Expression and purification of rHSA-p53i Gene encoding rHSA-p53i fusion protein was cloned into the pPICZαA vector as previously described (2). The fusion protein gene was generated by 2 steps of extension PCR. The 5’ primer contains the XhoI cloning site followed by the secretion signal of pPICZαA and the N-terminal sequence of HSA cDNA (5’ATCGCTCGAGAAAAGAGAGGCTAAGCGACGCACACAAGAGTGAGGTTGCT-3’). The first 3’ primer contains the C-terminal portion of HSA, the caspase 3 cleavage site (DEVDG), and the first 7 residues of p53i peptides (ETFSDLWKLLPE) (5’-CCATAGGTCTGAAAACGTTTCACCTCAACTTCGTCGGCGCCTAAGGCAGCTTGACTTGCAGC-3’). The second 3’ primer contains the whole p53i peptides, as well as the NheI restriction site

after

the

stop

codon

(5’-

CGATGCTAGCACTAGTTTATTCAGGAAGTAGTTTCCATAGGTCTGAAAACGTTTCACC-3’). The pPICZαA vector was digested with XhoI and XbaI. The HSA fusion protein gene was digested with XhoI and NheI and ligated into the pPICZαA vector to obtain the plasmid pMM1. The cloned genes were confirmed by DNA sequencing to express rHSA-p53i fusion proteins (HSA (585 a.a)-DVEDG- ETFSDLWKLLPE). Pichia pastoris yeast cells (Invitrogen, 18258-012) were then transformed using linearized plasmids. Clones containing rHSA-p53i were resistant to zeocin and selected after 72 hours. Recombinant proteins were then expressed in Pichia pastoris according to the manufacturer’s instructions (Invitrogen, K1740-01). Purification of rHSA protein was performed using Cibacron Blue 3GA agarose (Sigma, C9534) as previously described (2). Purities of rHSA and rHSA-p53i (greater than 95%) were confirmed by SDSPAGE. FITC and biotin-labeling of rHSA and rHSA-p53i and FA-FITC FITC or biotin-labeling of rHSA or rHSA-p53i to obtain FITC-rHSA, FITC-rHSA-p53i, biotin-rHSA and biotinrHSA-p53i, were performed using NHS-Fluorescein (Thermo Scientific, 46409) and NHS-Biotin (Thermo 6 ACS Paragon Plus Environment

Page 7 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scientific, 20217) according to the manufacturer’s instructions. Following the incubation, proteins were dialyzed three times in 1× PBS to remove unconjugated NHS reagents. FA-FITC was synthesized by mixing 1 × 1-Hexadecylamine and 2 × N,N-Diisopropylethylamine (Sigma) followed by addition of 1 × NHS-Fluorescein (Thermo Scientific). This reaction was carried out overnight, protected from light. Products were then purified by HPLC and identified by MS. Co-Immunoprecipitation SJSA-1, MDA-MB-231, and HeLa cells were lysed in buffer containing 20 mM Tris-HCl, 50 mM NaCl, 0.05% Triton X-100, and protease inhibitors. For each condition, 400 µg of cell extract was incubated with 8 µg of biotinylated rHSA-P53i or rHSA for 1 hour at room temperature. Anti Bcl-xL (Santa Cruz, sc-634) or Mcl-1 antibody (Santa Cruz, sc-819) was then added and incubated. Proteins bound to Bcl-xL or Mcl-1 antibody were pulled down using Protein A/G (1:1) resin (Santa Cruz sc-2003) and analyzed by Western blot using antibodies against Bcl-xL, Mcl-1, and Bak (Santa Cruz, sc-832), and streptavidin-HRP (Pierce, 21130), respectively. Blots were detected by chemiluminescence using SuperSignal West Dura Extended Duration Substrate (Thermo Scientific, 34075). Release of cytochrome c The indicated cells were seeded into 100 mm Petri dishes in triplicates at a density of 1x10 6 cells per dish. After 24 hours of culture, the cell culture medium was replaced by either 1 or 5 µM of rHSAp53i or rHSA in RPMI with 1% FBS. Cells were trypsinized and collected after 24 hours. Harvested cells were washed two times with 1× PBS and proceeded to separate cytosolic and mitochondrial fractions using Mitochondria Isolation Kit (Thermo Scientific, 89874). Both fractions were analyzed by Western blot to detect cytochrome c and normalized according to GAPDH. Cell culture and in vitro cytotoxicity assay



Page 8 of 41

SJSA-1, MDA-MB-231, and HeLa cell lines were purchased from ATCC and cultured in RPMI-1640 medium (Mediatech) with 10% FBS and 1% Penicillin-Streptomycin. Cells were maintained at 37°C with 5% CO2. For growth inhibition assay, 100 μL cells (3.5x104 cells/well) were seeded into each well of a 96-well plate. After 24 hours, cell culture medium was replaced by fresh medium with 1% FBS and the indicated amount of rHSA and rHSA-p53i. The medium with treatments was refreshed every 24 hours for 3 days and cell viability was quantified by PrestoBlue (Invitrogen, A13262). Cell viability was plotted as a percentage relative to the fluorescent reading of untreated cells. ABT-263 and Nutlin-3a (APExBIO, A4228) were used as controls. Analysis of apoptosis by flow cytometry SJSA-1 or MDA-MB-231 cells were seeded into wells of 6-well plates at a density of 1×105 cells/well. After 24 hours of incubation, culture medium was replaced by fresh RPMI medium with 1% FBS containing the indicated amounts of rHSA, rHSA-p53i, Nutlin-3a, and ABT-263, respectively. Cells were harvested by after 48 hours processed according to the manufacturer’s instructions (Invitrogen, V13241), Cells were sorted using FACS Calibur flow cytometer (Becton Dickinson, USA), and then analyzed by FlowJo. Cellular uptake of FA-FITC and FITC-labeled rHSA/rHSA-p53i SJSA-1 or MDA-MB-231 cells were seeded into 6-well plates at a density of 6.4×10 4 cells/well. After 24 hours, medium was replaced by fresh medium (RPMI with 1% FBS) containing the indicated amount of FITC-labeled rHSA or rHSA-p53i. After a 24-hour incubation, cells were trypsinized and washed three times with ice-cold 1× PBS and resuspended in 0.5 ml of PBS. The fluorescence for each condition was measured by a FACS Calibur flow cytometer (BD Biosciences) using the 530/30 (FL1) channel. To assess the cellular uptake of FA-FITC, defatted rHSA and rHSA-p53i were incubated with the same molar ratio of FA-FITC at 37°C for 1 hour to obtain rHSA/FA-FITC or rHSA-p53i/FA-FITC complexes. The complexes 8 ACS Paragon Plus Environment

Page 9 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were then incubated with SJSA-1, MDA-231, or HeLa cells. The fluorescence associated with FA-FITC was measured as described above. Biodistribution of biotin-labeled rHSA and rHSA-p53i Biodistribution of biotinylated rHSA and rHSA-p53i was evaluated using SJSA-1 xenograft tumor model. Female athymic nude mice (NCr-nu/nu, 6-8-week-old) were purchased from Charles River. SJSA-1 cells (5x106) suspended in 200 μL of 50% Matrigel Membrane Matrix GFR (BD Biosciences, 356230) were inoculated into the left flank of mice and the tumor volume was calculated based on the equation V = (AxB2)/2, where A and B are the tumor length and width (in mm), respectively. When tumors reached approximately 80 – 100 mm3 in volume, mice were injected with 13.3 mg/kg of biotin-labeled rHSA or rHSA-p53i and euthanized for tissue collection at 24, 48 , and 72 hours after injection. The tumor, kidneys, spleen, heart, lungs, as well as a portion of the liver were dissected and weighed. For each organ, around 50 mg tissues were homogenized and lysed in 200 µl RIPA buffer. After centrifugation at 13,000 × g for 15 minutes, protein concentration in the supernatant was quantified by Bradford assay. Lysates (20 µg) were subjected to SDS-PAGE followed by Western blot to detect biotin-labeled albumins. Densitometry was carried out using Image J software. IR800 labeling of rHSA and rHSA-p53i and in vivo Imaging NHS IRDye 800CW (IR800) was purchased from LI-COR Co. (Lincoln, NE). rHSA or rHSA-p53i were incubated with NHS IR800 at 1:2 ratio in 1× PBS at room temperature for 2 hours. Each mixture was dialyzed against 1 × PBS for 2 times. The protein concentration was determined by the absorption at 280 nm and the IR800 concentration was measured by the absorption at 775 nm. The number of conjugated fluorophore molecule per rHSA or rHSA-p53i was adjusted to 1 by adding unlabeled proteins. IR800rHSA or IR800-rHSA-p53i (1.8 mg/kg) was injected by i.p to female nude mice with SJSA-1 xenograft tumors. Mice were anaesthetized with isoflurane, and serial images of the dorsal surfaces were 9 ACS Paragon Plus Environment


Page 10 of 41

obtained using the Pearl Imager (LI-COR Biosciences, Lincoln, NE). Images were acquired and processed using Pearl Cam Software v1.0 (LI-COR Biosciences, Lincoln, NE). Longitudinal images were acquired at indicated time points after the injection of probes. Xenograft tumor model Female athymic nude mice (NCr-nu/nu), 6-8-week-old, were purchased from Charles River, and injected subcutaneously into the left flank of mice with 5×106 of SJSA-1 or MDA-MD-231 cells suspended in 200 μL of 50% Matrigel Membrane Matrix GFR (BD Biosciences, 356230). When xenograft tumors reached a mean of ~50-80 mm3, mice were randomized into groups consisting of 5 mice per group, and treated with 33.5 mg/kg of rHSA-p53i or rHSA (200 μL) via intraperitoneal injection (i.p.). Mice were treated twice a week with a total of five doses. Tumor volume was measured on the day of treatment based on the equation V = (AxB2)/2, where A and B are the tumor length and width (in mm), respectively. The relative fold changes in tumor volume were used to assess growth inhibition. The significance of tumor inhibition induced by rHSA-p53i compared with rHSA was determined by two-way anova and the pvalues are reported as * for p

Human serum albumin and p53-derived peptide fusion protein

Recommend Documents