Anal. Chem. 2003, 75, 1911-1917
Hybridization Enhancement Using Cavitation Microstreaming Robin Hui Liu,*,† Ralf Lenigk,† Roberta L. Druyor-Sanchez,‡ Jianing Yang,† and Piotr Grodzinski†
Microfluidics Laboratory, Motorola Labs, Tempe, Arizona 85284, and Motorola Life Sciences, Tempe, Arizona 85284
Conventional DNA microarray hybridization relies on diffusion of target to surface-bound probes, and thus is a rate-limited process. In this paper, a micromixing technique based on cavitation microstreaming principle that was developed to accelerate hybridization process is explained. Fluidic experiments showed that air bubbles resting on a solid surface and set into vibration by a sound field generated steady circulatory flows, resulting in global convection flows and, thus, rapid mixing. The time to fully mix dyed solutions in a 50-µL chamber using cavitation microstreaming was significantly reduced from hours (a pure diffusion-based mixing) to 6 s. Cavitation microstreaming was implemented to enhance DNA hybridization in both fluorescence-detection-based and electrochemicaldetection-based DNA microarray chips. The former showed that cavitation microstreaming results in up to 5-fold hybridization signal enhancement with significantly improved signal uniformity, as compared to the results obtained in conventional diffusion-based biochips for a given time (2 h). Hybridization kinetics study in the electrochemical detection-based chips showed that acoustic microstreaming results in up to 5-fold kinetics acceleration. Acoustic microstreaming has many advantages over most existing techniques used for hybridization enhancement, including a simple apparatus, ease of implementation, low power consumption (∼2 mW), and low cost.
diffusion to the intrinsic reaction rate.2 Among these parameters, mass transfer in the bulk solution as well as on the surface plays a critical role. Mass transfer falls into three modes:8 (1) migration of a charged body under the influence of an electric field (a gradient of electrical potential), (2) diffusion, and (3) convection (stirring or hydrodynamic transport). In most conventional microarray biochips, hybridization relies solely on diffusion and, thus, is a lengthy rate-limiting process. The bulk of the target solution is at a considerable distance, on the molecular length scale, from the reaction site on the chip surface. For example, the diffusion coefficient of a 250-bp DNA fragment in water at room temperature is ∼2 × 10-7 cm2/s, and thus, the time constant for diffusion along a length of 500 µm is ∼100 min. Since the reaction volume of most biochips is quite large (∼40-200 µL), diffusion of target DNA to the chip surface is very inefficient. Hence, the hybridization step for most conventional DNA chips with planar surface may require 6-20 h to complete, depending on the size and concentration of target DNA as well as the hybridization conditions.11-14 This greatly limits the throughput of sample analyses. Various methods have been developed to accelerate the hybridization process, including DNA migration enhancement by direct electric field,15,16 dynamic DNA hybridization using paramagnetic beads,17 and the use of a microporous three-dimensional biochip through which the hybridization solution is pumped continuously.18 It is believed that introduction of a micromixing technique can accelerate hybridization kinetics and improve uniformity of the hybridization.
DNA microarray technology is one of the most promising analytical tools in molecular biology. DNA hybridization is a heterogeneous biomolecular reaction, involving two species: the target DNA present in a free solution, and the DNA probes immobilized on a surface. The hybridization rate depends on a number of parameters, such as temperature,1 base composition and length of target and probe,2,3 target concentration and probe density,4 association and dissociation kinetics,1,5 method of probe immobilization,6,7 mass transfer,8-10 and the relative ratio of solute
(5) Jensen, K. K.; Orum, H.; Nielsen, P. E.; Norden, B. Biochemistry 1997, 36, 5072-5077. (6) Livshits, M. A.; Mirzabekov, A. D. Biophys. J. 1996, 71, 2795-2801. (7) Yang, M.; Yau, H. C. M.; Chan, H. L. Langmuir 1998, 14, 6121-6129. (8) Bard, A. J.; Faulkner, L. R. Electrochemical Methods; Wiley: New York, 1980. (9) Myszka, D. G.; He, X.; Dembo, M.; Morton, T. A.; Goldstein, B. Biophys. J. 1998, 75, 583-594. (10) Mason, T.; Pineda, A. R.; Wofsy, C.; Goldstein, B. Math. Biosci. 1999, 159, 123-144. (11) Schena, M. Microarray BiochipTechnology; Eaton Publishing: Natick, MA, 2000. (12) Lipshutz, R. J.; Fodor, S. P. A.; Gingeras, T. R.; Lockhart, D. J. Nat. Genet. 1999, 21, 20-24. (13) Southern, E.; Mir, K.; Shchepinov, M. Nat. Genet. 1999, 21, 5-9. (14) Williams, J. C.; Case-Green, S. C.; Mir, K. U.; Southern, E. M. Nucleic Acids Res. 1994, 22, 1365-1367. (15) Sosnowski, R.; Tu, E.; Butler, W.; O’Connell, J.; Heller, M. Proc. Natl. Acad. Sci. 1997, 94, 1119-1123. (16) Edman, C.; Raymond, D.; Wu, D.; Tu, E.; Sosnowski, R.; Butler, W.; Nerenberg, M.; Heller, M. Nucl. Acids Res. 1998, 25, 4907-4914. (17) Fan, Z. H.; Mangru, S.; Granzow, R.; Heaney, P.; Ho, W.; Dong, Q.; Kumar, R. Anal. Chem. 1999, 71, 4851-4859. (18) Cheek, B. J.; Steel, A. B.; Torres, M. P.; Yu, Y.; Yang, H. Anal. Chem. 2001, 73, 5777-5783.
* Correspondending author current address: Center for Applied NanoBioscience, Arizona State University, Tempe, AZ 85284. Tel: (480)-727-8168. Fax: (480)-727-8283. E-mail:
[email protected]. † Motorola Labs. ‡ Motorola Life Sciences. (1) Blasko, A.; Dempcy, R. O.; Minyat, E. E.; Bruice, T. C. J. Am. Chem. Soc. 1996, 118, 7892-7899. (2) Chan, V.; Graves, D. J.; McKenzie, S. E. Biophys. J. 1995, 69, 2243-2255. (3) Stillman, B. A.; Tonkinson, J. L. Anal. Biochem. 2001, 295, 149-157. (4) Chan, V.; Graves, D. J.; Fortina, P.; McKenzie, S. E. Langmuir 1997, 13 (2), 320-329. 10.1021/ac026267t CCC: $25.00 Published on Web 03/05/2003
© 2003 American Chemical Society
Analytical Chemistry, Vol. 75, No. 8, April 15, 2003 1911
A few interesting mixing techniques to facilitate mixing of various fluids within a DNA hybridization chamber have been reported in recent years. Of particular interest is “rotational mixing,” which involves a rotatable body having a rotational axis.19 When rotating the chamber about the rotational axis, the fluid within the chamber will become agitated as the direction of flow is hindered due to the change in direction of the chamber walls. This technique is attractive, since it is simple and does not require a specific micromixer. The rotational mixing generally works better in macroscale fluidic chambers, since this mixing relies on the inertial force of the fluid. However, when the reaction chamber is shallow (e.g., ∼200 µm deep), the inertial force of the fluid within the chamber is negligible, and viscous force dominates fluidic behavior because of a low Reynolds number (∼1). Significant mixing enhancement in microfluidic environment by mechanical agitation means, such as rotation or lateral shaking of the chamber, therefore, seems difficult to achieve, despite the apparent simplicity of methodology. Ultrasonic mixing using a piezoelectric element that is in contact with the outer surface of the hybridization chamber was also reported to achieve hybridization enhancement.20 Application of AC voltage (with a frequency of 2 MHz) to the acoustic actuator element generates ultrasonic vibrations that are translated to the reaction chamber where sample mixing occurs. The vibrations of this element result in convective flow in the reaction chamber. Other similar works on ultrasonic mixing include those of Moroney et al.21 and Zhu et al.22 The former used ultrasonic lamb waves (4.7 MHz) traveling in a 4-µm-thick composite membrane of silicon nitride and piezoelectric zinc oxide to induce convective liquid flow in a chamber. The latter utilized loosely focused acoustic waves generated by an electrode-patterned piezoelectric film to enhance mixing in an open chamber. Microfluidic motion produced by loosely focused acoustic waves uses radio frequency (RF) sources with frequencies corresponding to thickness-mode resonance of the thin piezoelectric film. Both devices required a thin chamber membrane (with a thickness of a few micrometers) between the liquid solution and the piezoelectric film, which was fabricated by silicon (Si) micromachining. Other mixing approaches to enhance hybridization include bubbling gas through the chamber and a “drain and fill” method.23 The former approach involves flowing of an inert gas stream through the body of the fluid in the chamber. The latter method involves alternately reversing the direction of the system’s pump to drain and then fill the chamber. Both mixing schemes require system setups containing in-line flowing and pumping and possibly precise flow control. In this paper, we describe the phenomenon of cavitation microstreaming, which provides a mechanism for achieving rapid and homogeneous mixing in a hybridization chamber. An airbubble-trapping design using micromachined air pockets coupled with a commercially available piezoelectric (PZT) disk is pre(19) Winkler, J.; et al. Rotational Mixing Method Using a Cartridge Having a Narrow Interior. U.S. Patent 6050719, 2000. (20) Anderson, R. C.; et al. Miniaturized Genetic Analysis Systems and Methods. U.S. Patent 6168948 B1, 2001. (21) Moroney, R. M.; White, R. M.; Howe, R. T. MEMS ’95, The Netherlands, 1995; 277-282. (22) Zhu, X.; Kim, E. S. Sens. Actuators, A 1998, 66 (1-3), 355-360. (23) Besemer, D.; et al. Fluidics Station With a Mounting System and Method of Using. U.S. Patent 6114122, 2000.
1912
Analytical Chemistry, Vol. 75, No. 8, April 15, 2003
sented. Fluidic experiments demonstrating utilization of cavitation microstreaming to achieve a high degree of fluid transport and mixing enhancement in a hybridization chamber are described. DNA hybridization experiments performed to demonstrate improvement of hybridization kinetics and signal uniformity using cavitation microstreaming are also discussed. THEORY An air bubble in a liquid medium can act as an actuator (i.e., the bubble surface behaves like a vibrating membrane) when it is energized by an acoustic field. The behavior of a bubble in a sound field is determined largely by its resonance characteristics. For frequencies in the range considered here (approximately kilohertz), the radius of a bubble at resonance frequency f is given by
2πaf ) x3γP0/F
(1)
where a is the bubble radius, γ is the ratio of specific heats for the gas, P0 is the hydrostatic pressure, and F is the density of the liquid. When a bubble undergoes vibration within a sound field, the frictional forces generated at the air/liquid interface induce a bulk fluid flow around the air bubble, called cavitation microstreaming or acoustic microstreaming.24 It was found that cavitation microstreaming is orderly at low driving amplitudes when the insonation frequency drives the bubbles at their resonance frequency for pulsation and when the bubbles are situated on solid boundaries. Bubble-induced streaming is strongly dependent on frequency for a given bubble radius and on the bubble’s radius for a given frequency. Acoustic microstreaming arising around a single bubble excited close to resonance produces strong liquid circulation flow in the liquid chamber. This liquid circulation flow can be used to effectively enhance mixing beyond the diffusion-limited process. Although cavitation microstreaming has been studied since 1950s,25,26 we have not found any report on the use of this phenomenon to enhance micromixing. One challenge here is to precisely control the size of the air bubbles. In this work, we have developed an air bubble trapping design using micromachined air pockets for mixing enhancement. EXPERIMENTAL SECTION Fluidic Experiments with Dye. Fluidic experiments using dye were implemented to visualize and study cavitation microstreaming in a hybridization chamber. As shown in Figure 1, the chamber was constructed by sealing a conventional DNA microarray glass chip with a polycarbonate cover slip using doublesided adhesive tape (3M, St. Paul, MN). The adhesive tape, with a thickness of 200 µm, serves as a spacing gasket to define the shape and dimension (16 × 16 mm) of the chamber. The cover slip has a desired number of air pockets distributed uniformly above the chamber with a pitch of 2 mm. The air pockets (500 µm in depth and 500 µm in diameter) that were machined using a Prolight milling machine (Light Machines, Manchester, NH) (24) Elder, S. A. J. Acoust. Soc. Am. 1959, 31, 54-62. (25) Nyborg, W. L. J. Acoust. Soc. Am. 1958, 30, 329-339. (26) Kolb, J.; et al. J. Acoust. Soc. Am. 1956, 28, 1237-1242.
Figure 1. Schematic showing a number of air pockets in the top layer of the DNA biochip chamber: (a) overview and (b) side view.
were used to trap air bubbles in the reaction solution. A piezoelectric (PZT) disk (15 mm diameter, APC Inc., Mackeyville, PA) was bonded onto the external surface of the cover slip using a super glue (Duro, Loctite Corp., Avon, Ohio). The chamber contents were irradiated by the sound generated by the PZT disk driven by a HP functional generator (HewlettPackard Co., Palo Alto, CA). Visual observations were made from above using a stereoscope. One-half of the chamber was filled with DI water, and the other half, with a red dye solution (a mixture of phenolphthalein and sodium hydroxide solution, both from Aldrich Chemical Co., Milwaukee, WI) that was used to depict motion of fluid elements in the chamber. The frequency employed was 5 kHz (square wave) with a peak-to-peak amplitude (Vpp) of 40 V. High-Density DNA Microarray Hybridization. High-density DNA microarray hybridization experiments were performed to evaluate mixing enhancement in improving hybridization efficiency and uniformity over conventional diffusion-based hybridization. A fluorescence-detection-based microarray biochip that consists of a high-density array of oligonucleotide probes dispensed on a 1 × 3-in. pretreated glass slide (Motorola Life Sciences, Tempe, AZ) was used. The oligonucleotide probes that consist of two types of oligonucleotides (NEO and YJEK, both obtained from Operon Technologies, Inc., Alameda, CA) and a positive control were arranged in a uniform pattern across the entire slide. Both NEO and YJEK are oligonucleotides that are Cy3-labeled. The sequence of the NEO probe is GCGTTGGCTACCCGTGATATTGCTGAAGAG with 5′ amine. The sequence of the YJEK probe is TTTGTAGATTAGCACTGGAACTGGCACCGC with 5′ amine. ×Doublesided adhesive tape (1 × 3 in.) with a thickness of 0.25 mm , which was cut into four 15 × 12 mm windows, was used to bond a polypropylene cover slip to the glass slide and served as a spacing gasket to define the shape and dimension of the chambers on the glass slide. The polypropylene cover slip consisted of a number of air pockets (500 µm in depth and 500 µm in diameter) on the side facing the DNA array. The air pockets were uniformly distributed across the cover slip with a pitch of 2 mm. A PZT disk (15 mm diameter) was glued on the outer surface of one chamber, in which cavitation microstreaming was implemented while static hybridization (i.e., diffusion-based) was performed as a control in one of the other three chambers on the same chip. During hybridization, a fluorescently labeled oligonucleotide target solution (with a volume of 45 µL), which had 50% formamide
(Sigma Chemical Co., St. Louis, MI) and 10 nM Cy3-labeled targets (Operon Technologies, Inc., Alameda, CA) that had complements to the NEO and YJEK sequence on the slide, was loaded into each detection chamber. The PZT was driven at 5 kHz (sinusoidal sound wave) and 10 Vpp. The device was kept in a temperature-controlled chamber at 37 °C. Hybridization was carried out for 2 h. Following the hybridization, the polypropylene cover slip was removed from the array glass slide, which was subsequently washed with TNT solution (Tris/sodium chloride/ Tween, from Sigma Chemical Co., St. Louis, MI) for 30 min at 42 °C and then 3 times with water. The glass slide was then scanned using a microarray scanner (Axon Instruments, Inc., Union City, CA). Hybridization Kinetics Study. An assay for single nucleotide polymorphisms (SNP) associated with hematochromatosis was performed in a Motorola eSensor device (Motorola Life Sciences, Pasadena, CA) with cavitation microstreaming. The eSensor devices allow for continuous measurement of DNA hybridization signals during the reaction because of the homogeneous nature of the assay, thus allowing hybridization kinetics study.27 Each device consists of a plastic cover slip assembled with a printed circuit board (PCB) chip that has 16 detection electrodes. Four electrodes contain identical oligonucleotide probes for the HFE-H gene, while the remaining electrodes contain other probes and negative controls. The plastic cover slip has a 4 × 4 array of air pockets (500 µm in depth and 500 µm in diameter) facing the DNA probes on the PCB substrate. A PZT disk was glued on the outer surface of the cover slip to induce cavitation microstreaming during the hybridization. The DNA target solution containing the HFE-H polymorphism was amplified from human genomic DNA characterized for HFE genotype. The PCR product was prepared by asymmetrical amplification of 100 ng of human genomic DNA (Clontech, Palo Alto, CA) using a set of three primers with a final concentration of 0.5 µM per primer, 400 µM dNTP, 50 mM KC, 10 mM TrisHCL (pH 8.3), 2 mM MgCl2, 0.05 U/µL Taq polymerase, and 100 µg/mL bovine serum albumin. Cycling parameters were 95 °C (3 min) to denature the human DNA, followed by 40 cycles of (94 °C for 45 s, 58 °C for 55 s, 72 °C for 60 s), and ending at 72 °C for 6 min to extend all unfinished DNA strands. Following PCR, the (27) Umek, R. M.; Vielmetter, J.; Terbrueggen, R. H.; Irvine, B.; Yu, C. J.; Kayyem, J. F.; Yowanto, H.; Blackburn, G. F.; Farkas, D. H.; Chen, Y. P. J. Mol. Diagn. 2001, 3, 74-84.
Analytical Chemistry, Vol. 75, No. 8, April 15, 2003
1913
Figure 2. Photographs showing multibubble-induced (7 × 5 top bubbles) cavitation microstreaming in a 16 × 16 × 0.2-mm chamber at (a) time 0, (b) 2 s, (c) 4 s, and (d) 6 s. The PZT disk on the backside of the chamber was driven at 5 kHz and 40 Vpp.
amplicon solution was mixed with a hybridization buffer solution (Motorola Life Sciences, Pasadena, CA) in a ratio of 1:2. The hybridization cocktail was then loaded into the eSensor chip with an internal volume of 65 µL. Hybridization was performed at 35 °C. During the hybridization process, the PZT was driven at 5 kHz and 10 Vpp. The signals were read out using a Motorola Hydra 600 instrument (Motorola Life Sciences, Pasadena, CA). The AC voltammetry technique to gather the electrochemical signals corresponding to hybridization reaction is described in more detail elsewhere.27,28 For comparison purposes, the hybridization reaction was also implemented in a conventional diffusion-based eSensor chip using the same amplicon mixture. Study of hybridization kinetics as a function of acoustic amplitude (Vpp) was also performed using 5 Vpp and 40 Vpp, as compared to 10 Vpp, while maintaining the same frequency of 5 kHz. RESULT AND DISCUSSION Fluidic Mixing Experiment. Fluidic dye experiments showed that sonic irradiation caused little motion of the liquid if air bubbles were excluded from the chamber. However, with air bubbles that have a resonance frequency matching the insonation frequency induced by the PZT transducer, a gross liquid motion was seen to take place around an individual bubble. Since the top pockets are uniformly distributed above the chamber, the resulting cavitation microstreaming dominates the mixing in the whole chamber (16 × 16 × 0.2 mm) within a few seconds. As shown in Figure 2, when the PZT was turned on (with 5 kHz and 40 Vpp
square wave), the streaming occurred around each air bubble, and the microstreaming flow fields began to interfere with each other. Churning motion in the liquid was seen at the interface of air bubble and liquid. An energetic convection streaming motion was observed in the vicinity of each bubble. Fluid elements were focused into a narrow stream and moved rapidly toward the bubble surface. Upon nearing the bubble, the velocity of the fluid elements decreased as they spread out and left the bubble region (the study of the flow field of cavitation microstreaming in a microchamber is described in more detail elsewhere29). Flow circulation was also observed in the liquid. As streaming continued and fluid elements moved rapidly, the dye eventually completely filled the chamber. Fluidic experiment (Figure 2) shows that complete mixing was achieved across the whole chamber within 6 s, while the mixing based on pure diffusion (i.e., without acoustic mixing) took ∼8 h to complete in the same chamber. Dye experiments were also performed to investigate the relationship between mixing rate and acoustic parameters. It was found that square wave gave faster mixing than sinusoidal wave. Lower voltage amplitude also resulted in less mixing enhancement. For example, complete mixing in the same chamber as shown in Figure 2 was achieved within 1 min 35 s if a 5 kHz and 10 Vpp sinusoidal wave was employed. The mixing effect as a function of the air pocket size and the pitch between air pockets has been reported in detail elsewhere.29 It was found that microstreaming induced by the air bubble with a diameter of 0.5 mm in an acoustic field of 5 kHz and 40 Vpp (square wave) remains strong within a radius of 2 mm
(28) Farkas, D. H. J. Assoc. Lab. Autom. 1999, 4, 20-24.
(29) Liu, R. H.; Yang, J.; Pindera, M. Z.; Athavale, M.; Grodzinski, P. Lab Chip 2002, 2 (3), 151-157.
1914 Analytical Chemistry, Vol. 75, No. 8, April 15, 2003
Figure 3. (a) Fluorescence image of a 4-chamber high-density array biochip after a 2-h hybridization reaction. One chamber (15 × 12 × 0.25 mm) undergoes static hybridization (b), while hybridization in another chamber (15 × 12 × 0.25 mm) is aided with cavitation microstreaming (c).
around the bubble. Therefore, the cavitation microstreaming technique can be applied to achieve rapid mixing enhancement in any chamber with a depth
