Article pubs.acs.org/JAFC
Identification of a Bioactive Bowman−Birk Inhibitor from an InsectResistant Early Maize Inbred Eric T. Johnson,*,† Christopher Skory,‡ and Patrick F. Dowd† †
Crop Bioprotection Research Unit and ‡Renewable Product Technology Research Unit, National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture , 1815 North University Street, Peoria, Illinois 61604, United States S Supporting Information *
ABSTRACT: Breeding of maize, Zea mays, has improved insect resistance, but the genetic and biochemical basis of many of these improvements is unknown. Maize oligonucleotide microarrays were utilized to identify differentially expressed genes in leaves of three maize inbreds, parents Oh40B and W8 and progeny Oh43, developed in the 1940s. Oh43 had enhanced leaf resistance to corn earworm larvae, Helicoverpa zea, and fall armyworm larvae, Spodoptera frugiperda, compared to one or both parents. Among ca. 100 significantly differentially expressed genes, expression of a Bowman−Birk trypsin inhibitor (BBI) gene was at least ca. 8-fold higher in Oh43 than in either parent. The Oh43 BBI gene was expressed as a recombinant protein. Purified BBI inhibited trypsin and the growth of fall armyworm larvae when added to insect diet. These experiments indicate that comparative gene expression analysis combined with insect resistance measurements of early inbreds can identify previously unrecognized resistance genes. KEYWORDS: defense, metallothionein, trypsin inhibition, reactive oxygen species, ribosome-inactivating protein
■
INTRODUCTION Global management of crops due to insect damage costs billions of dollars annually.1 Insect damage can also lead to the transmission of a variety of plant pathogens, including those that produce toxins that are harmful to people and animals in maize and other crops.2 Past breeding efforts have shown some success in developing maize lines with significant insect resistance.3 With the advent of successful transgene incorporation technology, new resistance gene sources have been identified and successfully deployed, such as the Bacillus thuringiensis crystal protein, which rely much less on source plant germplasm for trait improvement. However, recent and potential problems with pests developing resistance to these transgenic events4 has provided additional incentive for looking at source plants for useful resistance alleles that can be incorporated by breeding or transgenic means. Strategies for identifying new resistance genes are varied. Earlier work identified different bioactive chemicals in resistant plants, including DIMBOA-glucoside, maysin, and hemicellulose, which occurred at higher concentrations in resistant materials prior to insect damage.5,6 More recent studies have identified proteins involved in maize resistance, such as proteases,7 peroxidases,8 or ribosome-inactivating proteins,9,10 for which roles have been confirmed by diet incorporation or transgenic plant studies. With the advent of comparative expression analysis techniques, such as gene microarrays or RNA-Seq analysis, it has been possible to determine which genes that produce resistance molecules are up- or downregulated, although the expression profiles often involve dozens of potential resistance candidates, making confirmation of a role in resistance onerous.11 Additionally, the most effective resistance molecules are often expressed constitutively in This article not subject to U.S. Copyright. Published 2014 by the American Chemical Society
some resistant material, whereas the same molecules are induced in other resistant material.12 Modern maize commercial varieties can be examined in the presence and absence of various pests, obtaining information on potential induced molecules, with the benefits and caveats mentioned above. Whereas yield increases have been relatively steady over the past several decades, over a dozen diseases have increased significantly in importance over the same period of time,13 suggesting that resistance alleles have been lost during the process of breeding for yield. However, it is possible that useful resistance genes could be still expressed in “older” maize lines. Genome-wide examination of representatives of these older lines has yielded interesting examples of genes with utility.14 Gene microarray comparisons can allow for parent/ progeny comparisons where different pest resistance is present, as it is possible to examine the expression of many genes in the same tissue that also has been evaluated for insect resistance. Maize microarrays have been used to identify genetic differences among inbreds, especially in cases of hybrid vigor or heterosis,15 but to our knowledge, no genomic profiling studies of closely related inbreds have integrated insect resistance results. We now report on an example of this type of comparison, using parent and progeny inbreds developed in the 1940s.16 The inbreds were tested for leaf resistance to corn earworm and fall armyworm larvae. Maize microarrays were utilized to identify putative insect resistance genes differentially expressed in the leaves. A Bowman−Birk inhibitor, identified by Received: Revised: Accepted: Published: 5458
March 21, 2014 May 28, 2014 May 28, 2014 May 28, 2014 dx.doi.org/10.1021/jf501396q | J. Agric. Food Chem. 2014, 62, 5458−5465
Journal of Agricultural and Food Chemistry
Article
Table 1. PCR Primers Used for RT-qPCR of Maize Inbred or Control cDNA oligonucleotide MZ00018241 MZ00055932 luciferase a
top hit
a
NM_001 111495 GRMZM2G007928_T01 utr3 control RNA spike
PCR start
PCR end
PCR length (bp)
size (bp)
forward primer
reverse primer
983 596
CGTCTTCAGGTGGGCCGTCG TTCCGTTCGGAGCTCCATTT
ACCACGTGGAAGCAGAGCAACA CGAGTAAAAAGGCGACGAGC
760 42
969 137
210 96
1800
CCAGGGATTTCAGTCGATGT
AATCTGACGCAGGCAGTTCT
not known
not known
183
From BLAST alignment to GenBank or the maize B73 genome. purified with the RNeasy kit (Qiagen) as previously described.11 Ten micrograms of total RNA was converted into amino allyl modified cDNA by first adding 2 μg of oligo d(T)12−18 primer and incubating at 70 °C for 5 min and then incubating on ice for 1 min. cDNA synthesis reactions were incubated at 46 °C for 3 h and included 1× Superscript III reaction buffer (Life Technologies, Carlsbad, CA, USA), 7.5 mM DTT, 1× dNTP mix with amino allyl dUTP (Stratagene, La Jolla, CA, USA), 20 units of RNase Block ribonuclease inhibitor (Stratagene), and 200 units of Superscript III reverse transcriptase enzyme (Life Technologies). Preliminary experimentation found that Superscript III enzyme resulted in better cDNA yield than the RT enzyme supplied in the FairPlay III Microarray Labeling Kit (Stratagene). After cDNA synthesis, 10 μL of 1 M NaOH was added and the sample was incubated at 70 °C for 10 min and then allowed to cool to room temperature before 10 μL of 1 M HCl was added to neutralize the pH. The cDNA was precipitated using 5 μL of 3 M sodium acetate, pH 4.5, 20 μg of glycogen, and 100 μL of ice-cold ethanol at −20 °C for 30 min. The cDNA was centrifuged at 14000g for 15 min, and the pellet was washed with 0.5 mL of ice-cold 70% ethanol followed by an additional spin at 14000g for 15 min. Ethanol was removed, and the pellet was allowed to dry before 5 μL of coupling buffer (Stratagene) was added to resuspend the cDNA. Samples were incubated at 37 °C for 15 min to aid in resuspension, then 5 μL of either Cy3 or Cy5 mono reactive dye (GE Healthcare Biosciences, Piscataway, NJ, USA) diluted in dimethyl sulfoxide (DMSO) was added, and samples were placed in the dark for 30 min at room temperature. Fifty microliters of water was added, and then labeled cDNA was purified from the unreacted dye using the illustra CyScribe GFX Purification Kit (GE Healthcare Biosciences). Microarray Hybridization and Scanning. Maize microarray slides were purchased from the University of Arizona through the Maize Oligonucleotide Array Project funded by the NSF Plant Genome Research Program and contained ∼46000, 70mer oligonucleotides21 (NCBI GEO Platform the GPL6438). Labeled cDNA was quantified with a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) and subsequently evaporated to dryness in a Speedvac prior to resuspension. The probe solution (40 μL) included 40 pmol of Cy5-labeled cDNA, 40 pmol of Cy3-labeled cDNA, 25 μg of yeast tRNA, and 12 μg of salmon sperm DNA. Prehybridization of the microarray slide and hybridization of probes to the slide in a sealed hybridization chamber were carried out according to an established protocol22 except for an additional high-stringency wash at room temperature. Each microarray slide was hybridized to two different maize inbred labeled cDNAs with the following arrangement: slide 1, W8-1 (Cy3) versus Oh40B-1 (Cy5); slide 2, Oh43-1 (Cy3) versus W8-2 (Cy5); slide 3, Oh40B-2 (Cy3) versus Oh43-2 (Cy5); slide 4, W8-3 (Cy3) versus Oh43-3 (Cy5); slide 5, Oh40B-3 (Cy3) versus W8-4 (Cy5); slide 6, Oh43-4 (Cy3) versus Oh40B-4 (Cy5). The slides were scanned at 10 μm resolution on an Axon GenePix 4100A microarray scanner using GenePix Pro software (both from MDS Analytical Technologies, Sunnyvale, CA, USA). Photomultiplier tube levels were adjusted using the Auto-PMT feature. Each slide was visually scanned for aberrant signals, and such signals were removed if necessary. Mean signal intensity, with the background subtracted, was utilized for expression calculations. Each set (four replicates) of signal intensities for one inbred was scaled to the one replicate with the highest mean intensity and then transformed to log2 values, using Microsoft Excel. Each inbred replicate set was imported
this microarray analysis, was expressed in vitro and was bioactive against commercial trypsin and insect larvae.
■
MATERIALS AND METHODS
Insects. Corn earworms (CEW, Helicoverpa zea (Boddie)) and fall armyworms (FAW, Spodoptera frugiperda (J.E. Smith)) were reared on pinto bean based diet at 27 ± 1 °C, 50 ± 10% relative humidity, and a L14:D10 h photoperiod, as described previously.17 First-instar larvae were used in bioassays. Plants. Inbred maize parent lines W8 (Wisconsin Agricultural Experiment Station) and O40B (Ohio Agricultural Research and Development Center) and the inbred derived from the cross of these two parents, Oh43, were the subject of the study. Oh43, developed in 1949 by the Ohio Agricultural Experiment Station,16 was produced with at least four generations of selfing following the initial Oh40B × W8 cross.18 The W8 seed was obtained from Natalia de-Leon (Department of Agronomy, University of Wisconsin, Madison, WI, USA), and the Oh40B and Oh43 seeds were obtained from the USDA-ARS North Central Regional Plant Introduction Station. Prior studies indicated Oh40B had fair resistance to the corn leaf aphid Rhopalosiphum maidis (Fitch) and the European corn borer Ostrinia nubilalis (Hübner), whereas Oh43 had good resistance to these two insect species.16 No reports of insect resistance of W8 were listed under its description,16 although presumably it exhibits intermediate resistance against these insects. Seed was planted in soil mix 3.19 Plants were grown in a climate-controlled room with light 14 h (24 ± 1 °C)/ dark 10 h (18 ± 1 °C) and 50 ± 10% relative humidity. The third visible leaf from the top of a seven-leaf plant, which was fully expanded and mature, was used in bioassays. Leaf Bioassays. Bioassays were performed as described previously.19 Seven or eight plants of each inbred were used as a source of leaves. Approximately 20 cm of the anterior portion of the leaf was removed from each plant. Leaves were cut into approximately 1 × 2 cm sections with the posterior section used for corn earworms, and the adjacent anterior section was used for fall armyworms. The remaining leaf was frozen in liquid nitrogen for use in subsequent RNA extraction or protein assays. Individual leaf sections were placed on a piece of moistened filter paper in a 5 cm Petri dish with a tightfitting lid, along with 10 newly hatched caterpillars. The total number of 1 mm2 hole equivalents caused by feeding was determined after 2 days.19 Survivors were weighed to the nearest 0.01 mg using an analytical balance. Caterpillar Diet Disk Bioassays. Aliquots of recombinant protein (and corresponding quantities of background protein produced by wild-type yeast that eluted from a nickel column) were added to freeze-dried insect diet disks as previously described.20 Briefly, for the 2 day bioassay, the protein solutions were absorbed into the diet disks at a rate of 30 μL per 15 mg disk and then added to a Petri dish with a tight-fitting lid containing 10 insect larvae. For the 5 day bioassay, 150 μL of the protein solutions was absorbed into 50 mg diet disks, and each disk was placed on top of a Teflon disk in a well of a 24-well plate containing 3% water agar. One insect larva was caged in each well, and the wells were covered with a sheet of parafilm. The assays were run for 5 days. Survivors were weighed to the nearest 0.01 mg using an analytical balance. RNA Extraction and cDNA Labeling. RNA was extracted from the tissue, treated with DNase I (Qiagen, Valencia, CA, USA), and 5459
dx.doi.org/10.1021/jf501396q | J. Agric. Food Chem. 2014, 62, 5458−5465
Journal of Agricultural and Food Chemistry
Article
described above. A typical assay consisted of 20 μL of enzyme source, 20 μL of inhibitor source, and 160 μL of substrate source; enzyme and inhibitor free controls were also used. Assays were performed in duplicate for each treatment using 96-well plates held at 30 °C for 1 h and read on a Spectramax 250 plate reader (Molecular Devices, Sunnyvale, CA, USA) at 410 nm. Maximum absorbance of uninhibited reactions ranged from approximately 0.1 to 0.2 absorbance units per h. Recombinant Production of Maize BBI. The maize BBI gene that was expressed at higher levels in Oh43 leaves was amplified from Oh43 leaf cDNA (see above for cDNA preparation) on the basis of the B73 mRNA sequence (GRMZM2G007928_T01, which binds to maize oligonucleotide MZ00055932) using PCR Master mix (Roche Applied Science). The Oh43 BBI sequence was 100% identical to the B73 sequence (GRMZM2G007928_T01). The Oh43 BBI sequence (hereafter referred to as the Oh43 BBI), except for the 24 amino acid N-terminal signal peptide as predicted by SignalP,31 was cloned by PCR into the EcoRI and XbaI sites of pPICZα A, a vector for secreted expression in Pichia pastoris X-33. The Oh43 BBI construct additionally contained a C-terminal hexahistidine tag for purification. The entire BBI sequence was checked for accuracy before transformation into P. pastoris by sequencing using a BigDye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). Putative transformants were generated by electroporation and selection with 100 μg/mL zeocin on the following media: 1% yeast extract, 2% peptone, 2% dextrose, 1 M sorbitol, and 2% agar. Three different transformants were grown for 72 h, and Oh43 BBI clone 3 was chosen for further experimentation because of its high expression levels in the media as measured by Western blot analysis with a rabbit antihexahistidine antibody (Bethyl Laboratories, Montgomery, TX, USA). Wild type P. pastoris and Oh43 BBI clone 3 were each grown in 25 mL of BMG media (100 mM potassium phosphate, pH 6.0, 1.34% yeast nitrogen base with ammonium sulfate (containing no amino acids), 4 × 10−5% biotin, and 1% glycerol) overnight at 30 °C. The cells were resuspended in 120 mL of BMM media (same composition as BMG media, but with 0.5% methanol replacing the 1% glycerol) at OD 600 equal to 1.0 AU and then grown for 6 days at 30 °C with daily addition of methanol to 0.5%. The spent medium was recovered and adjusted to pH 6.5 with KOH. Three milliliters of nickel− nitrilotriacetic acid resin (Thermo Fisher Scientific) was washed with 10 mL of 20 mM NaPO4, 300 mM sodium chloride, and 15 mM imidazole, pH 6.5. Approximately 50 mL of spent medium was mixed by rocking with the washed resin for 30 min at room temperature. The spent medium was removed and the resin added to a plastic 10 mL column (Bio-Rad) kept at 4 °C. The resin was washed with 2 column volumes of 20 mM NaPO4, 300 mM sodium chloride, and 15 mM imidazole, pH 6.5. Histidine-tagged protein was eluted with 5 mL of 20 mM NaPO4, 300 mM sodium chloride, and 250 mM imidazole, pH 6.5, and 1 mL fractions were collected. Fractions of wild type and BBI clone 3 were quantified by the Bio-Rad protein assay dye reagent. Aliquots of some of the fractions were separated by tricine SDS-PAGE using a 10% acrylamide gel32 and transferred to polyvinylidene difluoride membrane in 10 mM 3-(cyclohexylamino)-1-propanesulfonic acid. Western blot analysis was performed as described previously9 except for the following changes: the membrane was blocked for 1 h in 5% instant nonfat dry milk (Kroger, Cincinnati, OH, USA) in phosphate-buffered saline (with 0.01% Tween-20); the primary antibody was a rabbit antihexahistidine antibody from Bethyl Laboratories that was diluted 1:10000, and the secondary antibody was diluted 1:150000. Reverse Zymography of Recombinant Maize BBI. Aliquots of eluted recombinant Oh43 BBI were subjected to reverse zymography as described previously33 with some modifications. The 15% (w/v) acrylamide-SDS gels, which included 0.1% (w/v) gelatin, were made according to the method of Schägger.32 Electrophoresis of the recombinant maize BBI, as well as soybean BBI (Sigma-Aldrich), was performed according to the method of Schägger32 at 4 °C. Use of bovine pancreas type III trypsin (Sigma-Aldrich) at 450 μg per 100 mL in development buffer required incubation for only 2 h at 37 °C to digest the indicator background gelatin protein when inhibition did
into the ArrayStar software program (version 4.1 DNASTAR, Madison, WI, USA). ANOVA analysis (F test procedure) with false discovery rate correction23 was used to identify differentially expressed genes at 95% confidence. The normalized data are available at the NCBI Gene Expression Omnibus, accession no. GSE40107. Reverse Transcriptase Quantitative PCR (RT-qPCR) Analysis. RNA was extracted as described above from maize leaves of three different biological replicates of each inbred that were different biological replicates from those used in the microarray experiments. Purified RNA (400 ng) was converted to cDNA using the AccuScript High Fidelity First Strand cDNA Synthesis Kit (Stratagene) with the provided oligo(dT) primer. Fifty picograms of luciferase RNA (Promega) was added to each cDNA reaction for normalization of target genes.24 RNA was removed from cDNA using RNase H according to the manufacturer’s instructions (New England Biolabs, Ipswich, MA, USA). Twenty-five microliter qPCR reactions were set up using 2× SYBR Green qPCR SuperMix Universal (Life Technologies), 10 μM of each forward and reverse primer, and 1 μL of cDNA reaction. Primers were designed with a melting temperature of 60 °C using Primer-BLAST (available at the NCBI Web site), OligoPerfect Designer (Life Technologies Web site), or Oligo Calc.25 All primers used in this study are listed in Table 1. The cycling program consisted of the following: 50 °C for 2 min; 95 °C for 10 min; 40 cycles of 95 °C for 15 s, 60 °C for 60 s, plate read. After amplification, the following melting curve analysis was performed: 60− 95 °C with a plate read every 1 °C; hold 1 s between reads. Cycling and fluorescence readings were performed on a Chromo 4 Detector (MJ Research, Waltham, MA, USA). Duplicate qPCR reactions for each primer combination and the luciferase control were completed for each biological replicate. A no-template control for each primer combination was also run for each plate to ensure the amplification did not include fluorescence due to primer dimers. Amplification of a single qPCR product close to the predicted size for each primer combination was confirmed using 3% agarose gel electrophoresis containing 1× SYBRsafe (Life Technologies) and visualized using a Molecular Imager ChemiDoc XRS+ (Bio-Rad, Hercules, CA, USA; at least one reaction was checked for each inbred). The crossover threshold (CT) value and efficiency for each reaction was calculated using the Real-time PCR Miner 4.0 algorithm26 (software available through the Stanford University Office of Technology Licensing). The normalized initial fluorescence was calculated for each reaction for each target gene using the equation27
R 0,T/R 0,R = (1 + E R )CT R /(1 + E T)CT T where R0 is the SYBR Green initial fluorescence for the T, target gene, and R, reference (luciferase) gene, E is the efficiency, and CT is the crossover threshold value. Trypsin Inhibitor Analysis. Trypsin inhibition (potentially due to a Bowman−Birk-type inhibitor) was determined using midgut homogenates of corn earworms and fall armyworms as the trypsin source and leaf homogenates of the three different maize inbreds as the source of trypsin inhibitor. Nα-Benzoyl-DL-arginine p-nitroanilide hydrochloride (BAPA) (Sigma-Aldrich, St. Louis, MO, USA) was used as the trypsin substrate28 and is a suitable substrate for measuring trypsin activity in caterpillars.29 BAPA was initially dissolved at the rate of 1 mg in 250 μL of dimethyl sulfoxide (DMSO). This stock of BAPA was diluted 1:50 in pH 8.0, 0.01 M sodium phosphate buffer, which was held at room temperature. Preliminary studies were used to determine an appropriate concentration of caterpillar midguts per volume of buffer to yield a linear reaction over 1 h at 30 °C. For the assays, three corn earworm and seven fall armyworm midguts were homogenized in 1400 μL of phosphate buffer.30 The homogenates were centrifuged at 10000g for 10 min, and the supernatants were used in the assays. Maize leaf pieces approximately 1.5 × 0.5 cm from the same leaves used in bioassays and for array analysis were homogenized in 500 μL of phosphate buffer, centrifuged as described for midgut homogenates, and the supernatants were used as the inhibitor source, after adjustment for equivalent protein amounts in assays. The BioRad protein assay dye reagent was used to quantitate protein, as 5460
dx.doi.org/10.1021/jf501396q | J. Agric. Food Chem. 2014, 62, 5458−5465
Journal of Agricultural and Food Chemistry
Article
Table 2. Biological Effects of Insect Larvae Feeding on Maize Leaves from Different Inbredsa insect CEW mean feeding CEW mean weight (mg) FAW mean feeding FAW mean weight (mg)
W8 37.4 0.42 49.9 0.53
± ± ± ±
Oh40B
1.2 (7) a 0.02 (59) a 1.6 (7) a 0.03 (68) a
35.8 0.34 43.5 0.62
± ± ± ±
Oh43
1.5 (8) a 0.02 (71) b 1.2 (8) b 0.03 (79) a
25.1 0.37 31.8 0.40
± ± ± ±
0.9 (8) b 0.02 (73) b 2.1 (8) c 0.03 (73) b
a
Feeding rate (1 mm2 hole equivalents) and weight (±standard error) were determined after 2 days of leaf feeding. Values in rows followed by different letters are statistically different at P < 0.05 by ANOVA. not occur. The gel was stained with Bio-Safe Coomassie stain (BioRad) according to the manufacturer’s instructions and visualized using a Molecular Imager ChemiDoc XRS+. Statistical Analyses. Statistically significant (P < 0.05) differences in feeding rates, insect midgut trypsin inhibitor activity, initial reporter fluorescence values for RT-qPCR analysis, and insect survivor weights were determined by analysis of variance using Proc GLM of SAS for Windows version 8.0 or higher. Chi-square analysis was performed using Proc Freq of SAS, with significance at P < 0.05.
Table 3. Differentially Expressed Genes in Maize Inbred Leaves Determined by Microarray Analysis oligonucleotide MZ00056633 MZ00041643 MZ00020744 MZ00040089 MZ00039334 MZ00055932 MZ00006035 MZ00018241 MZ00021395 MZ00026722 MZ00028883 MZ00016005 MZ00014067 MZ00017181 MZ00055047 MZ00037853
■
RESULTS AND DISCUSSION Differential Insect Feeding on the Inbred Leaves. Results of bioassays indicate the Oh43 inbred was more resistant to CEW and FAW compared to one or both parents, as indicated by reduced amounts of feeding and lower weights of survivors (Table 2). For the CEW, those caged with Oh43 caused less damage and weighed less than those caged with W8 leaves. Although feeding rates were lower on day 2 for CEW caged with Oh43 versus Oh40B leaves, weights of survivors were not different. For the FAW, those caged with Oh43 leaves caused less damage to leaves and weighed less than both parents. Thus, there were differential effects of the three inbreds on these two species of caterpillars. Differential Gene Expression of the Inbreds. Because the inbred lines displayed differential leaf resistance to the CEW and FAW, transcriptional profiling of the leaves was completed using maize oligonucleotide microarrays. These profiling experiments found 111 differentially expressed genes (with P < 0.05) among the three inbreds. Putative functions could be assigned to 90 of the differentially expressed genes. The majority of the differentially expressed genes (49/90) had a putative molecular function (Gene Ontology accession no. 0003674); this gene ontology describes the action of a gene product at the molecular level and could include catalysis or binding. The 20 genes with the lowest P values are listed in Table 3. A number of the genes in Table 3 could potentially contribute to differential insect resistance. Trypsin inhibitor (MZ00055932, described as a Bowman−Birk inhibitor by GenBank accession NP_001148299), which could inhibit trypsin proteases in insect digestive tracts, was more highly expressed in Oh43 than in W8 or Oh40B. The gene encoding ribosome-inactivating protein 2 (RIP2, MZ00018241), also known as rRNA N-glycosidase, was more highly expressed in Oh43 than in Oh40B or W8. Lastly, the Bx1 gene (MZ00015105), which encodes the initial enzyme of DIMBOA biosynthesis, was more highly expressed in W8 than in the other inbreds. There were also a number of metallothioneinlike genes and genes of unknown function differentially expressed among the three inbreds, which may be contributing to insect resistance. RT-qPCR was used to analyze the differential expression of the putative insect resistance genes (Table 4). Both RIP and the BBI were more highly expressed in Oh43 leaves (at statistically significant levels) than in Oh40B or W8 leaves, respectively, but
MZ00037704 MZ00035390 MZ00039519 MZ00015105
descriptiona Fe−S assembly protein cupin3 domain small nuclear RNA histone metallothionein-like trypsin inhibitor (BBI) nucleotide translocase RIP2 membrane protein expansin-like cytochrome P450 peroxidase germin-like protein unknown protein run and tbc domains chloroplast 50S ribosomal protein isomerase Fe−S assembly protein unknown protein Bx1
Oh43/ W8b
Oh43/ Oh40Bb
P
1.3 1.2 9.1 7.6 0.090 8.4 1.4 3.1 1.4 1.1 4.5 0.81 0.27 1.9 1.0 8.5
8.3 3.7 17.8 1.8 0.22 7.8 2.2 9.4 2.1 2.8 1.5 2.7 1.0 2.4 27.0 1.7
0.0051 0.0072 0.0080 0.0080 0.0084 0.0090 0.0090 0.010 0.011 0.012 0.013 0.013 0.013 0.020 0.020 0.020
1.1 1.4 1.3 0.13
3.7 8.8 3.0 1.9
0.022 0.024 0.030 0.030
a
Annotation from the top hit of BLAST alignment of the maize B73 genome or NCBI GenBank. bRelative expression level.
at higher levels than measured using the microarrays. This might be due to the greater sensitivity of quantitative PCR methods.34 A recent paper indicated that RIP2 mRNA and protein are rapidly induced (within 1 h) in maize Tx601 in response to fall armyworm feeding and RIP2 is active against FAW.10 Our results suggest that some maize inbreds may have elevated levels of RIP2 prior to insect attack that would contribute to greater resistance. Trypsin Inhibitor Experiments. Higher mRNA levels of a trypsin inhibitor (BBI) in Oh43 leaf extracts (Table 4) could contribute to reducing the trypsin activity of insect midguts compared to leaf extracts from the other inbreds. Some differences in levels of mean insect trypsin inhibition were significant for the crude inbred leaf extracts (Table 5). Oh40B trypsin inhibitory activity was significantly higher than that of W8 extract toward FAW trypsin and was more similar to levels for inhibition by Oh43 extract. For CEW trypsin activity, Oh40B and W8 inhibition levels were similar, but there were no statistically significant differences among the three inbred extracts. These results indicate that extracts from Oh43 leaves, as assayed, although sometimes more inhibitory than one or both parents, did not have significant trypsin inhibitory activity against CEW and FAW midgut trypsin that was higher than that of the parent inbred extracts. However, the crude mixture of plant and insect midgut extracts could contain components 5461
dx.doi.org/10.1021/jf501396q | J. Agric. Food Chem. 2014, 62, 5458−5465
Journal of Agricultural and Food Chemistry
Article
Table 4. RT-qPCR Assay of Putative Insect Resistance Genes oligonucleotide
description
inbred 1 R0,T/R0,luca
inbred 2 R0,T/R0,luca
RT-qPCRb
microarrayb
MZ00055932 MZ00018241
trypsin inhibitor RIP2
Oh43: 1.5 ± 0.38 c Oh43: 0.78 ± 0.15 c
W8: 0.012 ± 0.0082 d Oh40B: 0.0053 ± 0.0020 d
125 206
8.4 9.4
a R0,T/R0,luc is the mean ± SE initial reporter fluorescence for the target (T) relative to the initial reporter fluorescence of luciferase; values in columns followed by different letters are statistically different at P < 0.05 by ANOVA analysis. bRelative expression level, Oh43/inbred.
Table 5. Inhibition of Insect Midgut Trypsin Activity by the Three Maize Inbredsa inbred
% inhibition FAW
% inhibition CEW
W8 Oh40B Oh43
2.6 ± 3.6 a 6.6 ± 1.5 b 6.7 ± 1.9 ab
18.4 ± 0.8 a 19.4 ± 3.0 a 25.0 ± 4.7 a
a Values in columns followed by different letters are significantly different at P < 0.05 by analysis of variance.
that mask the actual trypsin and antitrypsin activities of individual bioactive species. Hence, further experiments were undertaken with the BBI gene that was expressed at higher levels in Oh43 than in either parent. Recombinant Oh43 BBI Added to Insect Diet Inhibits FAW Growth. To ascertain the insect inhibitory properties of the BBI gene elevated in Oh43, the gene was cloned for secreted recombinant protein production in P. pastoris. Western blot analysis of the nickel column elution fractions indicated wild-type P. pastoris did not secrete any detectable histidinetagged proteins into the media, whereas the recombinant line secreted two small (
