Identification and Characterization of Novel Immunogenic Proteins of Streptococcus suis Serotype 2 Hongran Geng,†,# Li Zhu,†,# Yuan Yuan,†,# Wei Zhang,†,# Wenjun Li,† Jie Wang,‡ Yuling Zheng,† Kaihua Wei,‡ Wuchun Cao,*,† Hengliang Wang,*,† and Yongqiang Jiang*,† State Key Laboratory of Pathogen and Biosecurity, Academy of Military Medical Sciences, No. 20 Dongda Street, Fengtai District, Beijing 100071, People’s Republic of China, and National Center of Biomedical Analysis, Beijing, 100850, People’s Republic of China Received March 16, 2008
Streptococcus suis, a zoonotic pathogen, caused serious outbreaks in humans with high mortality rates in the past decade. To develop safer and more effective vaccines, particularly for human protection, cell wall and extracellular proteins of S. suis serotype 2 were analyzed by an immunoproteomic approach in this study. Thirty-two proteins with high immunogenicity were identified and 22 of them were newly identified. Further analyses of 9 selected proteins revealed that (1) these 9 proteins were expressed in all tested virulent S. suis serotype 2 isolates, (2) antisera against 6 of the selected proteins efficiently killed the bacteria by opsonized phagocytosis in human blood, and (3) significantly higher levels of serum antibodies against 3 proteins were detected in both patients and infected swines. Therefore, our results suggest the 3 proteins (SSU98_0197, SSU98_1094 and SSU1664) have strong potential to be vaccine candidates. Keywords: Streptococcus suis • immunoproteomics • vaccine candidate • cell wall protein • extracellular protein
Introduction Streptococcus suis serotype 2 (SS2) infection is one of the major causes of septicemia, arthritis, meningitis, and sudden death in pigs.1,2 It also becomes a public health concern due to its zoonotic capability to cause severe infections in slaughterhouse workers and those who handle infected pork.3–5 S. suis infections in humans were sporadically reported worldwide.6–8 However, two outbreaks have occurred in humans in China with high mortality (19-56%). In these outbreaks, streptococcal toxic shock-like syndrome was a major etiological and mortality factor.9,10 While there have been extensive studies on these outbreaks, the attempts to control the infection in both humans and animals were hampered by the lack of an effective vaccine. Therefore, it is necessary to search better protective antigens for formulation of the most effective vaccine for human. Some studies were designed to develop whole-cell based vaccines by using the inactivated form of S. suis or avirulent mutants of S. suis.11–14 Although promising for piglet, these whole-cell based vaccines might have limited uses against SS2 infection in humans due to serious side effects. Since the capsular polysaccharide of S. suis plays an important role in virulence, some attempts have been made to develop capsulebased vaccines. However, they showed poor immunogenicity.15 * To whom correspondence should be addressed. Tel: +86-10-66948487. E-mails:
[email protected] (Y.J.),
[email protected] (W.C.), wanghl@ nic.bmi.ac.cn (H.W.). # These authors contributed equally to this work. † State Key Laboratory of Pathogen and Biosecurity, Academy of Military Medical Sciences. ‡ National Center of Biomedical Analysis.
4132 Journal of Proteome Research 2008, 7, 4132–4142 Published on Web 07/16/2008
In recent years, more studies have focused on protein-based vaccines. It has been shown that several virulence-related proteins such as muramidase-released protein (MRP), extracellular factor (EF) and suilysin (SLY) were able to provide some degree of protection against challenge with S. suis.16,17 However, further studies are still needed to find novel and more efficient immunoprotective antigens to develop new vaccines for fighting against SS2 infection in humans. Identifying immunogenes is crucial for vaccine development and recent progresses in genomic and proteomic technologies have made it possible to perform global profiling of immunogenic proteins for bacterial pathogens.18–20 Because of the important roles of bacterial cell wall proteins (CWPs) and extracellular proteins (ECPs) in adhesion, nutrient uptake, antiphagocytosis and host damage,21 these proteins have been considered important targets for vaccine development and sero-diagnosis.21,22 However, CWPs were hard to purify and solubilize for global analysis on 2D gels due to their hydrophobic nature. In this work, the CWPs were extracted by mutanolysin treatment, which has been used in a number of studies for the isolation of cell wall components without cytoplasmic contamination.23,24 Our results revealed different patterns of protein distribution and more protein spots in 2D gel, comparing with that reported by others.25 Using an immunoproteomic approach, we identified 32 CWPs and ECPs with high immunogenicity in SS2. Among these proteins, 22 were identified for the first time. Eight known cell wall attached proteins, including 6 proteins containing the LPXTG motif, were identified in this work. 10.1021/pr800196v CCC: $40.75
2008 American Chemical Society
research articles
Novel Immunogenic Proteins of S. suis Serotype 2 Table 1. Bacterial Strains and Plasmids Used in This Study discriptiona
strains or plasmids
S. suis S. suis 98012 S. suis 98013 S. suis 05ZY S. suis SUN S. suis 4 S. suis 5 S. suis 606 S. suis 607 S. suis 1940 S. suis 1941 S. suis NJ S. suis 4005 S. suis S735 S. suis T15 S. suis 1330 E. coli DH5R BL21 Plasmids pMD-18T pET32a(+) a
MRP+EF+SLY+89K+ MRP+EF+SLY+89K+ MRP+EF+SLY+89K+ MRP+EF+SLY+89K+ MRP+EF+SLY+89K+ MRP+EF+SLY+89K+ MRP+EF+SLY+89KMRP+EF+SLY-89KMRP+EF+SLY+89KMRP+EF+SLY+89KMRP+EF+SLY+89KMRP+EF+SLY+89KMRP+EF*SLY+89KMRP-EF-SLY+89KMRP-EF-SLY-89K-
originb
source
Jiangsu, China HP, 1998 Jiangsu, China HP, 1998 Sichuan, China HP, 2005 Jiangsu, China HP, 2006 Sichuan, China DP, 2005 Sichuan, China DP, 2005 China DP, 1980s Japan DP China DP, 1980s China DP, 1980s Jiangsu, China DP The Netherlands DP The Netherlands DP Europe HPL Canada HPL
This work This work This work This work This work This work This work This work This work This work This work Wisselink, H. J. Wisselink, H. J. Wisselink, H. J. Dr. M. Gottschalk
Host for cloning vector Host for expression vector cloning vector expression vector
89K, 89K pathogenicity islands (PAI).
b
Takara, Japan Novagen
HP, human patients; DP, diseased piglets; HPL, healthy piglets.
We further analyzed 9 selected immunogenic proteins in Western blot analysis and found all these proteins were conserved in virulent SS2 strains. In the bactericidal assay, antisera against 6 of the selected proteins had significant growth-inhibitory activity in human blood. Furthermore, the titers of the specific antibodies against 4 proteins were higher in sera of patients compared with the healthy people, and titers of the specific antibodies against 4 proteins were increased in sera from both infected and immunized piglets. There are 3 proteins in common. Therefore, we have identified 3 proteins as new potential vaccine candidates. These significant results supplement the previous studies to establish an antigenic profile of SS2 which is valuable for studying pathogenicity and developing vaccines and serodiagnostic markers in the future.
Materials and Methods Bacterial Strains, Plasmids, and Culture Conditions. The SS2 strain 98012, used for the immunoproteomic analysis, was isolated from clinically infected patients during the Chinese outbreaks in 1998. The other strains of S. suis used in this study, Escherichia coli strains and plasmids used for expression of recombinant proteins in this study are listed in Table 1. SS2 strains were maintained on Columbia blood agar containing 6% sheep blood and cultured in Todd-Hewitt broth containing 0.2% yeast extract (THY) at 37 °C. E. coli strains were grown in Luria-Bertani (LB) medium at 37 °C. Antisera from Rats, Piglets, and Patients. Antisera against whole cells and extracellular proteins of SS2 were obtained by immunization of Wistar rats and piglets with strain 98012 subcutaneously 5 times at multiple sites as described before.29 Two non-SPF piglets were immunized with inactivated whole cell of strain 98012, and the sera before and after immunization were collected. The polyclonal antisera against each recombinant protein were obtained from Wistar rats, and the immunized rats were bled 7 days after the final immunization. The sera from one experimentally infected swine before and after infection were kindly provided by professor Xiuzhen Pan.
Human sera samples were obtained from 5 healthy individuals and 6 convalescent patients infected with SS2 suffering from meningitis or streptococcal toxic shock-like syndrome. All the sera were collected during 1 to 2 weeks after the infection. Preparation of Extracellular Proteins (ECPs) and Cell Wall Proteins (CWPs). SS2 culture supernatants were harvested by centrifugation (10 000g for 10 min at 4 °C) of cultures (300 mL) grown to late-exponential phase. After treatment with a protease inhibitor cocktail (Roche Applied Science, Germany) and filtration through a 0.22 µm membrane, the ECPs were precipitated with 15% acetone-Trichloroacetic Acid (TCA) for 1 h on ice and collected by centrifugation at 10 000g for 20 min at 4 °C. To remove the TCA, the precipitated proteins were washed 4 times with ice-cold acetone containing 0.1% DTT and air-dried with a speed-vacuum. For the CWPs, bacterial pellets from 300 mL cultures were washed three times with PBS and dissolved in a separation buffer containing 30 mM Tris-HCl (pH 7.5), 3 mM MgCl2, 25% sucrose and mutanolysin (125 U/mL).26 After incubation for 1.5 h at 37 °C, the protoplast fraction was separated by centrifugation at 10 000g for 10 min at 4 °C, and the supernatant containing CWPs was subject to the acetone-TCA precipitation process described above. For the samples used for the immunoblot analysis of the expression of immunogenic proteins, the supernatants containing CWPs were separated directly by SDS-PAGE without TCA precipitation. Both ECPs and CWPs were solubilized with a lysis buffer containing 7 M Urea, 2 M Thiourea, 4% (w/v) CHAPS, 50 mM DTT and protease inhibitor cocktail. Protein concentrations were determined by the PlusOne 2-D Quant Kit (GE Healthcare). Two-Dimensional Polyacrylamide Gel Electrophoresis (2-DE) and In-Gel Protein Digestion. In our previous experiment, all of the ECPs and CWPs were basically scattered in the pI ranges of pH 4-7 when pH 3-10 immobilized pH gradient (IPG) strips (18 cm) were used (data not shown). To obtain better separation, we used pH 4-7 IPG strips (18 cm, GE Healthcare) in the isoelectric focusing (IEF) analysis. For each Journal of Proteome Research • Vol. 7, No. 9, 2008 4133
research articles
Geng et al.
Table 2. Primers, Vectors, and Cloning Sites Used in Gene Expression protein
forward primer (5′-3′)
reverse primer (5′-3′)
vector/cloning sites
SSU98_0171 SSU98_0197 SSU98_0201 SSU98_0267 SSU98_1094 SSU98_1549 SSU98_1675 SSU98_1819 SSU1664 MRP
gcggatccaagaaaattggtcgctatgtta gcgaattcacgacagagacttcaacagctac gcggatcctcaacaaaagttaaaaca tagaattcagcaagcagaaagttgtgtc gcgaattcaacaagaaacttgttggactg gcggatccaaaaagaatattcggttg gcggatccaatagcaagattttttcgttgag gcggatccgagcttgaaggaactccttcaac gcgaattcaaaaagacaacgaaactttttgc gcgaattcgatgaaactgttgcttcatcag
gcctcgagtttttcagttgctaattcagc cgctcgaggatttgatctttagattttttg atctcgagagcttgacctgaaacttca gcctcgagttcttcttttttgtttttgaatag atctcgagaggtttttcaggaacttctac atctcgagctccccttccttacgtctca gcctcgagctcactttctgttatctttttc gcgaattccgttttcctcgagaaaaatatctc atctcgagttctgccactacacccttatc cgctcgagatcttcgttacgacgacgttttcttgc
pET32a(+)/BamHI, XhoI pET32a(+)/EcoRI, XhoI pET32a(+)/BamHI, XhoI pET32a(+)/EcoRI, XhoI pET32a(+)/EcoRI, XhoI pET32a(+)/BamHI, XhoI pET32a(+)/BamHI, XhoI pET32a(+)/BamHI, EcoRI pET32a(+)/EcoRI, XhoI pET32a(+)/EcoRI, XhoI
analysis, 1 mg of ECPs or 300 µg of CWPs suspended in 350 µL rehydration buffer [7 M Urea, 2 M Thiourea, 4% (w/v) CHAPS, 50 mM DTT] was loaded. The following procedure and the ingel protein digestion were carried out as described previously.27 Peptides from digested proteins were resolubilized in 2 µL of 0.5% trifluoroactic acid. MALDI-TOF-MS and NanoLC-FT ICR MS/MS. The MALDITOF MS measurement was performed on a Bruker Reflex III MALDI-TOF-MS (Bruker Daltonics, Germany) operating in reflectron mode with 20 kV accelerating voltage and 23 kV reflecting voltage. A saturated solution of R-cyano-4-hydroxycinnamic acid in 50% acetonitrile and 0.1% trifluoroactic acid was used as the matrix. One microliter of the matrix solution and sample solution at a ratio of 1:1 was applied onto the Score384 target well. Mass accuracy for peptide mass fingerprints (PMF) analysis was calibrated with a 0.1-0.2 Da external standard, and internal calibration was carried out with enzyme autolysis peaks, resolution at 12 000. The nanoLC-MS/MS analysis was performed on an APEX-Q FT-ICR tandem mass spectrometer (Bruker Daltonics, Germany) equipped with a 9.4 T superconducting magnet (Magnex Scientific, U.K.) and an infinity cell. The trypsin digest peptides were sequenced by autoMSn mode with MS/MS boost function. The FT-ICR mass spectra were processed using DataAnalysis 3.4 software (Bruker Daltonics GmbH, Germany) as a gateway to set up database searches. Data Interpretation and Database Searching. To avoid inaccurate annotations derived from single genome or divergent protein sequences between strains, we established a local database including all the predicted protein sequences of three SS2 strains 98HAH33, 05ZYH33 and P1/7. Peptide mass fingerprints (PMFs) were searched by the program Mascot (Matrix Science Ltd.) licensed in-house against this local combined database, and the results were checked using Mascot with free access on the Internet (http://www.matrixscience.com) against NCBInr database. Monoisotopic masses were used to search the databases, allowing a peptide mass accuracy of 0.3 Da and one partial cleavage. Oxidation of methionine and carbamidomethyl modification of cysteine was considered. For unambiguous identification of proteins, more than 5 peptides must be matched for MALDI-TOF data. Expression and Purification of Recombinant Proteins. To express proteins in E. coli, genes of interest amplified by PCR were cloned into the pMD-18T vector (Takara, Japan) and transformed into E. coli strain DH5R. The primers (Table 2) were synthesized by Sangon Company (Shanghai, China). The cloned gene sequences were confirmed by DNA sequencing. For protein expression, the inserts were subcloned into pET32a (+) (Novagen) and transformed into E. coli strain BL21 (DE3). Recombinant thioredoxin (TRX)-target fusion proteins were 4134
Journal of Proteome Research • Vol. 7, No. 9, 2008
purified by immobilized metal chelate affinity chromatography (GE Healthcare) in accordance with the manufacturer’s instructions. ELISA and Immunoblot Assay. An indirect enzyme-linked immunosorbent assay (ELISA) was used for measuring specific antibody levels in sera from patients and immunized piglets. The sera collected from healthy people and preimmune piglets were used as controls. In brief, ELISA plates were coated with 5 µg/mL of recombinant protein antigens in coating buffer [0.05 M NaHCO3 (pH9.6)] at 4 °C overnight and blocked with 3% BSA in PBS-T (PBS containing 0.1% Tween-20) buffer for 3 h at 37 °C. Serum samples from humans (1:500), infected piglets (1:200) and immunized piglets (1:100) in PBS-T buffer were added to the wells. Signals were detected by incubation with a horseradish peroxide-conjugated secondary antibody. Western blot was performed as described previously,28 and the rat antisera against whole cell, extracellular proteins or recombination proteins were used at a dilution of 1:1000. Bactericidal Analysis. The bacterial cultures (OD600 0.8) were washed and diluted at 1:10 with PBS, and 50 µL of the dilutions was mixed with 100 µL of each test serum. The anti-TRX sera were used as control. After incubation for 15 min at 37 °C followed with 15 min on ice, 350 µL of nonimmune whole heparinized (10 U/mL) human blood was added and the mixture was rotated end-over-end at 60 rpm for 3 h at 37 °C. Blood cells were lysed with 0.1% saponin for 20 min on ice. Finally, the bacteria were plated on Columbia agar containing 6% sheep blood. Colonies were enumerated the following day. For each serum tested, 3 different inocula were used to ensure that the growth in blood was optimal and quantifiable. The results were expressed as percent killing, which was calculated by using the following formula:29 {[(CFU after 3 h of growth with anti-TRX serum) - (CFU after 3 h of growth with immune serum)]/CFU after 3 h of growth with anti-TRX serum} × 100. All of the experiments were repeated three times.
Results 2-DE Profile of the CWPs and Identification of Immunogenic Proteins. The 2-DE profile and Western blot analysis of CWPs of SS2 98012 displayed about 300 Coomassie-stained protein spots (Figure 1A,B). As shown in Figure 1A, most of the CWP spots of our gels were located in the acidic and high molecular weight (MW) regions (50-120 kDa). This is consistent with bioinformatics analysis, which showed that 90% of the predicted CWPs by PSORTb v.2.0 (http://www.psort.org) had a MW more than 50 kDa, and that 50% had more than 100 kDa, but different from other research.25 These discrepancies might be due to the different sample preparation methods in these two studies. About 50 spots were detected
Novel Immunogenic Proteins of S. suis Serotype 2
research articles
Figure 1. 2-DE profile and Western blot analysis of CWPs (A and B) and ECPs (C and D) of S. suis. CWPs and ECPs were separated in the first dimension (18 cm) by isoelectric focusing (IEF) in the pI range of 4-7 and by 12.5% SDS-PAGE in the second dimension. Arrows indicate antigenic proteins recognized with sera from immunized rats.
by Western blot analysis., and 43 of them were selected for the following analysis. After destaining and in-gel trypsin digestion, a total of 35 spots representing 23 proteins were identified by MALDI-TOF-MS and nanoLC-FT ICR MS/MS (Table 3). Some of the spots were identified to be different fragments of one single protein with various charges, a scenario that has been observed in proteomic analysis of other pathogens.27,28 The MWs of proteins SSU98_0267 (IF-2, spots CW06/07/08/11) and SSU98_0197 (spot CW17) were found to be larger than theoretically predicted. These might be caused by the tight spatial forms of hydrophobic CWPs,30 which is difficult to entirely denature in the standard process of 2-DE. The 2-DE profile and Western blot result of ECPs of SS2 98012 strain is shown in Figure 1C,D. About 500 protein spots were detected on the 2-DE gel stained with Coomassie G-250. More protein spots were observed in the gel than expected. This could be due to contamination with cytoplasmic proteins released by dead bacteria. About 30 spots were detected by Western blot analysis, and 20 of them were selected for the
following analysis. After destaining and in-gel trypsin digestion, a total of 16 spots representing 15 proteins were identified by MALDI-TOF-MS and nanoLC-FT ICR MS/MS (Table 4). Interestingly, SSU98_1819, which is predicted to be a cell wall protein, was found in the supernatant. The experimental MW of SSU98_1819 (spots E12/13) was 70 kDa, which is 50 kDa smaller than the predicted MW (120 kDa). PMF search showed that all of the matched peptides were located in the N-terminal fragment, suggesting that the N-terminal fragment of this protein is secreted after cleavage. Data Mining. Collectively, a total of 32 proteins were identified by MALDI-TOF/MS or nanoLC-FT ICR MS/MS in this study. The cellular localizations of these proteins were predicted by PSORTb v.2.0 (http://www.psort.org) and the detailed results are summarized in Table 5. According to the cellular location analysis of sequenced SS2 genomes, 27-30 proteins were predicted to be cell wall proteins through several different prediction methods.31 Our immunoproteomic analysis detected 8 of these proteins, including 6 Journal of Proteome Research • Vol. 7, No. 9, 2008 4135
research articles
Geng et al.
Table 3. Identification of the Immunogenic CWPs by MALDI-TOF MS and NanoLC-FT ICR MS/MS theoretical MW/pI
spot ID
scoreb
locusc
GI
product
CW01 CW02 CW05 CW06 CW07 CW08 CW09
90 78 132 60 53 58 54
SSU05_0753 SSU05_0753 SSU05_0753 SSU98_0267 SSU98_0267 SSU98_0267 SSU98_0122
gi|146318407 gi|146318407 gi|146318407 gi|146320114 gi|146320114 gi|146320114 gi|146319971
CW11 CW16 CW17 CW18 CW19 CW27
CW31 CW32 CW33 CW35 CW41
82 78 96 80 74 109 63 104 61 107 95 72 71 107 95 95 150 90
SSU98_0267 SSU98_1675 SSU98_0197 SSU98_0201 SSU98_1549 SSU98_0156 SSU1664 SSU1664 SSU98_0296 SSU1664 SSU98_0156 SSU98_0156 SSU1664 SSU1664 SSU0860 SSU0860 SSU0860 SSU98_0171
gi|146320114 gi|146321522 gi|146320044 gi|146320048 gi|146321396 gi|146320006 gi|146320143 gi|146320006 gi|146320006 gi|146320020
CW44
77
CW45 CW48 CW49a CW50 CW52 CW53 CW54 CW55a
64 63 267 103 154 145 188 82 24 145 79 218 171 140 116
MRP MRP MRP Translation initiation factor 2 (IF-2; GTPase) Translation initiation factor 2 (IF-2; GTPase) Translation initiation factor 2 (IF-2; GTPase) DNA-directed RNA polymerase, beta subunit/ 140 kDa subunit Translation initiation factor 2 (IF-2; GTPase) Hypothetical protein Hypothetical protein Pyruvate-formate lyase Putative 5′-nucleotidase Predicted metalloendopeptidase Oligopeptide-binding protein OppA precursor Oligopeptide-binding protein OppA precursor Molecular chaperone Oligopeptide-binding protein OppA precursor Predicted metalloendopeptidase Predicted metalloendopeptidase Oligopeptide-binding protein OppA precursor Oligopeptide-binding protein OppA precursor Putative 5′-nucleotidase precursor Putative 5′-nucleotidase precursor Putative 5′-nucleotidase precursor ABC-type sugar transport system, periplasmic component Uncharacterized ABC-type transport system component/surface lipoprotein Hypothetical protein Hypothetical protein Sao/Ribonucleases G and E Putative triosephosphate isomerase Putative enolase Translation elongation factor EF-Tu Arca/ arginine deiminase 3-phosphoglycerate kinase Hypothetical protein Arca DNA polymerase sliding clamp subunit Hypothetical protein Ribose-phosphate pyrophosphokinase Adenylosuccinate synthase Glyceraldehyde-3-phosphate dehydrogenase
CW28 CW29 CW30
CW56 CW57 CW58a CW59 CW60
SSU98_1094 gi|146320941 SSU98_0197 SSU98_0197 SSU05_1371 SSU98_0525 SSU98_1513 SSU98_0524 SSU98_0623 SSU98_0160 SSU98_0197 SSU98_0623 SSU05_0002 SSU98_0197 SSU0918 SSU98_1971 SSU98_0158
gi|146320044 gi|146320044 gi|146321218 gi|146320372 gi|146321359 gi|146320371 gi|146320470 gi|146320009 gi|146320044 gi|146320470 gi|146317664 gi|146320044 gi|146321818 gi|146320007
experimental MW/pI
136253/4.87 131890/4.57 136253/4.87 133842/4.60 136253/4.87 120757/4.73 77173/4.66 99309/4.65 77173/4.66 92720/4.60 77173/4.66 94073/4.61 132770/5.06 92720/4.69 90727/4.56 86242/4.59 87818/4.63 87818/4.68 86242/4.49 70925/4.61
sequence matched coverage peptides
21% 22% 27% 19% 22% 30% 25%
20 20 23 12 11 13 18 18 20 18 23 14 21 17 20 13 25 21 15 16 22 14 15 19 17
77173/4.66 80570/4.79 61222/4.85 88378/5.12 70988/4.74 72554/5.05 65631/4.91 65631/4.91 64787/4.62 65631/4.91 72554/5.05 72554/5.05 65631/4.91 65631/4.91 76787/4.59 76787/4.59 76787/4.59 53326/5.92
69150/4.70 93056/4.29 89099/4.22 79928/4.21 45580/4.56
32% 39% 42% 35% 23% 38% 30% 43% 33% 47% 43% 37% 34% 38% 26% 32% 44% 40%
36292/4.76
42524/4.35
41%
12
61222/4.85 61222/4.85 67116/4.98 26622/4.68 47066/4.66 44709/4.87 48844/5.25 42048/4.85 61222/4.85 48844/5.25 41913/5.11 61222/4.85 35483/5.08 51967/7.22 39464/6.68
41500/4.33 34863/4.60 30658/4.66 28900/4.60 52514/4.67 51759/4.93 49408/5.19 46182/4.77
19% 20% 19% 57% 48% 58% 61% 5% 6% 46% 39% 14% 10% 44% 53%
10 12 10 13 18 21 27 2 2 21 12 9 3 16 14
70159/4.66 72746/4.68 72746/4.73
49873/5.12 46009/5.30 37293/5.29 50155/6.08 41813/5.76
a Data generated by NanoLC-FT ICR MS/MS. b For PMF data, scores greater than 51 are significant (p < 0.05). For MS/MS data, scores greater than 16 are significant (p < 0.05). c Three different kinds of loci in the genome annotations of three S. suis strains (98HAH33, 05ZYH33 and P1/7) are used. Proteins with high homology were assigned with a locus in the genome annotation of the 98HAH33 strain.
proteins with the LPXTG motif. Among them, SSU05_0753 (MRP) and SSU05_1371 (Sao) were reported as antigens previously,16,32 while another 6 proteins, SSU98_0197 (Hypothetical protein), SSU98_0267 (Translation initiation factor 2), SSU0860 (Putative 5′-nucleotidase precursor), SSU98_1549 (Putative 5′-nucleotidase), SSU98_1675 (Hypothetical protein) and SSU98_1819 (Ribonucleases G and E), were demonstrated as antigens for the first time. In addition, 5 immunogenic proteins were predicted to be noncytoplasmic. Among them, SSU98_1094 (uncharacterized ABC-type transport system component) was predicted to be a lipoprotein. Oligopeptide-binding protein OppA precursor (SSU1664), which was predicted to have an N-terminal signal sequence and one transmembrane domain region, was detected in CWPs as previously reported,25 indicating that it may be a membrane associated protein. Our proteomic analysis also 4136
Journal of Proteome Research • Vol. 7, No. 9, 2008
identified some proteins that have been shown to have dual localization in bacterial cells, both in the cytoplasm and on the bacterial surface in the previous studies, such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH),33 enolase,34 arginine deiminase26 and elongation factor Tu.35 Besides these, two predicted cytoplasmic proteins, SSU98_0171 and SSU98_0201, were detected in CWPs samples. Whether these proteins are truly located on the cell surface needs further investigation. Two known secreted proteins, SSU98_0179 (Extracellular Factor) and SSU05_1403 (Suilysin), were identified in ECPs. Besides the cellular location predication, we also analyzed the homology of these proteins in 4 different sequenced SS2 strains using local BLASTp program (Table 5). Strain 98HAH33 and 05ZYH33 were isolated in Asian, strain p1/7 in European, and strain 89/1591 in North American. According to the
research articles
Novel Immunogenic Proteins of S. suis Serotype 2 Table 4. Identification of the Immunogenic ECPs by MALDI-TOF MS and NanoLC-FT ICR MS/MS spot ID
scoreb
locusc
GI
product
E15 E16 E17
222 124 189 354 149 129 208 177 141 450 419 180 238 159 59 145 92 145
SSU05_0753 SSU98_0267 SSU98_0179 SSU98_0197 SSU05_1371 SSU98_0212 SSU98_0155 SSU05_1403 SSU98_0524 SSU0721 SSU98_0524 SSU98_1819 SSU98_1819 SSU98_1819 SSU98_0267 SSU98_2181 SSU98_1813 SSU98_1807
gi|146318407 gi|146320114 gi|146320028 gi|146320044 gi|146319025 gi|146320059 gi|146320004 gi|146319057 gi|146320371 gi|146320371 gi|146321666 gi|146321666 gi|146321666 gi|146320114 gi|146322028 gi|146321660 gi|146321654
E18 E19
84 134
SSU98_0158 SSU98_0158
gi|146320007 gi|146320007
Mrp Translation initiation factor 2 (IF-2; GTPase) EF/Extracellular protein Hypothetical protein Sao/Ribonucleases G and E Hypothetical protein Translation elongation factor (GTPase) SLY/Hemolysin Translation elongation factor EF-Tu Putative 30S ribosomal protein S1 Translation elongation factor EF-Tu Ribonucleases G and E Ribonucleases G and E Ribonucleases G and E Translation initiation factor 2 (IF-2;GTPase) Inosine-5′-monophosphate dehydrogenase Enoyl-coa hydratase/carnithine racemase Dehydrogenase with different specificities (related to short-chain alcohol dehydrogenase) Glyceraldehyde-3-phosphate dehydrogenase Glyceraldehyde-3-phosphate dehydrogenase
E01 E02 E03 E05a E06 E07 E08 E10a E12 E13 E14a
theoretical MW/pI
experimental MW/pI
sequence coverage
136253/4.87 77173/4.66 89991/4.83 61222/4.85 67116/4.98 80096/4.71 76663/4.88 54817/4.98 44709/4.87 43619/4.94 44709/4.87 121972/4.69 121972/4.69 121972/4.69 77173/4.66 52743/5.61 29132/4.94 25573/5.53
175382/4.52 117339/4.43 96205/4.55 79398/4.61
58361/5.88 30832/5.42 28719/5.69
37% 39% 48% 29% 12% 4% 74% 55% 55% 34% 39% 27% 32% 4% 1% 44% 59% 83%
34 22 28 15 6 3 35 23 20 15 12 31 39 4 1 19 13 21
39464/6.68 39464/6.68
41904/5.53 42348/5.67
38% 66%
11 20
79118/4.96 57338/4.82 51200/4.93 50931/4.18 70649/5.83 70399/5.91 71656/6.02
matched peptides
a Data generated by nanoLC-FT ICR MS/MS. b For PMF data, scores greater than 51 are significant (p < 0.05). For MS/MS data, scores greater than 16 are significant (p < 0.05). c Three different kinds of loci in the genome annotations of three S. suis strains (98HAH33, 05ZYH33 and P1/7) are used. Proteins with high homology were assigned with a locus in the genome annotation of the 98HAH33 strain.
Table 5. Predicted Cellular Locations of 32 Identified Proteins homologous proteins in different strainsa protein
spot ID
SSU05_0753 SSU05_1371 SSU0860 SSU98_0197
E01/CW01/CW02/CW05 E05/CW49 CW32/CW33/CW35 E05/CW17/CW45/CW48/ CW55/CW58 E02/E14/CW06/CW07/ CW08/CW11 CW19 CW16 E12/E13/E14 CW57 E07 CW27/CW28/CW29/ CW30/CW31 E03 CW44 E10 CW58 CW09 E06 CW27/CW29/CW30 E18/E19/CW60 CW55 CW41 CW18 E05 CW28 E08/E10/CW53 CW50 CW54/CW56 CW52 E17 E16 CW59 E15
SSU98_0267 SSU98_1549 SSU98_1675 SSU98_1819 SSU05_0002 SSU05_1403 SSU1664 SSU98_0179 SSU98_1094 SSU0721 SSU0918 SSU98_0122 SSU98_0155 SSU98_0156 SSU98_0158 SSU98_0160 SSU98_0171 SSU98_0201 SSU98_0212 SSU98_0296 SSU98_0524 SSU98_0525 SSU98_0623 SSU98_1513 SSU98_1807 SSU98_1813 SSU98_1971 SSU98_2181
internal helices
LPXTG
2 2 2 2
+ + + + +
1 2 3 1 1 1
2
1 2
+
signal peptide
98HAH33
05ZYH33
p1/7
89/1591
+ + +
Cell Cell Cell Cell
cellular location
wall wall wall wall
+ + + +
+ + + +
+ + + +
+ + v +
reported
+ + -
selected
*
+
Cell wall
+
+
+
+
-
*
+ + + + + +
Cell wall Cell wall Cell wall Non-Cytoplasm Non-Cytoplasm Non-Cytoplasm
+ + + + + +
+ + + + + +
+ + + + + +
+ + + + v
+ +
* * *
+ +
Non-Cytoplasm Non-Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm Cytoplasm
+ + + + + + + + + + + + + + + + + + + + +
+ + v + + + + + + v + v + + + + + + + + +
+ + + + + + + + + + + v + + + + + + + + +
+ + + + + + + + + + + + + + -
+ + + + + + -
* *
* *
a A positive result (“+”) was defined as the identity of best BLASTP hit of >50% and both the query and subject sequence coverage were >60%. Those with very high identities (>95%) but the sequence coverage less than 60% were considered variant homologous proteins (“v”).
results, those identified immunogenic proteins were all conserved in Asian and European strains, while eight proteins were missing in the North American strain 89/1591. These results suggested that the cell wall structure of Asian/ European strains might be different from North American strains, and those conserved proteins in all strains were more valuable for developing a universal effective subunit vaccine.
Our research is focused on these immunoreactive cell wall and noncytoplasmic proteins, especially those that were not reported before. Toward this goal, 9 proteins (SSU98_0171, SSU98_0197,SSU98_0201,SSU98_0267,SSU98_1094,SSU98_1549, SSU98_1675, SSU98_1819, and SSU1664) were selected for further analyses. To examine their potentials in the applications of biomarkers for SS2 serodiagnosis and vaccine Journal of Proteome Research • Vol. 7, No. 9, 2008 4137
research articles
Geng et al.
Figure 2. Detection of 9 expressed proteins from 16 different S. suis serotype 2 strains. CWPs samples of S. suis serotype 2 strains of different origin were applied to Western blots and detected by each specific antibody. Strains 1-16 represents 4, 5, 98012, 98013, NJ, 606, 607, 1940, 1941, S735, T15, 4005, 1330, SUN, 200601, 05ZY, respectively. Among these, T15 (lane 11) and 1330 (lane 13) were weakly virulent strains. The 9 proteins were detected in all of the highly virulent strains.
development, these proteins were expressed in soluble form in E. coli and purified to an apparent homogeneity (data not shown). The known immunogenic protein MRP was also expressed and used as a control in the analyses below. Distributions of the Immunogenic Proteins among Different SS2 Strains. To determine the prevalence of those selected proteins in different SS2 strains, CWPs of 16 different SS2 strains were analyzed by Western blots with specific antiserum against each of the 9 recombinant proteins (Figure 2). Although this was a qualitative analysis, the protein concentrations of all CWPs samples were adjusted to a similar load. The anti-GAPDH antibody was used as a control in this assay. Five proteins (SSU98_0171, SSU98_1094, SSU98_1549, SSU98_1819 and SSU1664) were detected in all 16 strains tested. SSU98_0197 and SSU98_0201 were not detected in S. suis 1330 and SSU98_0267 was not in S. suis T15; both are weakly virulent strains, suggesting that these proteins might contribute to virulence. Protein SSU98_0197 with a higher MW was expressed in strains NJ, 606 and S735, whereas a lower MW band of this protein was observed in strain T15. In addition, protein SSU98_0267 with a higher MW was detected in strains 606, 1941 4138
Journal of Proteome Research • Vol. 7, No. 9, 2008
and 4005. Protein SSU98_1675 was not detected in strain 1330 and a lower MW band of this protein was recognized in strains NJ, 607, 1940, S735, T15 and 4005. Whether the variations correlated with virulence is still unknown. In a word, the expressions of 9 selected proteins in all of the highly virulent strains suggested that these proteins were worthy of further study. Bactericidal Activity of Antisera. To determine the protective effect of these proteins, a standard bactericidal assay was performed. Rats were immunized 5 times with each of the recombinant proteins. Serum samples were collected, measured for specific antibody with antibody titers above 105, and used in the bactericidal assay. Anti-TRX serum was used as a negative control. As shown in Figure 3, antisera against 6 of the 9 proteins (SSU98_0171, SSU98_0197, SSU98_0267, SSU98_1094, SSU98_1819 and SSU1664) inhibited S. suis growth in human blood, suggesting that the antibodies to these proteins can provide a certain degree of protection from SS2 infection. Additionally, we found the killing percent of antiserum against MRP was more than 90%. This is the first report that antiserum to MRP has high
research articles
Novel Immunogenic Proteins of S. suis Serotype 2
are highly immunogenic in pigs. Furthermore, the results of proteins SSU98_0197, SSU98_1094 and SSU1664 from the animal studies were significant in that they paralleled those obtained from human patients, suggesting their potential roles in serving as vaccine and diagnostic targets.
Discussion
Figure 3. Opsonophagocytic killing abilities of specific antibodies elicited in rats by each recombinant S. suis proteins. The results were expressed as percent killing calculated by percentage of reduction in growth in the presence of immune serum. Each test was replicated three times. A positive response was considered percent killing greater than 50% at least in one test.
bactericidal activity against S. suis in vitro. Perhaps, this observation is due to its high abundance in the cell wall (spots CW01/CW02/CW05). Detection of Specific Antibodies against Recombinant Proteins in Sera from Patients, Infected and Immunized Piglets. To further characterize the potential of the selected proteins as vaccines, we tested the reactivity of 6 patient sera as well as 5 healthy individuals with the recombinant antigens. Besides MRP, patients showed significantly higher antibody levels against 4 antigens (SSU98_0197, SSU98_1094, SSU98_1549 and SSU1664) (P < 0.05) compared with healthy individuals (Figure 4A). This result indicates the expression and the bacterial surface exposure of these antigens in vivo, and that individuals are able to mount a humoral immune response against these proteins. Because the patient sera could not be collected at the same period after infection, the absolute values of each standard deviation (SD) calculated from patients were high. When the other 5 proteins (SSU98_0171, SSU98_0201, SSU98_0267, SSU98_1675 and SSU98_1819) were analyzed, antibody levels against SSU98_0267 and SSU98_1819 were also higher in the group of patients, although not significantly (P > 0.05). Furthermore, there were no significant differences in the antibody levels against other 3 proteins, perhaps due to poor surface exposure or low abundance in the cell wall. To gain more information for developing efficient vaccines against highly virulent strains, the specific immunoreactions in piglets caused by highly virulent strains should be further evaluated. Therefore, we assessed the specific antibody responses to the above 9 recombinant proteins by using sera isolated from both piglet infected with highly virulent SS2 and piglets immunized with killed bacteria. The sera of piglets were collected to evaluate the specific antibody response to each recombinant protein with ELISA. After experimental infections, proteins SSU98_0197, SSU98_1094, SSU98_1549, SSU98_1675 and SSU1664 induced significant antibody responses (Figure 4B). Consistent with the results obtained from the infected sera, similar specific antibody responses were achieved using immunized sera. Compared with the sera before immunization, specific antibodies against proteins SSU98_0197, SSU98_0267, SSU98_1094, SSU98_1549, and SSU1664 were significantly increased in the immunized piglets (Figure 4C). Antibodies induced by proteins SSU98_0197, SSU98_1094 and SSU1664 were as strong as that induced by MRP, indicating that they
In recent years, S. suis infection has increasingly become a public health concern due to two outbreaks in China and the discovery of 89K pathogenicity islands (PAIs).31 However, attempts to control the infection are hampered by the lack of effective vaccines. Advances in genome sequencing coupled with serologic proteome analysis has permitted development of rapid strategies to identify potential new vaccine candidates in many bacterial pathogens.28,36 In this work, we identified potential CWPs and ECPs with high immunogenicity based on immunoproteomics of S. suis. Thirty-two immunogenic proteins were identified, which included the known vaccine candidates, such as MRP (SSU05_0753), EF (SSU98_0179), SLY (SSU05_1403) and Sao32 (SSU05_1371). Zhang et al.25,37 recently identified 20 extracellular proteins and membrane-associated proteins of SS2 as immunogenic proteins by using immunoproteomics. Among those proteins, 6 known antigens, MRP (SSU05_0753), EF (SSU98_0179), Arca (SSU98_0623), Glyceraldehyde-3-phosphate dehydrogenase (SSU98_0158), Translation elongation factor EF-Tu (SSU98_0524) and enolase (SSU98_1513) and two novel antigens, OppA (SSU1664) and predicted metalloendopeptidase (SSU98_0156), were also identified in our research. In addition, eight cell wall proteins were identified in our work and 6 of them had an LPXTG motif at the carboxy terminus, a characteristic of cell wall-linked proteins of Grampositive bacteria (Table 5).38 It is surprising that the two immunogenic proteins (SSU98_0171 and SSU98_0201) that were expected to be in the cytoplasm appeared in CWPs, even though these two proteins do not possess the secretion signal and LPXTG motif. Some reports of similar phenomena have appeared previously, such as vaccine candidates, R-enolase39 and glyceraldehyde-3-phosphate dehydrogenase.40 The mechanism of location of these proteins to the cell wall remained unclear. Hence, we also selected these two proteins for further analysis. But the test results were disappointing. These two proteins did not evoke effective immunoresponse either in human nor piglets. In this study, we identified three proteins (SSU98_0197, SSU98_1094, and SSU1664) as the promising vaccine candidates. All of them were produced by highly virulent strains, could induce effective bactericidal activity, and elicit higher antibody levels in patients and infected piglets. The former 2 proteins were novel SS2 immunoreactive proteins first reported in our study. Protein SSU98_0197 (spots E05/CW17/CW45/ CW48/CW55/CW58), named here SIP1 (SS2 immunoreactive protein 1), were found in both CWPs and ECPs, and detected as multispots in our research, suggesting that both of them have different isoforms. But the function of each variant protein was unknown. SIP1 is a putative surface-anchored protein with an YSIRK type signal peptide found in many surface proteins of Streptococcus and Staphylococcus species. This protein also contains a G5 domain (pfam07501) at its C-terminal, which is found in a wide range of extracellular proteins. This domain is also found in proteins associated with metabolism of bacterial cell walls and in the peptidases which cleave human Immunoglobulin A (IgA). IgA is important in mucosal immune defense. It is a primary line of immune defense against inhaled Journal of Proteome Research • Vol. 7, No. 9, 2008 4139
research articles
Geng et al.
Figure 4. Comparison of specific antibodies against recombinant proteins from patients and healthy individuals (A), and the antibody levels before and after infection (B) and immunization (C) in piglets. ELISA experiments were performed to evaluate the specific antibody responses. Significant differences (P < 0.05) are marked (*). Three proteins (SSU98_0197, SSU_1094, and SSU1664) induced significant specific antibody responses in both patient sera and sera from infected piglets. Thioredoxin (TRX) protein was used as a negative control.
and ingested pathogens and their toxins at the mucosal surfaces of the respiratory, gastrointestinal, and genitourinary tracts. Thus, this protein may possibly play a major role in the interaction of host immunity and bacterial counter-defense; that is, it specifically attacks secretory IgA to destroy the integrity of host’s mucosal immune defense. Interestingly, BLASTp analysis also reveals that SIP1 is similar to surface protein PspC of Streptococcus pneumoniae. PspC has putative roles in adherence to the nasopharyngeal and lung epithelia and the brain microvascular endothelium. There is also evidence that PspC may mediate the invasion of host cells at these locations. PspC also specifically binds the secretory component of human secretory IgA and human factor H, as well as complement component C3.41 Some findings indicate that PspC contributes to sepsis development.42 Mice immunized by the combination of PspC and other antigens were protected against S. pneumoniae. Whether SIP1 has the similar functions and protective effects against SS2 needs further study. Protein SSU98_1094 (spot CW44), named here Lpp36 (36kD lipoprotein), is an uncharacterized ABC-type transport system component. It belongs to a family of basic membrane lipoprotein (pfam02608), which possesses a lipoprotein signal sequence with the presence of a cysteine residue at the end of 4140
Journal of Proteome Research • Vol. 7, No. 9, 2008
the hydrophobic region.43 All of the proteins of this family are outer membrane proteins and those members possessed by pathogens are antigenic in nature. Lpp36 shares 52% sequence homology with CD4+ T cell-stimulating antigen of Listeria welshimeri. Recently, lipoproteins have been the target of vaccine research for many pathogenic bacteria, such as Lpp20 of Helicobacter pylori44 and Lipoprotein NMB0928 from Neisseria meningitides.45 Particularly, lipoprotein SsuiDRAFT 0103 has been found to induce a significant protective response against SS2.46 In fact, protection of mice against challenge with virulent SS2 strains by Lpp36 has been observed in our ongoing experiments (data not shown). Protein SSU1664 (spots CW28/29/31), which is also known as oligopeptide-binding protein OppA, is the membraneanchored extracellular receptor component of an ABC transporter responsible for the uptake of oligopeptides. Additionally, its homologous protein binds soluble fibronectin and plasminogen in Treponema denticola,47 and plays a role in adherence to host cells in Mycoplasma hominis.48 These observations indicate that, as a cell-surface molecule, this protein may also mediate the adhesion of S. suis to its host tissues. Inhibition of adherence to host cells may be the basis whereby antibodies raised against OppA detrimentally inhibit the growth of SS2 in
research articles
Novel Immunogenic Proteins of S. suis Serotype 2 human blood in vitro. The immunogenicity of this protein has been identified in previous studies of many bacteria.49,50 In contrast to Zhang’s studies,25,37 where the protein was detected both in the membrane-associated proteins and extracellular proteins, we only found it in high abundance in the CWPs. Besides these 3 potential vaccine candidates, another 3 proteins (SSU98_0267, SSU98_1549 and SSU98_1675) should also be noted. Protein SSU98_0267 has the LPXTG motif and signal peptide sequence, and this type of protein had been characterized as one category of the extracellular protein of Gram-positive bacteria.51 Antiserum to protein SSU98_0267 has certain bactericidal activity against S. suis in vitro. It can also evoke significant specific antibody response in swine when killed bacteria were injected. In addition, when using the specific antiserum against SSU98_0267 to blot the cell wall samples of different strains, very strong responses were observed. But we cannot find significant higher titers of antibodies against this protein in sera from infected patients and piglets. Protein SSU98_1549 (UshA) is a member of the 5′-nucleotidase family, involving in the nucleotide transport and metabolism. According to our results, UshA is a highly immunogenic protein (see Figure 4). Protein SSU98_1675 is a hypothetical protein with an YSIRK type signal peptide, and this protein is able to induce very strong antibody response in the infected pig (see Figure 4B).
Conclusion The immunoproteomic technique is a powerful tool in discovering novel antigens of bacterial pathogens. Given the importance of the ECPs and CWPs in the bacterial pathogenesis and host immune responses, we focused on the immunogenicity of these proteins. In this report, by using a subcellular immunoproteomic approach, we identified 22 novel immunoreactive proteins. Further analyses of 9 selected proteins revealed that 3 of those proteins are immunogenic antigens which can potentially be developed as vaccine candidates.
Acknowledgment. This work was supported by grants from the National Natural Science Foundation of China (30770117 and 30600023), the National Basic Research Program (973) of China (2006CB504400), the High-Tech Research & Development Project 863 (2006AA02Z404), and the National Key Technologies R&D program (2006BAD06A02). The unpublished genome annotation of S. suis P1/7 strain was kindly provided by Dr. Matthew Holden of the Wellcome Trust Sanger Institute. We thank Professor Fengcai Zhu for providing the antisera, and we thank Dr. Xinming Song and Dr. Beinan Wang for critical review of the manuscript.
(7)
(8) (9)
(10) (11)
(12)
(13) (14)
(15)
(16)
(17) (18) (19)
(20) (21) (22)
(23)
References (1) Clifton-Hadley, F. A. Streptococcus suis type 2 infections. Br. Vet. J. 1983, 139 (1), 1–5. (2) Touil, F.; Higgins, R.; Nadeau, M. Isolation of Streptococcus suis from diseased pigs in Canada. Vet. Microbiol. 1988, 17 (2), 171– 177. (3) Arends, J. P.; Zanen, H. C. Meningitis caused by Streptococcus suis in humans. Rev. Infect. Dis. 1988, 10 (1), 131–137. (4) Halaby, T.; Hoitsma, E.; Hupperts, R.; Spanjaard, L.; Luirink, M.; Jacobs, J. Streptococcus suis meningitis, a poacher’s risk. Eur. J. Clin. Microbiol. Infect. Dis. 2000, 19 (12), 943–945. (5) Robertson, I. D.; Blackmore, D. K. Occupational exposure to Streptococcus suis type 2. Epidemiol. Infect. 1989, 103 (1), 157– 164. (6) Shahein, Y. E.; Pons, P.; Gonzalez, F.; Borge, C.; Perea, A.; Tarradas, C.; Luque, I.; de, A. D.; bdel-Aziz. Epidemiological relationship of
(24) (25) (26)
(27)
human and swine Streptococcus suis isolates. J. Vet. Med., Ser. B 2001, 48 (5), 347–355. Tang, J.; Wang, C.; Feng, Y.; Yang, W.; Song, H.; Chen, Z.; Yu, H.; Pan, X.; Zhou, X.; Wang, H.; Wu, B.; Wang, H.; Zhao, H.; Lin, Y.; Yue, J.; Wu, Z.; He, X.; Gao, F.; Khan, A. H.; Wang, J.; Zhao, G. P.; Wang, Y.; Wang, X.; Chen, Z.; Gao, G. F. Streptococcal toxic shock syndrome caused by Streptococcus suis serotype 2. PLoS Med. 2006, 3 (5), e151. Kay, R.; Cheng, A. F.; Tse, C. Y. Streptococcus suis infection in Hong Kong. QJM 1995, 88 (1), 39–47. Yu, H.; Jing, H.; Chen, Z.; Zheng, H.; Zhu, X.; Wang, H.; Wang, S.; Liu, L.; Zu, R.; Luo, L.; Xiang, N.; Liu, H.; Liu, X.; Shu, Y.; Lee, S. S.; Chuang, S. K.; Wang, Y.; Xu, J.; Yang, W. Human Streptococcus suis outbreak, Sichuan, China. Emerg. Infect. Dis. 2006, 12 (6), 914– 920. Sriskandan, S.; Slater, J. D. Invasive disease and toxic shock due to zoonotic Streptococcus suis: an emerging infection in the East? PLoS Med. 2006, 3 (5), e187. Fittipaldi, N.; Harel, J.; D’Amours, B.; Lacouture, S.; Kobisch, M.; Gottschalk, M. Potential use of an unencapsulated and aromatic amino acid-auxotrophic Streptococcus suis mutant as a live attenuated vaccine in swine. Vaccine 2007, 25 (18), 3524–3535. Pallares, F. J.; Schmitt, C. S.; Roth, J. A.; Evans, R. B.; Kinyon, J. M.; Halbur, P. G. Evaluation of a ceftiofur-washed whole cell Streptococcus suis bacterin in pigs. Can. J. Vet. Res. 2004, 68 (3), 236– 240. Holt, M. E.; Enright, M. R.; Alexander, T. J. Immunisation of pigs with killed cultures of Streptococcus suis type 2. Res. Vet. Sci. 1990, 48 (1), 23–27. Kebede, M.; Chengappa, M. M.; Stuart, J. G. Isolation and characterization of temperature-sensitive mutants of Streptococcus suis: efficacy trial of the mutant vaccine in mice. Vet. Microbiol. 1990, 22 (2-3), 249–257. Elliott, S. D.; Clifton-Hadley, F.; Tai, J. Streptococcal infection in young pigs. V. An immunogenic polysaccharide from Streptococcus suis type 2 with particular reference to vaccination against streptococcal meningitis in pigs. J. Hyg. (London) 1980, 85 (2), 275– 285. Wisselink, H. J.; Vecht, U.; Stockhofe-Zurwieden, N.; Smith, H. E. Protection of pigs against challenge with virulent Streptococcus suis serotype 2 strains by a muramidase-released protein and extracellular factor vaccine. Vet. Rec. 2001, 148 (15), 473–477. Jacobs, A. A.; van den Berg, A. J.; Loeffen, P. L. Protection of experimentally infected pigs by suilysin, the thiol-activated haemolysin of Streptococcus suis. Vet. Rec. 1996, 139 (10), 225–228. Chen, Z.; Peng, B.; Wang, S.; Peng, X. Rapid screening of highly efficient vaccine candidates by immunoproteomics. Proteomics 2004, 4 (10), 3203–3213. Vytvytska, O.; Nagy, E.; Bluggel, M.; Meyer, H. E.; Kurzbauer, R.; Huber, L. A.; Klade, C. S. Identification of vaccine candidate antigens of Staphylococcus aureus by serological proteome analysis. Proteomics 2002, 2 (5), 580–590. Krah, A.; Jungblut, P. R. Immunoproteomics. Methods Mol. Med. 2004, 94, 19–32. Navarre, W. W.; Schneewind, O. Surface proteins of gram-positive bacteria and mechanisms of their targeting to the cell wall envelope. Microbiol. Mol. Biol. Rev. 1999, 63 (1), 174–229. Trost, M.; Wehmhoner, D.; Karst, U.; Dieterich, G.; Wehland, J.; Jansch, L. Comparative proteome analysis of secretory proteins from pathogenic and nonpathogenic Listeria species. Proteomics 2005, 5 (6), 1544–1557. Hughes, M. J.; Moore, J. C.; Lane, J. D.; Wilson, R.; Pribul, P. K.; Younes, Z. N.; Dobson, R. J.; Everest, P.; Reason, A. J.; Redfern, J. M.; Greer, F. M.; Paxton, T.; Panico, M.; Morris, H. R.; Feldman, R. G.; Santangelo, J. D. Identification of major outer surface proteins of Streptococcus agalactiae. Infect. Immun. 2002, 70 (3), 1254–1259. Mujahid, S.; Pechan, T.; Wang, C. Improved solubilization of surface proteins from Listeria monocytogenes for 2-DE. Electrophoresis 2007, 28 (21), 3998–4007. Zhang, W.; Lu, C. P. Immunoproteomic assay of membraneassociated proteins of Streptococcus suis type 2 China vaccine strain HA9801. Zoonoses Public Health 2007, 54 (6-7), 253–259. Winterhoff, N.; Goethe, R.; Gruening, P.; Rohde, M.; Kalisz, H.; Smith, H. E.; Valentin-Weigand, P. Identification and characterization of two temperature-induced surface-associated proteins of Streptococcus suis with high homologies to members of the Arginine Deiminase system of Streptococcus pyogenes. J. Bacteriol. 2002, 184 (24), 6768–6776. Jing, H. B.; Yuan, J.; Wang, J.; Yuan, Y.; Zhu, L.; Liu, X. K.; Zheng, Y. L.; Wei, K. H.; Zhang, X. M.; Geng, H. R.; Duan, Q.; Feng, S. Z.;
Journal of Proteome Research • Vol. 7, No. 9, 2008 4141
research articles (28)
(29) (30)
(31)
(32)
(33)
(34)
(35)
(36)
(37) (38) (39)
4142
Yang, R. F.; Cao, W. C.; Wang, H. L.; Jiang, Y. Q. Proteome analysis of Streptococcus suis serotype 2. Proteomics 2008, 8 (2), 333–349. Ying, T.; Wang, H.; Li, M.; Wang, J.; Wang, J.; Shi, Z.; Feng, E.; Liu, X.; Su, G.; Wei, K.; Zhang, X.; Huang, P; Huang, L. Immunoproteomics of outer membrane proteins and extracellular proteins of Shigella flexneri 2a 2457T. Proteomics 2005, 5 (18), 4777–4793. Hu, M. C.; Walls, M. A.; Stroop, S. D.; Reddish, M. A.; Beall, B.; Dale, J. B. Immunogenicity of a 26-valent group A streptococcal vaccine. Infect. Immun. 2002, 70 (4), 2171–2177. Li, Y.; Martinez, G.; Gottschalk, M.; Lacouture, S.; Willson, P.; Dubreuil, J. D.; Jacques, M.; Harel, J. Identification of a surface protein of Streptococcus suis and evaluation of its immunogenic and protective capacity in pigs. Infect. Immun. 2006, 74 (1), 305– 312. Chen, C.; Tang, J.; Dong, W.; Wang, C.; Feng, Y.; Wang, J.; Zheng, F.; Pan, X.; Liu, D.; Li, M.; Song, Y.; Zhu, X.; Sun, H.; Feng, T.; Guo, Z.; Ju, A.; Ge, J.; Dong, Y.; Sun, W.; Jiang, Y.; Wang, J.; Yan, J.; Yang, H.; Wang, X.; Gao, G. F.; Yang, R.; Wang, J.; Yu, J. A glimpse of streptococcal toxic shock syndrome from comparative genomics of S. suis 2 Chinese isolates. PLoS ONE 2007, 2 (3), e315. Li, Y.; Gottschalk, M.; Esgleas, M.; Lacouture, S.; Dubreuil, J. D.; Willson, P.; Harel, J. Immunization with recombinant Sao protein confers protection against Streptococcus suis infection. Clin. Vaccine Immunol. 2007, 14 (8), 937–943. Brassard, J.; Gottschalk, M.; Quessy, S. Cloning and purification of the Streptococcus suis serotype 2 glyceraldehyde-3-phosphate dehydrogenase and its involvement as an adhesin. Vet. Microbiol. 2004, 102 (1-2), 87–94. Antikainen, J.; Kuparinen, V.; Lahteenmaki, K.; Korhonen, T. K. Enolases from Gram-positive bacterial pathogens and commensal lactobacilli share functional similarity in virulence-associated traits. FEMS Immunol. Med. Microbiol. 2007, 51 (3), 526–534. Granato, D.; Bergonzelli, G. E.; Pridmore, R. D.; Marvin, L.; Rouvet, M.; Corthesy-Theulaz, I. E. Cell surface-associated elongation factor Tu mediates the attachment of Lactobacillus johnsonii NCC533 (La1) to human intestinal cells and mucins. Infect. Immun. 2004, 72 (4), 2160–2169. Chitlaru, T.; Gat, O.; Grosfeld, H.; Inbar, I.; Gozlan, Y.; Shafferman, A. Identification of in vivo-expressed immunogenic proteins by serological proteome analysis of the Bacillus anthracis secretome. Infect. Immun. 2007, 75 (6), 2841–2852. Zhang, W.; Lu, C. P. Immunoproteomics of extracellular proteins of Chinese virulent strains of Streptococcus suis type 2. Proteomics 2007, 7 (24), 4468–4476. Schneewind, O.; Mihaylova-Petkov, D.; Model, P. Cell wall sorting signals in surface proteins of gram-positive bacteria. EMBO J. 1993, 12 (12), 4803–4811. Fluegge, K.; Schweier, O.; Schiltz, E.; Batsford, S.; Berner, R. Identification and immunoreactivity of proteins released from Streptococcus agalactiae. Eur. J. Clin. Microbiol. Infect. Dis. 2004, 23 (11), 818–824.
Journal of Proteome Research • Vol. 7, No. 9, 2008
Geng et al. (40) Ling, E.; Feldman, G.; Portnoi, M.; Dagan, R.; Overweg, K.; Mulholland, F.; Chalifa-Caspi, V.; Wells, J.; Mizrachi-Nebenzahl, Y. Glycolytic enzymes associated with the cell surface of Streptococcus pneumoniae are antigenic in humans and elicit protective immune responses in the mouse. Clin. Exp. Immunol. 2004, 138 (2), 290–298. (41) Ogunniyi, A. D.; LeMessurier, K. S.; Graham, R. M.; Watt, J. M.; Briles, D. E.; Stroeher, U. H.; Paton, J. C. Contributions of pneumolysin, pneumococcal surface protein A (PspA), and PspC to pathogenicity of Streptococcus pneumoniae D39 in a mouse model. Infect. Immun. 2007, 75 (4), 1843–1851. (42) Iannelli, F.; Chiavolini, D.; Ricci, S.; Oggioni, M. R.; Pozzi, G. Pneumococcal surface protein C contributes to sepsis caused by Streptococcus pneumoniae in mice. Infect. Immun. 2004, 72 (5), 3077–3080. (43) von, H. G. The structure of signal peptides from bacterial lipoproteins. Protein Eng. 1989, 2 (7), 531–534. (44) Keenan, J.; Oliaro, J.; Domigan, N.; Potter, H.; Aitken, G.; Allardyce, R.; Roake, J. Immune response to an 18-kilodalton outer membrane antigen identifies lipoprotein 20 as a Helicobacter pylori vaccine candidate. Infect. Immun. 2000, 68 (6), 3337–3343. (45) Delgado, M.; Yero, D.; Niebla, O.; Gonzalez, S.; Climent, Y.; Perez, Y.; Cobas, K.; Caballero, E.; Garcia, D.; Pajon, R. Lipoprotein NMB0928 from Neisseria meningitidis serogroup B as a novel vaccine candidate. Vaccine 2007, 25 (50), 8420–8431. (46) Aranda, J.; Garrido, M. E.; Cortes, P.; Llagostera, M.; Barbe, J. Analysis of the protective capacity of three Streptococcus suis proteins induced under divalent cation-limited conditions. Infect. Immun. 2008, 76 (4), 1590–1598. (47) Fenno, J. C.; Tamura, M.; Hannam, P. M.; Wong, G. W.; Chan, R. A.; McBride, B. C. Identification of a Treponema denticola OppA homologue that binds host proteins present in the subgingival environment. Infect. Immun. 2000, 68 (4), 1884–1892. (48) Henrich, B.; Hopfe, M.; Kitzerow, A.; Hadding, U. The adherenceassociated lipoprotein P100, encoded by an opp operon structure, functions as the oligopeptide-binding domain OppA of a putative oligopeptide transport system in Mycoplasma hominis. J. Bacteriol. 1999, 181 (16), 4873–4878. (49) Tanabe, M.; Atkins, H. S.; Harland, D. N.; Elvin, S. J.; Stagg, A. J.; Mirza, O.; Titball, R. W.; Byrne, B.; Brown, K. A. The ABC transporter protein OppA provides protection against experimental Yersinia pestis infection. Infect. Immun. 2006, 74 (6), 3687–3691. (50) Nowalk, A. J.; Gilmore, R. D., Jr.; Carroll, J. A. Serologic proteome analysis of Borrelia burgdorferi membrane-associated proteins. Infect. Immun. 2006, 74 (7), 3864–3873. (51) Lei, B.; Mackie, S.; Lukomski, S.; Musser, J. M. Identification and immunogenicity of group A Streptococcus culture supernatant proteins. Infect. Immun. 2000, 68 (12), 6807–6818.
PR800196V
