Hygrocins C–G, Cytotoxic Naphthoquinone Ansamycins from gdmAI

Article pubs.acs.org/jnp

Hygrocins C−G, Cytotoxic Naphthoquinone Ansamycins from gdmAIDisrupted Streptomyces sp. LZ35 Chunhua Lu,†,⊥ Yaoyao Li,†,⊥ Jingjing Deng,†,⊥ Shanren Li,‡,§ Yan Shen,† Haoxin Wang,*,‡ and Yuemao Shen*,†,‡ †

Key Laboratory of Chemical Biology (Ministry of Education), School of Pharmaceutical Sciences, Shandong University, Jinan 250012, China ‡ School of Life Sciences, Shandong University, Shandong 250100, China § School of Life Sciences, Xiamen University, Xiamen 361005, China S Supporting Information *

ABSTRACT: Six hygrocins, polyketides of ansamycin class, were isolated from the gdmAI-disrupted Streptomyces sp. LZ35. The planar structure of hygrocins C−E (1−3) was determined by one-dimensional and two-dimensional NMR spectroscopy and high-resolution mass spectrometry. They are derivatives of hygrocin A but differ in the configuration at C-2 and the orientation of the C-3,4 double bond. Hygrocin F(4) and G(5) were shown to be isomers of hygrocin C (1) and B (6), respectively, due to the different alkyl oxygen participating in the macrolide ester linkage. Hygrocins C, D, and F were found to be toxic to human breast cancer MDA-MB-431 cells (IC50 = 0.5, 3.0, and 3.3 μM, respectively) and prostate cancer PC3 cells (IC50 = 1.9, 5.0, and 4.5 μM, respectively), while hygrocins B, E, and G were inactive.

A

cultured agar was chopped, diced, and extracted overnight with EtOAc−MeOH−AcOH (80:15:5) at room temperature. The organic extracts were collected, dried under vacuum, and the residues were redissolved in methanol and petroleum ether to obtain the methanol extract, which was subjected to MPLC, Sephadex LH-20, silica gel CC, and finally HPLC to yield compounds 1−6. The molecular formulas of compounds 1−4 were established as C28H31NO8 by high-resolution ESIMS (m/z 510.2188, 510.2254, 510.2179, 510.2200 [M + H]+, respectively). The 13C and HSQC NMR data of 1−4 revealed in each case the same four methyl groups, three methylene groups, nine methines (two oxygenated and five olefinic), and twelve quaternary carbons (including two carboxyls and two ketones). The 1Hand 13C NMR spectral data were almost identical to those of hygrocin A derivative 6, thus establishing the planar structures of 1−3 (Table 1).5 Additionally, the structure of 1 was confirmed by HMBC and 1H−1H COSY correlations (Figure 2). The spectroscopic data of 4 were similar to those of 1, except the downfield shift of H-7 (δ = 5.07) and upfield shift of H-6 (δ = 3.90), which indicated the formation of a C-5,6 ester linkage instead of a C-5,7 in 1 (Table 1). This was further supported by the HMBC correlations from H-7 to C-5,8, and 9. The relative configurations of 1−4 were established by thorough analysis of one-dimensional (1D)- and two-dimen-

nsamycins comprise a diverse group of bioactive macrolides, including the HSP90 inhibitor geldanamycin,1 the antibiotic rifamycin,2 and the anticancer agents maytansinoid3 and ansamitocin P-3.2 Strain LZ35 was isolated from intertidal soil collected at Jimei, Xiamen, China. The 16S rRNA sequencing (GenBank: JX853780) was performed to characterize it as Streptomyces sp., and it was designated strain LZ35. Two different types of ansamycins, geldanamycins (octoketides) and hygrocin B (nonaketide), have been isolated from the oatmeal agar culture of strain LZ35, with the production of geldanamycins being much higher than that of hygrocins.4 The hygrocins represent a small subfamily of nonaketide ansamycins, with only two members reported so far.5 In order to explore the structural diversity and biological activity of hygrocins, additional material was needed. As these compounds are minor constituents, a geldanamycin-nonproducing mutant of strain LZ35 (LZ35ΔGPKS) was constructed by deletion of part of gdmAI, which is a gene-encoding geldanamycin PKS (Figure S1 of the Supporting Information). This mutant provides a relative “clean” background to facilitate the isolation of minor hygrocins. We report here the discovery and cytotoxic activity of five new hygrocin derivatives, namely hygrocins C− G (1−5), together with hygrocin B (6), from the metabolites of LZ35ΔGPKS (Figure 1).

■

RESULTS AND DISCUSSION

Solid-state fermentation (30 l) of strain LZ35ΔGPKS was performed with an oatmeal medium at 28 °C for 11 days. The © 2013 American Chemical Society and American Society of Pharmacognosy

Received: November 22, 2012 Published: November 18, 2013 2175

dx.doi.org/10.1021/np400474s | J. Nat. Prod. 2013, 76, 2175−2179

Journal of Natural Products

Article

Figure 1. The chemical structures of hygrocins (1−6).

planar structure, the lack of activity of E might be ascribed to the E configuration of the 3,4 double bond. Previously, the Carter group reported the isolation, characterization, and antimicrobial activities of hygrocins A and B, along with one “degradation” product.5 In this study, hygrocins C−E were shown to have the same planar structure as the “degradation” product. However, since the relative configuration of the “degradation” product was not elucidated, it cannot be identified as one of hygrocins C−E. As previously reported, hygrocins B−G may be derived from the reactive precursor hygrocin A. The γ-lactam of hygrocins C−F was formed in an intramolecular aldol reaction, and the formation of the seven-membered lactam ring in hygrocin B and G was possibly due to the attack of the carbonyl-activated methylene on the quinone in a vinylogous fashion.5,6 Apparently, this does not lead to inactive shunt products but generates macrolides with various ring sizes and overall configurations, which could further diversify the structures and biological activities of this subfamily. Taken together, the inherent activity of hygrocin A allows various reaction channels to diverge the biosynthetic pathways, which again highlights the beauty of biosynthetic versatility in nature.

sional (2D)-NMR spectroscopic data. The large coupling constants (J > 15.0 Hz) between H-8 and H-9 led to assignment of the 8-E configuration for 1−4. The Z configuration of the C-3,4 double bonds of 1, 2, and 4 was deduced from the relative downfield shift of the allylic methyl group C-4a (δ = 22.1 in 1, δ = 21.5 in 2, and δ = 21.7 in 4) (Table 1), which was further supported by the NOE correlations Me-4a ↔ H-3 ↔ H-17, while the upfield shift of C-4a (δ = 13.6) indicated an E configuration of C-3,4 double bond in 3 (Figure 2). The small vicinal coupling constant of ca. 4.0 Hz was an indication of a syn orientation between H-6,7 in 1−3. Additionally, strong NOE correlations between H-2,6a suggested the 2R* configuration in 1 and 4, compared to the 2S* configuration in 2 and 3 due to the absence of NOEs between H-2,6a (Figure 2). Finally, an X-ray single-crystal structure analysis of 1 was carried out for the final structure determination. In the X-ray structure, the relative configurations of the stereogenic centers C(10) and C(19) were determined (Figure 3). For hygrocin G (5), high-resolution ESIMS (m/z 508.1899 [M + H]+) and 13C NMR spectroscopy established a molecular formula of C28H29NO8. The 1D- and 2D-NMR data revealed that this metabolite represents a homologue of hygrocin B, but differs in the side chain of the ester linkage. The relative configuration of 5 was determined from the ROESY spectrum. The NOE correlations Me-6a ↔ Me-4a indicated that H-7 was in the opposite orientation from Me-4a (Figure 2). The hygrocins (1−6) were evaluated for their cytotoxicities against various human cancer cell lines (breast cancer MDAMB-431 cells, prostate cancer PC3 cells, alveolar basal epithelial cells A549, colorectal cancer SW620 cells, and hepatocellular liver carcinoma cells HepG2). Surprisingly, though the hygrocins tested are structurally quite similar, they showed dramatically different biological activities. Note that this phenomenon was also observed in another group of ansamycins, divergolides A−D.6 Hygrocins C (1), D (2), and F (4) were observed to be cytotoxic to human breast cancer MDA-MB-431 cells (IC50 = 0.5, 3.0, and 3.3 μM, respectively) and prostate cancer PC3 cells (IC50 = 1.9, 5.0, and 4.5 μM, respectively), whereas hygrocins B (6), E (3), and G (5) showed no toxicity relative to the control at the maximum dose evaluated (10 μM). As hygrocins C, D, and E have the same

■

EXPERIMENTAL SECTION

General Experimental Procedures. NMR spectra were recorded on a Bruker Avance DRX-600 spectrometer operating at 600 (1H) and 150 (13C) MHz. HRESIMS were carried out on an LTQ-Orbitrap XL. HPLC were performed on an Agilent 1200 equipped with a ZORBAX Eclipse XDB-C18 5 μm column (9.4 × 250 mm). All solvents used were of analytical grade. Optical rotations were measured on a GYROMAT-HP polarimeter, and UV data were recorded on a UV2450 spectrophotometer (Shimadzu, Japan). Silica gel (200−300 mesh; Qingdao Haiyang Chemical Company Ltd., Qingdao, P. R. China) and Sephadex LH-20 (25−100 μm; Pharmacia Biotek, Denmark) were used for column chromatography. Thin-layer chromatography (TLC) was carried out with glass precoated silica gel GF254 plates (Qingdao Haiyang Chemical Company Ltd.). Compounds were visualized under UV light and by spraying with H2SO4/EtOH (1:9, v/v), followed by heating. Material. Strain LZ35 was isolated from intertidal soil collected at Jimei, Xiamen, China. It was identified as a Streptomyces species, according to the 16S rRNA sequence (GenBank accession no. JX853780). 2176

dx.doi.org/10.1021/np400474s | J. Nat. Prod. 2013, 76, 2175−2179

δC mult.

174.3s 53.5d 130.0d 135.1s 21.1q 166.4s 73.6d 13.1q 70.0d 127.4d 135.2d

44.8d 26.0t 12.1q 30.4t 39.6t

206.3s 128.2s 152.3s 130.5s 15.9q 129.7d 132.8s 72.6s 161.6s 102.9d 183.0s 129.3s

position

1 2 3 4 4a 5 6 6a 7 8 9

10 10a 10b 11 12

13 14 15 16 16a 17 18 19 20 21 22 23

(qd, 6.4, 4.0) (d, 6.4) (dd, 5.6, 3.6) (dd, 15.2, 3.4) (ddd, 15.2, 9.5, 1.9)

2177

5.82 (s)

2.25 (s) 7.48 (s)

1.43 (m) 1.45 (m) 0.95 (m) 0.64 (t, 7.1) 1.39 (m) 2.88 (dd, 17.3, 11.6, 2.0) 2.52 (dd, 17.3, 6.9, 2.0)

4.83 1.03 3.94 4.21 5.30

2.19 (s)

4.67 (d, 10.7) 6.59 (dd, 10.7, 1.5)

δH (mult., J in Hz)

1 [(CD3)2CO]

212.0s 128.5s 153.4s 133.1s 17.0q 130.4d 134.3s 73.7s 164.5s 103.5d 185.6s 129.3s

44.1d 29.5t 12.7q 34.9t 42.7t

177.1s 55.9d 132.7d 135.3s 21.5q 168.5s 76.1d 13.7q 71.5d 128.0d 137.7d

δC mult.

(dq, 3.5, 6.1) (d, 6.1) (d, 1.4) (dd, 15.5, 1.4) (ddd, 15.5, 7.6, 2.2)

5.79 (s)

2.28 (s) 7.54 (s)

1.54 (m) 1.35 (m) 1.08 (m) 0.73 (t, 7.3) 1.76 (m) 1.36 (m) 2.66 (ddd, 15.2, 11.9, 2.4) 2.48 (ddd, 9.6, 7.1, 2.4)

4.80 0.95 3.96 3.85 5.21

2.18 (d, 1.3)

4.22 (d, 10.8) 6.46 (dd, 10.8, 1.3)

δH (mult., J in Hz)

2 (CD3OD)

211.9s 132.9s 152.8s 130.0s 16.8q 131.4d 132.8s 75.2s 164.5s 104.9d 185.5s 129.5s

41.7d 28.9t 10.4q 26.1t 41.6t

177.1s 56.8d 133.0d 133.8s 13.6q 167.5s 75.2d 15.2q 74.1d 128.0d 138.2d

δC mult.

(dq, 2.8, 6.2) (d, 6.2) (dd, 6.8, 2.3) (ddd, 16.0, 6.8, 1.1) (dd, 15.7, 5.5)

5.85 (s)

2.28 (s) 7.21 (s)

1.85 (m) 1.48 (m) 1.23 (m) 0.72 (t, 7.4) 1.46 (m) 1.21 (m) 2.76 (ddd, 16.8, 9.6, 6.9) 2.63 (ddd, 15.2, 10.0, 5.1)

4.66 1.54 3.91 4.94 5.53

2.05 (s)

4.07 (d, 11.2) 6.10 (dd, 11.2, 0.6)

δH (mult., J in Hz)

3 (CD3OD)

Table 1. 1H and 13C NMR Data of Compounds 1−5 at 600 and 125 MHz, Respectively (δ in ppm, J in Hz)

212.0s 126.7s 153.1s 133.2s 17.0q 132.0d 134.5s 74.9s 164.6s 103.9d 185.6s 130.0s

42.3d 29.0t 11.8q 30.7t 43.8t

178.5s 56.1d 131.7d 137.2s 21.7q 168.0s 78.9d 17.0q 67.2d 125.7d 138.5d

δC mult.

(dq, 4.1, 6.4) (d, 6.4) (td, 4.1, 1.3) (dd, 16.1, 5.0) (dd, 12.4, 6.5)

5.79 (s)

2.22 (s) 7.35 (s)

1.53 (m) 1.38 (m) 1.10 (m) 0.77 (t, 7.4) 1.54 (m) 1.40 (m) 2.88 (ddd, 16.2, 8.8, 2.3) 2.48 (ddd, 16.2, 9.7, 2.2)

3.90 1.00 5.07 4.31 5.24

2.18 (d, 0.9)

4.94 (d, 10.3) 6.54 (dd, 10.3, 1.3)

δH (mult., J in Hz)

4 (CD3OD)

208.5s 122.2s 158.2s 133.7s 16.5q 131.4d 130.4s 178.4s 135.6s 128.7s 182.4s 124.5s

39.7d 22.8t 12.0q 24.8t 38.4t

164.3s 122.8d 145.3d 50.5s 24.7q 172.2s 69.1d 19.6q 79.8d 123.8d 142.6d

δC mult.

2.36 (s) 8.00 (s)

3.89 (br s) 1.20 (d, 6.4) 5.39 (br s) 5.30 (m) 6.12 (dd, 15.8, 11.0) 1.27 (m) 1.28 (m) 0.88 (t, 7.2) 2.39 (m) 1.39 (m) 2.78 (m) 2.17 (dt, 17.4, 8.5)

1.58 (s)

6.10 (d, 12.5) 6.37 (d, 12.5)

δH (mult., J in Hz)

5 (CDCl3)

Journal of Natural Products Article

dx.doi.org/10.1021/np400474s | J. Nat. Prod. 2013, 76, 2175−2179

Journal of Natural Products

Article

(v/v/v) at room temperature, and the crude extract was decanted and concentrated under reduced pressure and sequentially solventpartitioned into petroleum ether- and MeOH-soluble extracts. The MeOH extract was chromatographed over Sephadex LH-20 eluted with MeOH to obtain eight fractions: Fr. 1−8. In accordance with the TLC results, hygrocins were in Fr. 6 and Fr. 7. The combined Fr. 6 and Fr. 7 (1.5 g) was subjected to MPLC (80 g RP-18 silica gel; 30%, 50%, 70% MeOH−H2O and 2 L of MeOH, respectively) to afford 13 subfractions: Fr. 1−2 obtained from 30%, Fr. 3−7 from 50%, Fr. 8−10 from 70%, and Fr. 11−13 from 100% MeOH. In accordance with the TLC results, Fr. 1−2, Fr. 3−5, and Fr. 11−13 were combined and marked as Fr. A, Fr. B, and Fr. C, respectively. Fr. A was chromatographed over Sephadex LH-20 (60 g; MeOH) to obtain Fr. A1 (64 mg) and Fr. A2 (40 mg). Fr. B was chromatographed over Sephadex LH-20 (120 g; MeOH) to obtain Fr. B1 and Fr. B2, which were combined with Fr. A1 and Fr. A2, respectively. The resulting Fr. A1 (530 mg) was purified by MPLC (40 g RP-18 silica gel; 40% and 600 mL, 45% and 600 mL, 50% and 200 mL MeOH−H2O and 200 mL MeOH, respectively) to afford: Fr. A1a−A1e. Fr. A1a (26 mg) was purified by CC (0.6 g, SiO2; CH2Cl2, 20 mL; CH2Cl2−MeOH 30:1, 62 mL) to afford 1 (19 mg). Fr. A1b (12 mg) was further purified by CC (0.6 g, SiO2; CH2Cl2, 20 mL; 50:1, 51 mL; 30:1, 46.5 mL of CH2Cl2−MeOH) to afford 3 (2 mg). Fr. A1c (16 mg) was further purified by CC (0.56 g, SiO2; 100:1, 30 mL; 50:1, 25.5 mL; 40:1, 20.5 mL CH2Cl2−MeOH) to afford 4 (2 mg). Fr. A1e (25 mg) was subjected to reversed-phase HPLC (Agilent 1200 instrument; ZORBAX Eclipse XDB-C18 9.4 × 250 mm, 5 μm) eluting with 40% CH3CN at a flow rate of 4.0 mL/min to yield 6 (tR = 15 min, 6.6 mg). The resulting Fr. A2 (220 mg) was purified by MPLC (40 g RP-18 silica gel; 40% of 600 mL, 50% of 600 mL, and MeOH of 200 mL MeOH−H2O, respectively) and further purified by CC (0.6 g, SiO2; 50:1 and 25.5 mL; 40:1 and 20.5 mL of CH2Cl2−MeOH) to afford 2 (8 mg). Fr. C was chromatographed over Sephadex LH-20 (120 g; MeOH), and then purified by MPLC (40 g RP-18 silica gel; 55% and 500 mL and 73% and 300 mL of MeOH−H2O and 200 mL of MeOH, respectively), and finally purified by reversed-phase HPLC (Agilent 1260 instrument; ZORBAX Eclipse XDB-C18 9.4 × 250 mm, 5 μm) eluted with 40% CH3CN at a flow rate of 4.0 mL/min to obtain 5 (tR = 30 min, 4.0 mg). X-ray Crystallography of 1. Single crystals of 1 with appropriate dimensions were chosen under an optical microscope and quickly coated with high vacuum grease (Dow Corning Corporation) before being mounted on a glass fiber for data collection. Data for 1 was

Figure 2. The selected 1H−1H COSY, HMBC, and ROESY correlations for hygrocin C (1). Disruption of gdmAI. The gdmAI-disrupted mutant of strain LZ35 was obtained by the Redirect technology, according to the literature protocol with some modifications.7 The LZ35 genomic library was constructed and screened by PCR using the primers GDMPKSF1 (CCGACGCTCTACCACCATCT) and GDMPKSR1 (AACCCAATCCAGCCTCAGCA) to obtain the fosmid 6A2, containing the intact gdmAI. In fosmid 6A2, the gdmAI was replaced with the apramycin-resistance cassette [aac(3)IV] amplified with the primers gdmAIPTF (CCGCGCGCCCTGCTTCGAACCGAGAGGTGTGGCGGCATGATTCCGGGGATCCGTCGACC) and gdmAIPTR (GTCATCCGCCTCCGCCGCGGGCACGACCGCTTCCGGTGCTGTAGGCTGGAGCTGCTTC) from pIJ773. The resulting fosmid, pSR100, was transformed into Escherichia coli DH5α cells containing the temperature sensitive FLP recombination plasmid PCP20 to excise the aac(3)IV cassette, yielding the pSR101. Due to the native chloramphenicol resistance of strain LZ35, the chloramphenicol resistance gene on pSR101 was replaced with the aac(3)IV cassette by application of the same procedure, resulting in pSR102. This fosmid was introduced into strain LZ35 by conjugation with E. coli ET12567 (pUZ8002). Mutants were selected on 30 μg/mL apramycin and then grown under nonselective conditions and verified by PCR using the primers GDMPKSYZF (AGGGGGAATGAGGGGGCTGTTTAGG) and GDMPKSYZR (AAGACGGGCGAGGTGTGGAGGAGTT) (Figrure S1 of the Supporting Information). The resulting deletion strain was named LZ35ΔGPKS. Fermentation, Extraction, and Isolation. The gdmAI mutant strain LZ35ΔGPKS was inoculated on oatmeal medium (oatmeal 20 g, saline salt 1 mL, agar 20 g, pH 7.2) in Petri dishes and cultivated for 7 d at 28 °C to afford a seed culture. The fermentation (30 L) was performed on oatmeal medium for 11 d at 28 °C. The culture was diced and extracted three times with EtOAc−MeOH−AcOH 80:15:5

Figure 3. X-ray crystal structure for 1. 2178

dx.doi.org/10.1021/np400474s | J. Nat. Prod. 2013, 76, 2175−2179

Journal of Natural Products

Article

(3) Cassady, J. M.; Chan, K. K.; Floss, H. G.; Leistner, E. Chem. Pharm. Bull. (Tokyo) 2004, 52, 1−26. (4) Shi, N.; Wang, H.; Lu, C.; Liu, Z.; Shen, Y. Chin. Pharm. J. 2011, 46, 1317−1320. (5) Cai, P.; Kong, F.; Ruppen, M. E.; Glasier, G.; Carter, G. T. J. Nat. Prod. 2005, 68, 1736−1742. (6) Ding, L.; Maier, A.; Fiebig, H. H.; Gorls, H.; Lin, W. H.; Peschel, G.; Hertweck, C. Angew. Chem., Int. Ed. 2011, 50, 1630−1634. (7) Yu, D.; Ellis, H. M.; Lee, E. C.; Jenkins, N. A.; Copeland, N. G.; Court, D. L. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 5978−5983. (8) Mosmann, T. J. Immunol. Methods 1983, 65, 55−63. (9) SMART, SAINT, and SADABS; Bruker AXS Inc.: Madison, Wisconsin, 1998. (10) Sheldrick, G. M. Acta Crystallogr. 2008, A64, 112−122. (11) Spek, A. L. Implemented as the PLATON Procedure, a Multipurpose Crystallographic Tool; Utrecht University: Utrecht, The Netherlands, 1998.

collected on a Bruker SMART APEX II CCD diffractometer with graphite-monochromated Mo Kα radiation source (λ = 0.71073 Å), operating at 50 kV and 40 mA by using a multiscan technique at room temperature. A preliminary orientation matrix and unit cell parameters were determined from 3 runs of 12 frames each, each frame corresponds to a scan in 5 s, followed by spot integration and leastsquares refinement. Data were measured using ω scans for 10 s per frame, until a complete hemisphere had been collected. Cell parameters were retrieved using SMART and refined with SAINT on all observed reflections. Data reduction was performed with SAINT and corrected for Lorentz and polarization effects. Absorption corrections were made using the SADABS program.9 The structures were solved using direct methods and successive Fourier difference synthesis (SHELXS-97),10 and they were refined using the full-matrix least-squares method on F2 with anisotropic thermal parameters for all nonhydrogen atoms (SHELXL-97).11 Atoms were located from iterative examination of difference F-maps, following least-squares refinements of the earlier models. Hydrogen atoms were placed in calculated positions and included as riding atoms with isotropic displacement parameters 1.2−1.5 times Ueq of the attached C atoms. Structure was examined using the Addsym subroutine of PLATON,9 to ensure that no additional symmetry could be applied to the models. Crystal data: yellow block; C28H31NO8, Mr = 509.54, monoclinic, P21/c, a = 9.630 (3) Å, b = 9.913 (3) Å, c = 13.627 (4) Å, β = 90.466 (5)°, V = 1300.9 (7) Å3, 4518 reflections, 339 parameters; crystal size 0.10 × 0.12 × 0.14 mm.3 The final indices were R1 = 0.0824, wR2 = 0.2446 [I > 2σ(I)]. Crystallographic data for compound 1 have been deposited as Supporting Information at the Cambridge Crystallographic Data Centre (deposition no. CCDC 943598). Cytotoxicity Assays. Effects of hygrocins on the cell viabilities and proliferations were determined using the MTT (microculture tetrazolium [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide], Sigma) assay.8 Cisplatin was used as a positive control in this study. The growth-inhibitory effect of cisplatin (5 μg/mL) on breast cancer MDA-MB-431 cells, prostate cancer PC3 cells, alveolar basal epithelial cells A549, colorectal cancer SW620 cells, and hepatocellular liver carcinoma cells HepG2 were 90.99%, 85.78%, 60.36%, 89.64%, and 95.99%, respectively.

■

ASSOCIATED CONTENT

S Supporting Information *

The information on disruption of gdmAI and NMR data of compounds 1−6. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. Tel: (+86) 0531 − 88382108. *E-mail: [email protected]. Author Contributions ⊥

C.H., Y.L. and J.D. contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was financially supported by the 973 Programs (Grants 2010CB833802 and 2012CB721005) and the Independent Innovation Foundations of Shandong University (Grants 2010TB016 and 2010TS072).

■

REFERENCES

(1) Fukuyo, Y.; Hunt, C. R.; Horikoshi, N. Cancer Lett. 2010, 290, 24−35. (2) Floss, H. G.; Yu, T. W. Chem. Rev. 2005, 105, 621−632. 2179

dx.doi.org/10.1021/np400474s | J. Nat. Prod. 2013, 76, 2175−2179