Hyaluronan Reduces Cationic Liposome-Induced Toxicity and

Subscriber access provided by UNIV OF DURHAM

Biological and Medical Applications of Materials and Interfaces

Hyaluronan Reduces Cationic Liposome-Induced Toxicity and Enhances the Antitumour Effect of Targeted Gene Delivery in Mice Yanping Qian, Xiao Liang, Jingyun Yang, Chengjian Zhao, Wen Nie, Li Liu, Tao Yi, Yu Jiang, Jia Geng, Xia Zhao, and Xiawei Wei ACS Appl. Mater. Interfaces, Just Accepted Manuscript • Publication Date (Web): 29 Aug 2018 Downloaded from http://pubs.acs.org on August 29, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Hyaluronan Reduces Cationic Liposome-Induced Toxicity and Enhances the Antitumour Effect of Targeted Gene Delivery in Mice 2

2

2

2

1

Yanping Qian1†, Xiao Liang1†, Jingyun Yang , Chengjian Zhao , Wen Nie , Li Liu , Tao Yi , Yu 2

2

1

2,

Jiang , Jia Geng , Xia Zhao , Xiawei Wei

*

1. Department of Gynecology and Obstetrics, Key Laboratory of Obstetrics & Gynecologic and Pediatric Diseases and Birth Defects of Ministry of Education, West China Second Hospital, Sichuan University, Chengdu, 610041, P. R. China. 2. Lab of Aging Research and Nanotoxicology, State Key Laboratory of Biotherapy, West China Hospital, Sichuan University and Collaborative Innovation Center, No. 17, Block 3, Southern Renmin Road, Chengdu, Sichuan 610041, PR China

†These authors contributed equally to this work.

* Corresponding author.

XiaWei Wei, Ph. D.

Tel.: +86 28 85502796; fax: +86 28 85502796.

E-mail addresses: [email protected]

1

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Cationic nanocarriers are reported to induce cell necrosis, especially in the lungs upon systemic administration. The release of damage-associated molecular patterns (DAMPs), such as mitochondrial DNA from the injured cell may result in the inflammatory toxicity of the nanocarrier, which has largely limited its clinical application. Partially blocking the surface charge of cationic nanocarriers might improve their safety. As hyaluronan (HA) is an anionic polysaccharide that is widely used for specific binding to CD44 to improve the cellular uptake efficiency in tumour-targeting therapy, in this study, we modified cationic liposomes (LP) with negatively charged HA at a mass ratio of 10% to prepare a targeted cationic liposome HA-modified cationic liposomes (HALP). Cationic liposomes modified with hyaluronan showed significantly less cytotoxicity due to the blockage of their surface charge than the unmodified liposomes. In addition, HA modification helped to reduce cell necrosis in lung tissue and reduced the amount of mitochondria subsequently released, which alleviated pulmonary inflammation in mice. HA-modified liposomes also improved the survival of mice injected with a fatal dose of HALP compared with mice injected with cationic LP. In addition, both serological biochemical analysis and histological examination proved that a liposome modified with HA is a safer carrier for systemic administration than an unmodified liposome. Furthermore, HALP/Survivin exhibited an enhanced antitumour effect by inhibiting tumour growth and promoting tumour cell apoptosis compared with the unmodified LP group. In conclusion, compared to the properties of cationic liposomes, liposomes modified with 10% HA (HALP) might be gene vectors with lower toxicity and higher tumour targeting efficiency. 2


Page 2 of 34

Page 3 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Keywords: Cationic liposome; Hyaluronan; Targeted gene delivery; Cytotoxicity; Inflammation;

3



Introduction In recent years, nanoparticle-based drug delivery systems (DDSs) have substantially impacted clinical medicine, in cancer therapy, vaccine development, tissue repair and regeneration1-3. Among the nanoparticles studied, liposomes have gained considerable attention because of their simple administration and potential application to the targeted delivery of small molecule drugs and macromolecules4-5. Because of their reported advantageous biocompatibility and biodegradability, numerous cationic liposomes have been used in gene delivery/therapy and showed remarkable efficacy both in vitro and in vivo6-9. Surface charge is regarded as one of the most important characteristics of the nanoparticles. A positive surface charge will help the liposome interact with its anionic nucleic cargo (plasmids or siRNA) and condense the cargo via electrostatic attraction to form a lipid–DNA complex (lipoplex)10. As the positively charged lipoplexes could be endocytosed by the negatively charged cell membrane11-12, the surface charge of liposomes is important for the cellular uptake and cytotoxicity of particles. Although the benefits of using cationic liposomes in gene therapy have gained considerable attention, it has been generally accepted that the limitations of cationic liposomes, including low efficacy and toxic cell/tissue responses, have always been the main barriers to the application of cationic liposomes13-14. In clinical studies, the administration of cationic liposomes was hindered by their toxicity. The applications of lipoplexes are limited by the occurrence of inflammatory toxicity-related adverse events, such as fatigue, fever, and chills15-18. Therefore, considerable efforts have been devoted to designing and finding novel, effective, and targeted-delivery cationic liposomes19-21. 4


Page 4 of 34

Page 5 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Recently, our group discovered that cationic nanoparticles, such as cationic liposomes, polyethylene imines (PEI) and chitosan, can induce acute cell necrosis in a positive charge-dependent way. The positively charged liposome can induce acute cell necrosis through interaction with Na+/K+-ATPase and subsequent release of mitochondria, which may further stimulate the innate immune response22. Thus, in this study, we attempted to find a ligand that can specifically bind to tumour cells and has reduced cytotoxicity. It has been reported that HA is one of the major components of the natural extracellular matrix and is constructed by repeating units of disaccharides ((1-3)- and (1-4)-linked b-D-glucuronic acid and N-acetyl b-D-glucosamine monomers)23-24. As a water-soluble, biodegradable material with good biocompatibility, HA has been widely used in the fields of bioengineering and drug delivery systems. Mostly, HA has been used for specific binding to CD44, which are overexpressed on many types of tumour cells, to improve the cellular uptake efficiency25-29. As an anionic polysaccharide, the negatively charged HA backbone can negate the positive charge of the liposome and reduce nonspecific interactions with components in a physiological environment. In this study, we prepared HA-modified cationic liposomes and investigated their toxicity and efficiency of transfection in vivo and in vitro. Our data showed that modified with negatively charged HA can reduce toxicity of LP both in vivo and in vitro. The reduction of toxicity may be due to the addition of HA which can block the positive surface charge of the liposomes and protect cells from necrosis to decrease the leakage of mitochondria. In addition, HA could realize the targeted delivery of plasmids to CT26 cells which were overexpressing CD44, and exhibited 5



Page 6 of 34

an antitumour effect by delivering Survivin. Materials and Methods Materials 1,2-dioleoyl-3-trimethylammonium-propane

(chloride

salt)

(DOTAP)

and

1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) were obtained from Avanti Polar Lipids Inc (Alabaster, AL, USA). Hyaluronan (medium MW) was purchased from R&D Systems (Abingdon, United Kingdom). The plasmid pORF9-hSurvivinT34A was purchased from Invivogen (San Diego, CA). The fragment containing survivin cDNA was excised and then inserted into the pVAX vector (Invitrogen, Carlsbad, CA, USA), and the plasmid pVAX was used as the negative control. Green fluorescent protein (GFP) plasmid was used to perform the transfection experiment in vitro. Preparation and Characterization of Liposomes and Lipoplexes Cationic liposomes (LP) were prepared by a film dispersion method as described previously30-31. Lipoplexes were prepared by mixing prepared liposomes with pDNA (pVAX, GFP or Survivin) for 3-5 times by a pipette, and then placed the mixture at room temperature for 30min to form LP/DNA complexes. HA solution was prepared by dissolving HA in distilled water overnight at a concentration of 1 mg/mL. The HA solution was then passed through a Millipore 0.22 µm microporous membrane and stored at 4°C until use. HA-modified liposomes and lipoplexes were prepared by adding HA into the LP or LP/DNA solution at an HA/LP mass ratio ranging from 0%-20% and incubating for another 30 min. 6


Page 7 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The average particle size and zeta potential of liposomes and lipoplexes were measured using a Zetasizer Nano ZS ZEN3600 (Malvern Instruments, Ltd., Malvern, Worcestershire, UK). The zeta potential was determined while diluting the sample in distilled water at a concentration of 1mg/mL at room temperature. All experiments were performed in triplicate. The morphology and surface topography of LP, HALP, LP/pVAX and HALP/ pVAX were characterized by transmission electron microscopy (TEM) and scanning electron microscopy (SEM)30-31. Liposomes and lipoplexes were diluted with distilled water. Agarose gel electrophoresis was performed for the detection of the efficient encapsulation of plasmid DNA in liposomes as previously described30-31. Animals and Cell Lines Female BALB/C mice purchased from Vital River (Peking, China) were placed in a specific pathogen-free (SPF) environment with a consistent room temperature and humidity. Animal experiments were performed according to the guidelines of the Animal Care and Use Committee of Sichuan University (Chengdu, Sichuan, China) and approved by the animal association. The mouse colon carcinoma cell line CT26 and the human embryonic kidney 293 cell line were obtained from the American Type Culture Collection. The cells were cultured in RPMI-1640 (CT26 cells) medium or DMEM (293 cells) (Gibco, Invitrogen Corp., Carlsbad, CA, USA) supplemented with 10% fetal bovine serum, penicillin (100 units/mL) and streptomycin (100 µg/mL) in a humidified atmosphere containing 5% CO2 at 37°C. Cytotoxicity Assessment 7



The cytotoxicity of LP, HALP, LP/pVAX and HALP/pVAX in the 293 cell line was evaluated by the MTT assay as described previously32. Cells were treated with 80 µg/mL liposome or lipoplexes in which the HA concentration was varied from 0% to 10% with 100 µL of serum-free medium. Alternatively, the cells were treated with LP or HALP, and the concentration of total lipids varied from 10-160 µg/mL. The relative cell viability (% of Control) was determined as follows: Relative Cell Viability (% of Control) = Atreated/Acontrol × 100① Cell Necrosis and Mitochondrial Leakage To detect cell necrosis in vivo, bronchoalveolar lavage (BAL) was performed 4 h after injection, just as described33. The cell necrosis in BAL fluids was detected with a CytoTox 96® Non-Radioactive Cytotoxicity Assay (G1780, Promega, USA). To detect the release of mitochondria caused by cationic liposomes, mouse primary lung cells were seeded on sterile coverslips (WHB-24-CS, diameter: 14 mm). Following attachment overnight, cells were stained with Mito-Tracker Red (100 nM, Beyotime, China) and Hoechst 33342 (20 µg/mL, Sigma, USA) for 30 min. Then, cells were treated with HA (5 mg/mL), pVAX (5 mg/mL), liposome or lipoplexes (50 mg/mL, calculated as lipids) in 1 mL of serum-free medium for 0.5 h. The supernatant was removed gently and leakage of mitochondria was photoed by a Zeiss LSM 880 confocal microscope with Airyscan (Carl Zeiss, Germany). Quantitative real-time PCR for mtDNA The mtDNA in plasma isolated 4 h after injection was concentrated and purified with QIAamp DNA Blood Mini Kit (Qiagen) and quantified by qPCR performed with TaqMan probes. 8


Page 8 of 34

Page 9 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The primers and probes were designed as described previously22 and synthesized by Invitrogen. Primer Sequences Forward (5’→3’) ACCTACCCTATCACTCACACTAGCA Reverse (5’→3’) GAGGCTCATCCTGATCATAGAATG Probe ATGAGTTCCCCTACCAATACCACACCC. Inflammation in the lungs The neutrophil cells (CD45+, CD11b+, Ly6G+) in lung tissues were detected by flow cytometry as previously described22. Elastase staining of infiltrating neutrophils in the lungs was performed with a paraffin section using a Naphthol AS·D Chloroacetate Kit (Sigma Chemicals Co., Ltd. St. Louis, USA)22. After staining, the elastase-positive cells (neutrophils) were counted under a high-power microscope. In Vivo Toxicity and Survival of Mice For survival analysis, BALB/c mice were injected with 100 µL of NS, HA (10 mg/kg), pVAX (5 mg/mL), liposomes or lipoplexes (100 mg/kg, calculated as lipids) through their tail veins every 24 h for 10 days, and mouse survival was recorded every 24 h. Tumour Model and Antitumour Treatment A murine intraperitoneal CT26 tumour model was established by intraperitoneal (i.p.) injection of CT26 cells (1 × 106 cells/0.2 mL serum-free RIPM1640). Mice were randomly allocated into five groups and treated three days after inoculation. LP/pVAX, HALP/pVAX, LP/Survivin and HALP/Survivin (30 µg of liposomes containing 5 µg of DNA) in 200 µL of normal saline were prepared and injected intraperitoneally every three days. This model exhibited 9



the peritoneal tumour growth of colon carcinomas, and peritoneal therapeutic lipoplexes were injected intraperitoneally. At the time of sacrifice, tumour tissues and vital organs of the mice were harvested for further characterization, and the tumour weight was recorded. Serological Biochemical Analysis and HE Staining 24 h after the systemic administration of 100 µL of NS, HA (2.5 mg/kg), pVAX (4 mg/kg), liposomes (25 mg/kg) or lipoplexes (25 mg/kg), the serum and vital organ of mice were harvested. The serum was obtained by centrifugation and used for serological biochemical analysis with an automatic analyser (Hitachi High-Technologies Corp., Minato-ku, Tokyo, Japan). Vital organ and tumour tissues were paraffin-embedded. Sections (3-4 µm) after deparaffinization and hydratation were stained with haematoxylin and eosin. Transfection Experiments In vitro transfection experiments were carried out as described previously6. HALP/GFP and LP/GFP containing 2 µg of pGFP were used to transfect 5 × 105 CT26 cells in a 6-well plate with serum-free medium. The efficiency of transfection was observed under an inverted fluorescence microscope and detected with flow cytometry. In vivo transfection experiments were carried out in CT26 tumour-bearing mice with subcutaneous tumour sizes of 3-5.5 mm (8–16 days post-injection with 106 CT26 cells). The lipoplexes loaded with 20 µg GFP plasmid (HALP/GFP and LP/GFP) were prepared and injected intravenously through the mouse tail vein. Seventy-two hours later, mice were sacrificed, and 4-µm-thick frozen sections of tumour tissues were prepared and examined with an upright 10


Page 10 of 34

Page 11 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


fluorescence microscope (Eclipse 80i, Nikon Instruments, Melville, NY). Results Preparation and Characterization of Liposomes and Lipoplexes Cationic liposomes were produced using a film hydration method as previously described34. From examination of the sizes of the liposomes (Figure 1a), the cationic liposome LP was found to be approximately 100 nm, and the liposome/DNA complex (6/1) was slightly larger. After the addition of HA, the liposomes modified with HA were slightly larger and reached approximately 180 nm (with 20% HA added). This result might be due to the binding of HA to the surface of LP. The slight increase in particle size suggested that the addition of HA did not induce the accumulation or fusion of the liposomes and lipoplexes. As shown in Figure 1b, the zeta potential of LP was approximately +55 mV, which can be significantly decreased to +35 mV with the addition of negative plasmid DNA (6/1, m/m). After modification with negatively charged HA, we achieved cationic liposomes (LP+1%HA, LP+2%HA, LP+5%HA, LP+10%HA) with lower zeta potentials. When the concentration of HA reached 20%, the surface charge of the liposomes became negative, which may not be suitable for loading negatively charged DNA cargo. The positive charge of the liposome is important for the electrostatic attachment of the negatively charged DNA to the positively charged carrier 35. Considering that negatively charged HA can also bind to cationic liposomes via electrostatic attachment, we next characterized the DNA encapsulation efficiencies of different liposomes by agarose gel electrophoresis. Within the obtained gel image (shown in Figure 1c), no free DNA was visible in the lipoplexes. Thus, these results confirmed that the DNA was mostly bound to LP and the binding of LP/DNA was 11



unaffected by the addition of HA. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) were used to analyse the morphology and surface topography of the liposomes and lipoplexes and revealed a spheroidal shape and uniform size (Figure 1d).

Figure 1. Physicochemical properties of LP and HA modified LP. (a) Particle size of liposomes and lipoplexes (mean ± SD, n = 3). (b) Zeta-potential of liposomes and lipoplexes (mean ± SD, n = 3). (c) Gel retardation assay of DNA and lipoplexes. Lane 1, DNA marker; lanes 2, naked pVAX; lanes 3, LP/pVAX lipoplexes; lanes 4, LP/pVAX+1%HA lipoplexes; lanes 5, LP/pVAX +2%HA lipoplexes; lanes 6, LP/pVAX+5%HA lipoplexes; lanes 7, LP/pVAX +10%HA lipoplexes; lanes 8, LP/pVAX+20%HA lipoplexes. (d) TEM and SEM images of liposome and lipoplexes. Scale bar, 200nm. 12


Page 12 of 34

Page 13 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The Decreased Cytotoxicity of HALP in vitro As we have reported, the cytotoxicity of the cationic liposome increased in a positive charge-dependent way22. Negatively charged HA can reduce the cytotoxicity of the cationic liposome LP, and such effect was dependent on the HA concentration (Figure 2a). As shown in Figure 1b and c, when the concentration of HA reached 20%, the surface charge of the LP+20%HA liposome and LP/pVAX+20%HA lipoplexes became negative. As positively charged lipoplexes could be endocytosed by the negatively charged cell membrane. By adding 20% HA, negatively charged lipoplexes (LP+20%HA) may not be suitable for effectively loading of DNA cargo. Therefore, in the subsequent study, we chose LP+10%HA (HALP) as the DNA carrier. The concentration-dependent cytotoxicity of LP and HALP was detected by the MTT assay. As shown in Figure 2b. The modification with HA can significantly reduce the cytotoxicity of LP.

Figure 2. The decreased cytotoxicity of HALP. (a) The cytotoxicity of liposomes (80 ߤg/mL) to 293 cells with or without different concentration of HA. (b) The cytotoxicity of LP and HALP 13



(LP+10%HA) to 293 cells with a total lipid varied from 0-160 μg/mL.

The Decreased Cytotoxicity of HALP in vivo It is has been reported that after systemic administration, cationic liposomes and PEI can accumulate in the lungs immediately and induce an immediate type of cell death, which was named as acute necrosis36. Therefore, we detected the cell necrosis in the lungs by analysis of lactate dehydrogenase (LDH) release. As shown in Figure 3a, after the systemic administration of LP, LDH release in bronchialveolar lavage (BAL) fluids was significantly increased. Moreover, compared to LP treated mice, the LDH released in BAL fluids of HALP treated mice was notably reduced. These results support the idea that systemic administration of LP can induce lung tissue injury, and LP modified with HA (HALP) could significantly reduce the injury. Therefore, we next studied the toxicity of LP and HALP in vivo by analyzing the survival of mice injected with a fatal dose of liposome. The data showed that the injection of LP will lead to the death of mice rapidly, but the modified LP with HA (HALP) helped to improve the survival of the mice (Figure 3b).

14


Page 14 of 34

Page 15 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. The decreased toxicity of HALP in vitro and in vivo. (a) Cell necrosis in bronchoalveolar lavage (BAL) fluids was detected by LDH release 4 h after injection of NS, HA (2.5mg/kg), LP (25mg/kg) or HALP (25mg/kg). (b) For survival analysis, BALB/c mice were injected with 100µL NS, HA (10mg/kg), LP (100mg/kg), HALP (100mg/kg) through tail veins every 24 h for 10 days and mouse survival was recorded every 24 h. n=10, ****P < 0.0001 by Log-rank (Mantel-Cox) test. (c) Mice primary lung cells were pre-stained with Mito-tracker red (mitochondria; red) and Hoechst 33342 (nucleus; blue). Then cells were treated with NS, HA (5mg/mL), LP (50mg/mL), HALP (50mg/mL) for 0.5h and observed for the leakage of mitochondria. Arrows represent leaked mitochondria. Scale bar, 20 µm. (d) 4 h after systemic 15



administration of 100µL of NS, HA (2.5mg/kg), LP (25mg/kg) or HALP (25mg/kg), mtDNA in mice plasma was determined by qPCR. (e-f) Influx of neutrophils in lung tissues (staining with CD11b and Ly-6G) was detected by flow cytometry. (g) Specific esterase staining of neutrophils in representative mouse lung sections 24 h after injection is presented. (h) The esterase positive neutrophils were counted in ten high power fields (HPFs). Scale bar, 20 µm. ***P < 0.001, **P < 0.01, by Student’s t-test. Mean ± SEM; n = 3-5.

As it was reported, cationic liposomes can induce cell necrosis and mitochondrial leakage in primary lung cells and mitochondrial DNA will lead to a sever inflammation in vivo22. In the present study, we were excited to find the decreased mitochondria leakage from primary lung cells after the treatment with HALP in vitro (Figure 3c). In line with the data in vitro, the mtDNA released in plasma in the mice treated with HALP was decreased while compared with that released from mice treated with LP (Figure 3d). mtDNA plays a key role in the induction of the inflammation after a tissue injury as a potent DAMP 37. We further characterized whether HALP could alleviate the pulmonary inflammation in mice after the injection by evaluating the infiltration of neutrophils. The neutrophils were detected by flow cytometry (CD45+, CD11b+ and Ly6G+) and esterase staining. As shown in Figure 3e and f, neutrophils were recruited in the lungs after treatment with LP for 24 hours. However, HA modified liposomes (HALP) can successfully protect lung tissue from inflammation. This result was also supported by the results of histological examination with esterase staining (Figure 3 g and h) and HE-staining (Figure 4). Compared with normal BALB/c mice, LP-treated mice exhibited an inflammatory response 16


Page 16 of 34

Page 17 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in the lung, liver and spleen (Figure 4). Severe lymphocytic infiltration in lung and structural failure in liver and spleen were observed. However, all these vital organ damages could be reduced by modifying LP with HA. All these data suggested that the cationic liposome-induced inflammation and injury in vital organs can be reduced by modifying liposomes with HA, which means that HALP may be a better cationic liposome with less toxicity.

Figure 4. HE staining of vital organ sections. Compared with the normal group, the inflammatory 17



response in lung and the cell necrosis in spleen were observed after treated with LP. However, these toxicities are reduced in the HALP group. Scale bar, 50 µm.

The Decreased Cytotoxicity of HALP/pVAX in vivo We next studied the toxicity of lipoplexes (LP/pVAX and HALP/pVAX) in vivo. Since we have proved that cationic liposomes can induce mitochondrial leakage and pulmonary inflammation. We studied the mitochondrial leakage in mouse primary lung cells after treatment with LP/pVAX and HALP/ pVAX for 0.5 h. After the treatment with LP/pVAX, the mouse primary lung cells broke apart and mitochondria was released (Figure 5a). However, the modification of LP/pVAX with HA can reduce the mitochondrial leakage and improve the survival of mice while compared with the mice in LP/pVAX group (Figure 5b). In addition, the pulmonary inflammation induced by systemic administration of lipoplexes was characterized by the infiltration of neutrophils. As revealed by flow cytometry (Figure 5c and d) and esterase staining (Figure 5e and f), compared with neutrophils induced by LP/pVAX, the neutrophils induced by HALP/pVAX was notably decreased. This result was also supported by HE-staining shown in Figure 6, in which organ toxicity of lung, liver and spleen was observed after systemic administration of LP/pVAX. By treating with LP/pVAX, severe lymphocytic infiltration in lung and tissue structure failure in liver and spleen were observed in mice. However, all these tissue damages could be alleviated by modifying the lipoplexes with HA. All these data suggested that HALP may be a safer formulation for gene delivery in vivo.

18


Page 18 of 34

Page 19 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5: The decreased toxicity of HALP/pVAX in vitro and in vivo. (a) Mice primary lung cells stained with Mito-tracker red (mitochondria; red) and Hoechst 33342 (nucleus; blue) were treated with pVAX (5mg/mL), LP/pVAX (50mg/mL), HALP/pVAX (50mg/mL) for 0.5h and were observed for leakage of mitochondria. Arrows represent leaked mitochondria. Scale bar, 20 µm. (b) For survival analysis, BALB/c mice were injected with 100uL NS, HA (10mg/kg), LP (100mg/kg), HALP (100mg/kg) through tail veins every 24 h for 10 days and mouse survival were recorded every 24 h. ****P < 0.0001, by Log-rank (Mantel-Cox) test. (c and d) Influx of neutrophils in lungs tissue (staining with CD11b and Ly6G) was detected with flow cytometry, 24 h after treated with pVAX (4mg/kg), LP/ pVAX (25mg/kg), HALP pVAX (25mg/kg). (e) Specific esterase staining of neutrophils in representative mouse lung sections 24 h after injection are presented. Scale bar, 20 µm. (f) The stained esterase positive neutrophils were counted in ten high 19



power fields (HPFs). ***P < 0.001, **P < 0.01, by Student’s t-test, Mean ± SEM; n = 3.

Safety and Toxicity Evaluations of LP/pVAX and HALP/pVAX in Mice To further study the safety of the HALP liposomes and HALP/pVAX lipoplexes on the physiology of mice, serological biochemical analysis was carried out and the results were shown in Figure 7. Biochemical indexes suggested that the functions of LP and LP/pVAX-treated mice's vital organs such as the liver were severely damaged. However, as shown by the HE staining, this injury could be alleviated by modifying the lipoplexes with HA in HALP/pVAX treated mice. The HE staining showed that the addition of HA notably decreased the inflammation and tissue cell necrosis induced by LP/pVAX in the mice's vital organs such as the liver, lungs and spleen in Figure 6.

20


Page 20 of 34

Page 21 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6: HE-staining of vital organ sections. Compared with normal group, inflammatory response in lung was observed in mice after LP/pVAX injection. vacuolar degeneration (in liver) and cell necrosis (in spleen) were observed in LP/pVAX treated group. However, as shown in HALP/pVAX group, all these tissue damage can be reduced by adding HA. Scale bar, 50 µm. 21



All this evidence suggested that the damage to the functions of LP- and LP/pVAX-treated mice's vital organs can be reduced by the addition of HA. Overall, adding HA can alleviate the tissue toxicity and inflammation induced by LP and LP/pVAX in mice, which suggests that modifying with HA can establish a safer formulation of cationic liposomes and lipoplexes for gene therapy.

Figure 7. Safety and toxicity evaluations in mice with serological biochemical analysis. ALT, Alanine transaminase; AST, Aspartate aminotransferase; LDH, Lactate dehydrogenase; BUN Blood urea nitrogen; ALP, Alkaline phosphatase; CHOL, Cholesterol. (*p< 0.05, **p

Hyaluronan Reduces Cationic Liposome-Induced Toxicity and

Recommend Documents