Identification of a filamin A mechanobinding partner I: Smoothelin

Subscriber access provided by UNIV OF LOUISIANA

Article

Identification of a filamin A mechanobinding partner I: Smoothelin specifically interacts with filamin A mechanosensitive domain 21 Fumihiko Nakamura, and lina wang Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.9b00100 • Publication Date (Web): 16 Apr 2019 Downloaded from http://pubs.acs.org on April 17, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Identification of a filamin A mechanobinding partner I: Smoothelin specifically interacts with filamin A mechanosensitive domain 21 Lina Wang and Fumihiko Nakamura* From School of Pharmaceutical Science and Technology, Life Science Platform, Tianjin University, 92 Weijin Road, Nankai District, Tianjin, 300072, China * To whom correspondence should be addressed: Fumihiko Nakamura: School of Pharmaceutical Science and Technology, Life Science Platform: [email protected]; Tel: +86- 22-87401830

ABBREVIATIONS FLNA, filamin A; SMTN A and B, smoothelin A and B; LUZP1, leucine zipper protein 1; F-actin, actin filaments; hcaSMCs, human primary coronary artery vascular smooth muscle cells; FRAP, fluorescent recovery after photobleaching; SILAC, stable isotope labeling by amino acids in cell culture; CBFβ, core-binding factor β subunit; FLNBvar-1, FLNA variant 1; MEF cells, Mouse embryonic fibroblast cells; VSMC, vascular smooth muscle cells

1

ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Filamin A (FLNA) is a ubiquitously expressed actin across-linking protein and a scaffold of numerous binding partners to regulate cell proliferation, migration, and survival. FLNA is a homodimer, and each subunit has a N-terminal actin-binding domain followed by 24 immunoglobulin-like repeats (R). FLNA mediates mechanotransduction by force-induced conformational changes of its cryptic integrin-binding site on R21. Here, we identified two novel FLNA-binding partners, smoothelins (SMTN A and B) and leucine zipper protein 1 (LUZP1), using stable isotope labeling by amino acids in cell culture (SILAC)-based proteomics followed by in silico screening for proteins having consensus FLNA-binding domain. We found that although SMTN does not interact with full-length FLNA, it binds to FLNA variant-1 (FLNAvar-1) that exposes the cryptic CD cleft of R21. Point mutations on the C strand that disrupt the integrin binding also block the SMTN interaction. We identified FLNA-binding domains on SMTN using mutagenesis and used the mutant SMTN to investigate the role of the FLNA-SMTN interaction on the dynamics and localization of SMTN in living cells. Fluorescence recovery after photobleaching (FRAP) of GFP-labeled SMTN in living cells demonstrated that the non-FLNAbinding mutant SMTN diffuses faster than wild-type SMTN. Moreover, inhibition of Rho-kinase using Y27632 also increases the diffusion. These data demonstrated that SMTN specifically interacts with FLNAvar1 and mechanically activated FLNA in cells. The accompanying report, “Identification of a filamin A mechanobinding partner II: Fimbacin is a novel actin-crosslinking and filamin A binding protein”, describes the interactions of FLNA with the transcript of LUZP1 gene.

2


Page 2 of 26

Page 3 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

INTRODUCTION Living cells are subjected to internal and external mechanical forces that can elicit biochemical signals in response to the applied forces (mechanotransduction). Mechanotransduction plays a crucial role in tissue repair and regeneration by controlling cell migration, growth, and differentiation 1-7. Therefore, mechanotransduction has important clinical implications including exercise-induced bone mass maintenance, muscular dystrophies, and hypertension-induced vascular and cardiac hypertrophy 8, 9. Despite its importance, little is known about the underlying mechanisms of mechanotransduction. Although the concept of how mechanotransduction is carried out at molecular level exists 10, it is difficult to maintain a protein complex that occurs only under mechanical stress as force is usually a missing parameter in in vitro experiments. Filamin A (FLNA) has recently been identified as a mechanosensor and mechanotransducer 11, 12. FLNA is an actin-crosslinking protein comprised of a spectrin-like actin-binding domain and 24 immunoglobulin-like (Ig) repeats. Force-induced conformational changes in FLNA “mechanosensing domains” can regulate partner interactions by two distinctive mechanisms: 1) exposing a cryptic integrin binding site in repeat 21 (R21 exposure) and 2) avidity loss caused by separating subunit chains, which move paired R23s apart and dissociate a Rac-GAP (FilGAP) (Figure 1) 11, 13.

Figure 1. How mechanical forces regulate FLN-partner interaction.

3


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(A) Differential mechanotransduction in FLNA occurs through opening cryptic sites (a: eg. integrin) and spatial separation of binding sites (b: eg. FilGAP). F-actin, filamentous actin. (B) The C-D strands indicated in blue provide a cleft for the integrin binding, which is covered with strand A of FLNA R20. Mechanical force induces conformational change of FLNA and exposes integrin-binding site. (C) Spatial separation of the two FLNA R23 reduces affinity to FilGAP. To monitor R21 exposure, we have recently developed a microscopic method and documented spatial and temporal R21 exposure in living cells 14. The results demonstrated that such conformational changes are not localized to integrin-rich focal adhesion, suggesting that other R21-binding partners interact with FLNA in a force-dependent manner. To identify such proteins, we employed stable isotope labeling by amino acids in cell culture (SILAC)-based proteomics followed by in silico screening for proteins that bind to the cryptic R21 site of FLNA. We found that smoothelins (SMTN A and B) and leucine zipper protein 1 (LUZP1) specifically bind R21 and describe how they biochemically interact with FLNA in our back-to-back reports. In this first report, we document identification of the novel binding partners and characterization of FLNA-SMTN interaction. SMTN is a smooth muscle cell (SMC)-specific protein and exclusively found in fully differentiated (contractile) SMCs 15, 16, whereas its mRNA is detected in fibroblasts and many tumor cell lines (http://www.proteinatlas.org/ENSG00000183963-SMTN/cell). SMTN-A (short isoform) is abundant in visceral smooth muscle and is essential for the contractility of intestinal smooth muscle 17. SMTN-B (long isoform) is expressed in vascular smooth muscle cells, and loss of SMTN-B results in increased mean arterial pressures 18. We demonstrated that although SMTN does not interact with full-length FLNA, it binds to FLNAvar-1 that exposes cryptic CD cleft of R21. Point mutations on the C strand that disrupt the integrin binding also block the SMTN interaction. We also identified FLNA-binding sites on overlapping sequences of both SMTN-A and -B, and obtained point mutant SMTN for functional analysis. Fluorescence recovery after photobleaching (FRAP) analysis confirmed that deletion of FLNA-binding sites and/or treatment with Rho-kinase inhibitor diminishes the interaction of SMTN with actin cytoskeleton, demonstrating force-dependent FLNA-SMTN interaction in the cell. We successfully obtained soluble full-length SMTN-B protein and characterized its actin-binding activity in vitro. Although SMTN-B barely cross-links actin filaments (F-actin), it augments actin-crosslinking activity of FLNAvar-1, suggesting that force-dependent interaction of FLNA with SMTN-B reinforces the mechanics of actin cytoskeleton. EXPERIMENTAL PROCEDURES Antibodies and reagents Mouse monoclonal anti-GFP antibody (JL-8) and rabbit polyclonal anti-GFP antibodies were purchased from Clontech. Mouse monoclonal anti-SMTN antibody was obtained from Santa Cruz Biotechnology (sc73042). Mouse monoclonal anti-FLNA and B were previously described 19. Rabbit polyclonal anti-FLNA and C were outsourced (Pacific immunology,

4


Page 4 of 26

Page 5 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

CA) using human FLNA repeat 1 and FLNC repeat 1, respectively, and affinity purified using the antigens immobilized on NHS-Sepharose (GE Healthcare) as an affinity ligand. Alexa Fluor 568 phalloidin and Hoechst 33342 were purchased from Thermo Fisher Scientific. Glutathione-Sepharose was purchased from GE Healthcare. Plasmid construction Human SMTN-B cDNA (UniProt Accession ID P53814) was amplified by PCR using 5’ primer CGGGATCCATGGCGG-ACGAGGCCTTAGC, 3’ primer GCTCTAGATTAGGACTTTTTGGTTTTTACCAGCC, and qPCR human reference cDNA (Clontech) as a template and ligated into pAcGFP-C1and pmCherry (Clontech) vectors at BglII/XbaI sites. The DNA sequence analysis confirmed that the cloned cDNA encoded SMTN-B (917 amino acid residues). pcDNA3.6 vector was constructed by ligating a KpnI/XbaI fragment of GGGGTACCGGATCCGAATTCCTCGAGGCGGCCGCTCTAGAGC into KpnI/XbaI sites of pcDNA3 (Invitrogen). The cDNA of eGFP(A207K) was amplified by PCR using 5’ primer GAATGCGGCCGCAATGGTGAGCAAGGGCGAGG, 3’ primer GCTCTAGATCAGATCCCGG-CGGCGGTC, digested with NotI/XbaI, and ligated into pcDNA3.6 vector at NotI/XbaI sites to construct pcDNA3.6-eGFP. The cDNA encoding SMTN was amplified by PCR using 5’ primer, CGGGATCCATGGCGGACGAGGCCTTAGC, containing a BamHI site, and 3’ primer, GAAT-TCGCGGCCGCCGGACTTTTTGGTTTTTACCAGCCC, digested with BamHI/NotI, and ligated into BamHI/NotI sites of pcDNA3.6-eGFP to construct pcDNA3.6-SMTN-eGFP. To construct pcDNA3.6-SMTN-Myc, the cDNA encoding SMTN was amplified by PCR using 5’ primer, CGGGATCCATGGCGGACGAGGCCTTAGC, containing a BamHI site, and 3’ primer, GCTCTAGAGGACTTTTTGGTTTTTACCAGCTGCGGCCGCGGACTTTTTGGTTTTTACCAGC, containing NotI site, My-tag, and XbaI site, and ligated into BamHI/XbaI sites of pcDNA3.6. Deletion mutants were engineered using the QuickChange® site-directed mutagenesis kit. For bacterial expression, fragments of SMTN were amplified by PCR and ligated into pGEX4T-1 (GE Healthcare) vector and full-length SMTN cDNA was ligated into pTXB1 (New England BioLabs) using 5’ primer GGAATTCCATATGGCGGACGAGGCCTTAGC and 3’ primer GAATTCGC-GGCCGCCGGACTTTTTGGTTTTTACCAGCCC. The cDNA encoding EGFP was amplified by PCR using pEGFP-C1 vector (Clontech) as the template, 5’ primer, CATGCCATGGTGAGC-AAGGGCGAG, containing a NcoI site, and 3’ primer, CGGGATCCGATCCCGGCGGCGGTC, containing BamHI site. The amplified fragments were purified, NcoI/BamHI-digested, and ligated into NcoI/BamHI sites in the pFASTBAC-HTb vector (Life Technologies) to generate pFASTBAC-HTb-EGFP vector. pFASTBAC-HTb-EGFP-R21 vector was constructed by cloning cDNA of FLNA repeat 21 (UniProt Accession ID P21333) into BamHI/SalI sites of pFASTBAC-HTb-EGFP vector. BACMID vector was generated using pFASTBAC-HTb-EGFP-R21 vector as previously described 20. Protein expression and purification Bacterial expression was performed with BL21(DE3) Star grown in LB medium in accordance with the manufacturer’s protocol. GST-fusion proteins were purified using glutathione-Sepharose in accordance with manufacturer’s protocol (GE Healthcare). Full-length SMTN protein was cleaved from intein using β-mercaptoethanol and further purified on Superdex 200 size exclusion chromatography column (10/300 GL, GE

5


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Healthcare) equilibrated with PBS containing 1 mM EGTA and 1 mM βmercaptoethanol. His-EGFP-R21 was expressed in sf-9 insect cells as previously described 20 and purified using Ni-NTA column chromatography (Qiagen) in accordance with manufacturer’s protocol. Affinity Ligand Using pFASTBAC-FLNA vector 21 as the template, FLNA repeats 21-23 (test) and 1-3 (negative control) were cloned into NdeI/SapI sites of pTXB1 vector (New England Biolabs, Beverly, MA) by PCR. To facilitate on-column self-cleavage, alanine residue was fused immediately upstream of the intein cleavage site. The vectors were transformed into E. coli ER2566 cells (New England Biolabs). Upon induction with 0.4 mM isopropyl β-D-thiogalactopyranoside, the proteins were expressed as a fusion with the chitin-binding peptide affinity tag separated from the proteins by an intein sequence, which was cleaved off in the presence of 50 mM β-mercaptoethanol according to the manufacturer's instructions. The proteins were further purified by gel filtration chromatography (Superdex 200, 10/300 GL, GE Healthcare) pre-equilibrated with 10mM sodium phosphate-buffer containing 150mM NaCl, 0.1mM EGTA, and 0.1mM β-mercaptoethanol, pH7.4. Purified FLNA repeats 21-23 and 1-3 were covalently coupled to NHS-activated Sepharose 4 Fast Flow beads (GE Healthcare) at 10 mg per 1 ml of the beads in PBS for 2 hr at room temperature. The nonreacted groups of the beads were blocked with 0.1 M Tris-HCl pH 8.0 for 2 hr at room temperature, equilibrated with TTBS solution, 50mM Tris-HCl, pH 7.4, 150mM NaCl, 1% TritonX-100, 1mM EGTA, 1mM β-mercaptoethanol, and stored at 4 °C. Cell Lines and SILAC Labeling Mouse embryonic fibroblast (ATCC) cells were grown for at least six generations in Dulbecco's modified Eagle's medium (DMEM) supplemented with L-lysine (light) or L-lysine-13C6 (heavy) using SILAC Protein Quantitation Kit (Pierce). Cells were maintained at 37 °C and 5% CO2. Affinity Purification for Mass Spectrometry Labeled MEF cells were grown on 150 mm tissue culture dishes at about 90% confluency and lysed in 1.5 ml of ice-cold TTBS solution supplemented with complete EDTA-free protease inhibitor cocktail (Roche), protease inhibitor set (without EDTA) (G-Biosciences), 10 μg/ml α1-anti-trypsin (EMD Biosciences), and 2 μM latrunculin A. Debris was pelleted at 16,000 × g at 4 °C for 20 min, and the supernatant was incubated with 20 μl of the affinity beads for 2 hr at 4 °C. The beads were washed three times with 800 μl of TTBS solution, bound protein was eluted with SDS sample buffer, and eluates from both samples (heavy and light) were pooled. The samples were resolved on precast PAGE gels (Novex 4–20% Tris-Gly gel; Invitrogen), stained with colloidal Coomassie (SimplyBlue SafeStain; Invitrogen), and analyzed by liquid chromatography–MS/MS-based quantification. For that, the lane was cut into 8 slices, all of which were subsequently subjected to in-gel tryptic digestion.

6


Page 6 of 26

Page 7 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Mass Spectrometry and Data Analysis Mass spectrometry, data analysis, and database searches were performed as previously described 22. Briefly, digested peptides were analyzed by LC-MS/MS on LTQ-OrbitrapXL hybrid mass spectrometer (Thermo Scientific, San Jose, CA). Protein identification and relative quantification was performed using Andromeda and MaxQuant (version 1.3.0.5) 23. The subsequent bioinformatics and statistical analyses were performed with Perseus 1.4.1.3 (http://www.maxquant.org). Co-immunoprecipitation Transfected or non-transfected cells were solubilized in TTBS (50 mM Tris-HCl, pH7.4, 150 mM NaCl, 1% Triton X100, 1 mM EGTA, 1mM βmercaptoethanol) supplemented with complete protease inhibitor cocktail (Roche) on ice. The lysate was incubated with 30 μl of anitFLAG M2 beads (Sigma) and incubated for 2 hours at 4℃. The beads were sedimented and washed with TBS buffer. Bound proteins were solubilized in SDS sample buffer and separated by a 9% Tris-glycine gel. Immunoblotting was performed using an anti-GFP antibody (JL-8, Clontech) at 1:8000 dilution to detect GFP-SMTN. In vitro binding assay GST-SMTN protein constructs were immobilized on glutathione beads (30 μl) in TBS buffer and incubated with 100 nM of GFP-R21 for 1 hr at room temperature. The beads were sedimented and washed with TBS buffer. Bound proteins were solubilized in SDS sample buffer and separated by a 9% Tris-glycine gel. Immunoblotting was performed using an anti-GFP antibody (JL-8, Clontech) at 1:8000 dilution to detect GFP-R21. F-actin cosedimentation assay A various concentrations of SMTN or its deletion mutants were mixed with or without 5 µM G- actin in solution F (20 mM Tris-HCl, pH 7.4, 0.5 mM Na2ATP, 5 mM MgCl2, 120 mM NaCl, 0.2 mM DTT) at 25C as previously described 20. After 1 h, the actin filaments were then sedimented by centrifugation at 200,000 × g (70,000 rpm, Beckman TLA100) for 30 min at 25C. Proteins in the supernatants and pellets were then solubilized in SDS gel sample buffer and subjected to SDS-PAGE. Polypeptides were visualized by Coomassie-staining and were scanned and quantified using the software program NIH ImageJ 1.47v for Mac and apparent Kd was calculated as previously described 20. Cell culture and transfection Primary human aortic VSMCs, Mouse embryonic fibroblast (MEF), and rat A7r5 cells were purchased from American Type Culture Collection. Cell lines HEK 293A (Invitrogen), A7r5, and MEF cells were maintained in DMEM (Invitrogen) supplemented with 10% FBS. HEK 293A and A7r5 cells were transfected using Trans-IT LT1 Reagent and MEF cells were transfected using Trans-IT X2 Dynamic Delivery System (Mirus Bio). Immunofluorescence microscopy Cells were plated on a poly-lysine-coated cover glass, transfected with a plasmid, fixed with 4% formaldehyde in PBS-D (PBS

7


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

containing 1mM of Ca2+ and Mg2+) for 20 min, rinse in PBS-D, permeabilized with 0.5% Triton X-100 in TBS (50mM Tris-HCl, pH 7.4, 150 mM NaCl)) for 10min, rinse in TBS-0.1%Tx (TBS containing 0.1% Triton X-100), blocked in 2% BSA in TBS-0.1%Tx, and incubated with Alexa568-phalloidin (Invitrogen) or primary antibodies for 2 hr. After several washes with TBS-0.1%Tx, the cells were incubated with secondary antibodies (Invitrogen), washed with TBS-0.1%Tx, and mounted with mounting media (Spring Bioscience). Cells were imaged on a twolaser confocal Olympus Fluoview FV-1000 microscope fitted with a 60 NA1.4 objective. Images were processed using Image J software (NIH). Colocalization was analyzed using JACoP plug-in 24. Fluorescence Recovery after Photobleaching (FRAP) assay MEF cells expressing WT or mutant AcGFP-SMTN were captured onto glass bottom dishes coated with poly-L-lysine. Cells were imaged in growth medium without phenol red, 50 mM HEPES, and 1.5% FBS using a Leica SP8 X confocal microscope. FRAP was performed as described previously . Briefly, the regions of interest (6.72 × 3.36 μm) were photobleached for ∼9 s at maximum 514-nm laser power. Subsequently, time lapse images were collected at 2% laser power until the bleached signal reached a stable level. FRAP curves from four independent trials with five cells per trial were derived by fitting the normalized fluorescence at each time point versus time into a onephase association model plugged into the Prism software. Fmax, which represents the mobile fraction of the molecule in the bleached region, and τ½, which is the time to recover half of the maximum fluorescence and is inversely correlated to the diffusion coefficient, were derived from this curve. RESULTS Identification of a novel FLNA binding partner that specifically interacts with FLNA’s mechanosensing sites We identified R21 and R23 as FLNA’s mechanosensing domains; a cleft between strands C and D of the repeats is the actual partner binding sites (Figure 1). Removal of R20 exposes the CD face of R21 while R23’s CD face is intrinsically exposed. Hence, we have used R21-23 to identify new mechanopartners for FLNA, as they should contain known FLNA mechanosensing domains. As a negative control, we used R1-3 because CD faces of R1-3 are structurally different from that of R21 (Figure 2).

8


Page 8 of 26

Page 9 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 2. Molecular tools for affinity purification of a mechanicallyregulated FLNA-binding partner. (A) Natural FLNA varian-1 is missing 41 amino acid residues (red), thereby exposing the cryptic integrinbinding site and mimicking mechanically-activated FLNA. (B) FLNA domains used for affinity purification of mechanically-regulated FLNAbinding partner (R21 and R23 are known to be mechanosensitive as illustrated in Figure 1). R1-3 was used as a negative control. These proteins were expressed as intein fusion proteins in E. coli, cleaved from intein, purified by size-exclusion chromatography, and covalently attached to NHS-Sepharose beads (10mg/ml). The ligands behaved as expected; only R21-23 binds to the cytoplasmic domain of integrin-β7 (747-798) and FilGAP25, 26 (Figure S1). Using these affinity beads, we pulled several proteins from the lysate of mouse embryonic fibroblast (MEF) cells that specifically bind to R21-23 (Coomassiestained SDS-PAGE gel, Figure 3). MEF cells were used because we have detected opening of R21 at their leading edges 14.

9


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. SILAC-based proteomics of FLNA-binding partner. (A) Schematic representation of the SILAC-based mass spectrometry experiments. (B) Standard scatterplots with normalized Log2 (H/L) ratios/Log10 Intensities (control versus test) highlighting the distribution of quantified proteins in each MS screening (cutoff values for enriched proteins was 2, except for integrin β1 (ITB1)). Known FLNA-binding proteins are highlighted in red. Novel FLNA-binding partners are highlighted in blue. Proteins highlighted in black are identified as a high score protein, but are not characterized in this study. See also supplementary table 1. We used SILAC followed by MS analysis to identify specific mechanopartners. MEF cells were cultured in media containing 13C6-L-Lys (heavy) or 12C6-L-Lys (light) for six cell doubling times to achieve >95% isotope incorporation. Separate cell lysates were mixed with the ligand-coated beads, washed, and bound proteins eluted. Proteins eluted from the two affinity matrices, each from a differently labeled cell, were pooled, proteins displayed by SDS-PAGE and Coomassie Brilliant Blue staining, cut into 8 slices (Figure 3), each of which was subjected to in-gel digestion followed by Mass spectrometry, data analysis, and database searches. The MS result identified 150 proteins that were enriched by over 4-fold when incubating with FLNA repeats 21-23 (Table S1). Among these proteins are known FLNA binding partners such as FILIP-1L 27, JRAB/MILK2 28, FBLI1/Fblim1/migfilin 29, 30, and RICTR 31. The concentration of

10


Page 10 of 26

Page 11 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

integrin-β1 only increased slightly in the presence of FLNA repeats 21-23 (Figure 3). In silico screening and biochemical assay for FLNA-binding partners FLN binding partners use a β-strand that fits into the CD grove formed by the FLN repeat (Figure 1) 13. Alternating residues of the partner β-strand either face towards or away from the groove. Residues facing the groove (indicated by asterisks on the sequence alignment shown in Figure 6), tend to be hydrophobic, while those facing away are less restricted. We developed an algorithm that searches for β-strands with these conserved amino acids 26, 30, 32-35. Using this algorithm, we screened primary sequences of the 150 proteins identified by SILAC. FLN-binding motif was found in PEAK1, DIAP2, MILK1, ECT2, STK3, PALM, ASAP, LARP4, SYNPO, NUMB, SMTN, and LUZP1 (Table S1). We constructed mammalian expression vectors carrying cDNAs of these candidate proteins. We co-expressed FLAG-tagged FLNA with green fluorescent protein (GFP)-tagged candidate proteins in human embryonic kidney (HEK)-293 cells and detected the interaction by immunoprecipitation using anti-FLAG-antibody followed by western blotting against GFP. Since lysing the cells would remove mechanical stress on FLNA molecule, we used a FLAG-FLNA del41 construct that constitutively exposes integrin-β binding site (deletion of 41 amino acid residues which include strand A of repeat 20 that covers the CD face of repeat 21, Figure 2). As a negative control, we used FLAG-FLNA mutated on repeats 21 (AA/DK) and 23 (M/E). The mutations in the C strand of repeat 21 (AA/DK: A2272D and A2274K) disrupt binding to βintegrin 36) or mutation in the D strand of repeat 23 (M/E: M2474E) disrupts binding to FilGAP 26). As shown below and the accompanying paper, SMTN and LUZP1 were biochemically confirmed to bind FLNA del41. SMTN is a novel FLNA-binding partner GFP-SMTN was pulled down only with FLAG-FLNA del41 but not with the WT or the point mutants expressed in HEK-293 cells, demonstrating that SMTN specifically binds to the open domain of R21 (Figure 4).

11


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4. Selective interaction of SMTN with open FLNA. pAcGFP-SMTN was co-expressed with Flag-FLNA mutated on R21(AA/DK) and 23(M/E) or deleted 41 amino acid residues (del41) to constitutively expose the cryptic integrin-binding site in HEK-293 cells. Flag-FLNA was immunoprecipitated with agarose-beads coated with anti-Flag moue antibody and bound AcGFP-SMTN was detected by western blotting using rabbit anti-GFP antibodies. To confirm a direct interaction between FLNA and SMTN, we expressed tagged-proteins in bacteria or insect cells for affinity purification and detection. GST-SMTN pulls down GFP-R21, and using deletion mutants of GST-SMTN, we identified 2 FLNA binding regions (457-483aa and 678-692aa) in SMTN (Figure 6 and Figure S2) as predicted by in silico analysis. Removal of these sites completely abolished the FLNA-SMTN interaction (Figure S2B).

12


Page 12 of 26

Page 13 of 26

A

457

917

SMTN-A

1 24 89 SMTN-B

194

CC

282

603 630

Pro

87

B

CH

CC

134

799

CC

Actin-binding

535

FLNAbinding

682

456 535

4

+

682 683

5 7

468

917

683

C

456

MW

484 484

GST-SMTN fragments

798 677

D

+

682

10

+

682 484

9

1

917

467

8

12

-

798 799

6 283

+ -

534

283

3

11

917aa

917

1

2

903 917 CH

1

1

461aa

693

917

+ -

R21-23 pulldown Input

250 150

W T de Wl T de l

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

100

250 150 100 75

75

50

50 37

37

CBB staining 1 2 3 4 5 6 7 8 9 10 11 Bound GFP-R21 (Anti-GFP)

1 2 3 4 5 6 7 8 9 10 11

Figure 5. Structure of SMTNs and identification of FLNA-binding sites on SMTNs. (A) CC: coiled-coil, Pro: polyproline, CH: calponin-homology domain. Red underlines indicate actin-binding domains. (B) FLNAbinding sites are identified at 457-483aa and 678-692aa of SMTN-B. (C) CBB stained gel of GST-SMTN constructs (top) and western blotting against GFP-R21 bound to GST-SMTN fragments (bottom). (D) R21-23 pulldown assay showing that deletions of the FLNA-binding sites abolish the interaction with R21-23.

13


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 26

Alignment of the binding sites with known FLNA-binding motif predicted how SMTN interacts with FLNA and mutagenesis confirmed critical amino acid residues for the interaction (Figure 6A). Point mutations of M457, T459, T685, and V687 to Ala greatly diminished the interaction as predicted (Figure 6B). Since the more widely expressed SMTN-A also contains these sites, both SMTN isoforms should interact with FLNA (Figure 5).

A

B

IB: anti-GFP

FLNA-binding domains GPIbα Integrin β1A Integrin β2 Integrin β3 Integrin β7 Migfilin CFTR FilGAP SMTN SMTN

Bound

* * * * *

--LPTFRSSLFLWVRP573---610 --NPIYKSAVTTVVNP793---798 --NPLFKSATTTVMNP764---769 --NPLYKEATSTFTNI783---788 --NPLYKSAITTTINP788---798 --EKRVASSVFITLAP19----373 --KASVVSKLFFSWTR21----1480 --EQFFSTFGELTVEP736---748 --GGSMKTTFTIEIKD467---917 --ARTTTVESSFVRRS695---917

WT 1

Total lysate 2

WT 1

2

135 100 95 Exposure time: 15min

135 100 95 Exposure time: 2min

Figure 6. Identification of critical amino acids of SMTN for FLNA interaction. (A) Alignment of binding interfaces of FLNA-binding partners. Amino acids indicated with asterisks are mainly involved in binding interaction. Point mutations of the underlined amino acids of SMTN to Ala (M457A, T459A, T685A, and V687A) are predicted to disrupt the interaction with FLNA R21. (B) Interaction of SMTN-eGFP (WT, 1: M457A/T459A/T685A/V687A, 2: M457A/T459A/S689A/F691A) expressed HEK293 cells with FLNA R21-23 coated on Sepharose beads. Bound SMTN-eGFP was detected by western blotting using mouse anti-GFP antibodies. Point mutations on Q471A, S473A, T679A, T681A, T684A, and T686A of SMTN had no effect on FLNA interaction (data not shown). SMTNB directly binds to F-actin Although SMTN is known to directly interact with F-actin 37, 38, binding affinity of full-length SMTNB to F-actin has never been measured. We have successfully prepared recombinant SMTNB that is soluble (fractionated in supernatant after centrifugation at 100,000 × g for 30 min) and co-sediments with F-actin in dose-dependent manner (Figure 7A). SMTN-B binding to F-actin saturated 0.13 mol/mol, which corresponds to one SMTNB per 8 actin monomers with an apparent Kd of 0.54 μM (Figure 7B). Deletion of FLNA-binding sites did not affect its F-actin binding (Figure 7C).

14


Page 15 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 7. Interaction of SMTN with F-actin. (A-C) F-actin cosedimentation assay with purified SMTN to measure binding affinity. (A) Co-sedimentation of WT SMTN-B with F-actin. (B) Amount of bound SMTN-B is plotted. (C) Deletion of FLNA-binding sites of SMTN-B does not affect its F-actin binding. (D) Apparent viscosity of F-actin networks cross-linked with FLNA and SMTN measured by falling ball assay. SMTNB reinforces gelation activity of FLNA Using purified actin, FLNA, and SMTNB proteins, we found SMTNB binds F-actin, but does not crosslink it. However, it enhances FLNA’s F-actin gelation activity when FLNAvar-1 is used (Figure 7D), suggesting that mechanical force triggers the FLNA-SMTNB interaction to reinforce mechanical properties of FLNA-actin networks. The FLNA-SMTNB interaction in living cells SMTNB is not expressed in established SMC lines 39 and the amount of SMTNB mRNA decreases in primary cells to undetectable levels within 12 hours after isolation of VSMCs from tissue, as VSMCs convert from contractile to synthetic phenotypes in culture 15, 40, 41. Therefore, we cultured SMCs under conditions that promote the contractile phenotype

15


Biochemistry

42-44.

SMTNB is not expressed in human primary coronary artery SMCs (hcaSMCs) when they were cultured in 5% serum (Figure 8A). Serum starvation, however, induced the expression of SMTNB that partially colocalized with FLNA (Figure 8B). Western blotting against FLN isoforms using specific antibodies demonstrated that hcaSMCs express FLNA and B (Figure 8C) that colocalized with F-actin 20.

A

C

IB: Anti-SMTN e m fre ru e m S ru % e 5 S

B

IB: Anti-FLNs FLNA FLNB FLNC

250

250

150

150

FLNA

SMTN/FLNA

5% Serum

SMTN

Colocalized pixel map image

Serum Free

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 26

Figure 8. Western blotting and staining of FLNAs and SMTN using antibodies against FLN isoforms and SMTN. (A) Induction of SMTN in hcaSMCs by serum starvation. (B) Localization of SMTN and FLNA in hcaSMCs. Colocalized pixel map image was generated on Image J v1.52e. Bar: 20μm. (C) FLNA and B are expressed in human primary coronary artery SMCs (hcaSMCs). SMTN interacts with FLNA in myosin-dependent manner in living cells We microscopically investigated if internal mechanical forces change the dynamics of SMTNB through FLNA in living cells. We expressed WT and a non-FLNA binding mutant SMTNB-eGFP in MEF cells and analyze the binding kinetics by FRAP. SMTNB-eGFP can be expressed in rat A7r5 smooth muscle cells and MEF cells and that it colocalizes with mCherry-FLNA on stress fibers (Figure S2). Although SMTNB-eGFP were exclusively expressed in nucleus in some cells, deletion of FLNA-

16


Page 17 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

binding sites of SMTNB did not significantly affect on localization of SMTNB (Figures S3). FRAP analysis demonstrated that deletion of FLNA-binding sites of SMTN significantly decreases τ½, which is the time to recover half of the maximum fluorescence, and slightly increase mobile (unbound) fraction (Figure 9), strongly supporting that FLNA-SMTNB interaction occurs in cells and this interaction stabilizes SMTNB on actin cytoskeleton. To relieve internal mechanical stress generated by myosin, cells were treated with Y27632 (inhibitor for Rho-kinase, upstream of myosin contraction) 45, 46. This treatment also decreases τ½, suggesting that myosin contraction promotes FLNA-SMTNB interaction. Mobilize fraction was not significantly affected, presumably due to the intrinsic F-actin binding activity of SMTNB.

Figure 9. FRAP Analysis of SMTN-eGFP expressed in MEF cells. (A) MEF cells expressing WT or mutant SMTN-eGFP were imaged before and during recovery after bleaching (bleached areas are indicated with red circles). Images were taken at the indicated times after the bleach

17


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

pulse. (B) Quantitative analyses of FRAP results. Curves depict mean values (± SD) from measurements of at least 6 representative cells including those shown (n ≥ 10). WT (black), non-FLN-binding (red), and WT treated with 20μM Y27632 for 30min (blue). (C) Summary of FRAP analysis. (95% confidence intervals)

DISCUSSION We have developed a new method to identify a binding partner for FLNA mechanosensing sites using SILAC-based proteomics followed by computational analysis of amino acid sequence that contains FLNA-binding motif. To identify a protein-protein interaction, affinity purification followed by mass spec analysis has been widely used, but still challenging due to nonspecific binding. Although SILAC was developed to alleviate this effect, it still does not eliminate an indirect binding partner. In addition, it is difficult to maintain a protein complex in vitro to pull-down a mechanobinding partner because force is missing in cell lysate. Here, we developed a tandem screening method to identify a protein that specifically binds to FLNA mechanobinding sites. First, guided by atomic structure of FLNA mechanosensing domains, we constructed constitutively open FLNA domains (R21-23) as a bait and R1-3 as a negative control for SILIC-based proteomics. Although we have detected 4 known binding partners (FILIP-1L 27, JRAB (MILK2) 28, FBLI1/Fblim1/migfilin 29, 30, and RICTR 31.) with high H/L ratio (>4), mechanoregulation of their interactions with FLNA remains unexamined. Interestingly, the H/L ratio of integrin-β1 only increased slightly in the presence of FLNA repeats 21-23, which is consistent with our recent observation that opening of FLNA does not mainly occurs at integrin-rich focal adhesions 14. Although we added R23 to the affinity ligand, none of the screened proteins tested so far interacted with R23 presumably because dimerization through R24 is necessary to increase overall affinity (avidity). The second screening was used in silico analysis to find a FLNA-binding motif in primary sequences of the candidate proteins. Although this screening found the motif in 12 candidate proteins, only SMTN and LUZP1 directly and specifically bound to FLNAvar-1. This suggests that potential FLNA-binding sites in the other candidate proteins are sterically hidden and could be exposed by post-translational modification such as phosphorylation and proteolysis. Although we did not detect typical FLNA binding motif in the proteins indicated in black in Figure 3B, these proteins might interact with FLNA mechanobinding sites as well and are worthy of future investigation. More rigorous studies will be necessary to conclusively prove that FLNA interacts SMTN in living cells. However, the previous 18


Page 18 of 26

Page 19 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

and current evidence suggests that this is the case. First, we show that SMTN specifically binds to natural FLNAvar-1. Although expression and distribution of FLNAvar-1 hasn’t been investigated, FLNBvar-1, which also lacks 41 aa, is expressed in a variety of tissues and cell types 47. In addition, since amino acids of R21 involved in the partner binding are highly conserved between filamin isoforms (Figure S4) 36, it is likely that SMTN interacts with FLNBvar-1. In line with this aspect, it would be interesting to explore if FLNC, mainly expressed in skeletal and cardiac musle, also interacts with SMTN and if the interaction influences myogenesis. Although varian-1 is not known in FLNC, it is possible that additional 82 amino acid residue inserted into FLNC R20 disrupts the domain pair of FLNC R20 and R21 to expose the CD face of FLNC R21 48. Moreover, since SMTN expression appears not to be exclusive in smooth muscle cells (https://www.proteinatlas.org/ENSG00000183963-SMTN/cell), it is likely that all filamins and SMTN are expressed in the same cells. In fact, SMTN was detected in MEF cells as well. Second, filamin-integrin interaction in living cells is well established 25 despite the fact that the interaction between canonical FLNA and integrin is weak unless the 41aa is removed from FLNA11, 47. In addition, physiologically relevant force is sufficient to induce conformation changes of FLNA to expose the cryptic binding site 11, 12, 49. Third, FRAP analysis show that point mutations of SMTN that diminish the interaction with FLNA and relaxation of myosin using Rho-kinase inhibitor significantly accelerated diffusion time of SMTN. Forth, double staining of FLNA and SMTN confirmed co-localization in hcaSMCs. However, it is interesting to note that FLNA and SMTN do not fully co-localized in cells, suggesting that not all of FLNA is mechanically activated. These results strongly support that SMTN interacts with FLNAvar-1 constitutively and canonical FLNA in a force dependent manner. Loss of expression of both SMTN-A and -B in mice is lethal at a young age, and SMTN-B deficiency results in a decreased contractile potential of SMCs, hypertension and cardiac hypertrophy 17, 18. In human, the SMTN gene is associated with essential hypertension, cerebral infarction, and myocardial infarction 50-52. Loss of SMTN-B results in the disappearance of the contractile VSMC phenotype in a variety of vascular disorders 53. Although SMTN has been used as a marker for the highly differentiated SMC, and SMTN expression is useful in studying vascular malformation and injury, its function has not been well studied, presumably due to difficulty to prepare soluble material for biochemical analysis 16. We have successfully prepared a large quantity of purified SMTN protein, allowing us, for the first time, to measure binding affinity of

19


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

full-length SMTN to F-actin and to study the effect of SMTN protein on FLNA gelation activity in vitro. Although our biochemical analysis clearly demonstrated that SMTN interacts with CD cleft of R21 in the same fashion as βintegrin, migfilin, and CFTR 34, 36, 54, 55, future study is necessary to investigate how the full-length SMTN molecule interacts with dimerized FLNA under force and how the complex associates with F-actin. How this interaction affects cell mechanics and contractility of SMCs is an open question as well. We observed that some exogenously expressed SMTN localizes in the nucleus. Nuclear localization of endogenous SMTN is also seen in some gastrointestinal leiomyosarcomas 56, suggesting its role as a transcription factor. Although inhibition of FLNA interaction with the transcription factor core-binding factor β subunit (CBFβ) promote its nuclear translocation to induce chondrocyte differentiation 57, disruption of FLNA-SMTN interaction did not affect its nuclear localization, suggesting the existence of another mechanism to regulate the localization.

20


Page 20 of 26

Page 21 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Funding This work is supported by the National Natural Science Foundation of China (31771551 to F.N.). Notes The authors declare that they have no conflicts of interest with the contents of this article. Contributions F.N. designed the experiments. L.W. and F.N. carried out the experiments and analyzed the data. F.N. wrote the paper. SUPPORTING INFORMATION Figure S1 (Validation of affinity ligands coated on Sepharose beads), Figure S2 (Colocalization of mCherry-FLNA and SMTN-BeGFP expressed in rat A7r5 VSMCs), Figure S3 (Effect of deletion of FLNA-binding domains of SMTN on its localization in MEF cells), Figure S4 (Binding interface of filamin R21 and integrin-𝞫 ), and Table S1 (Potential FLNA-binding proteins identified by SILAC-based quantitative proteomics). REFERENCES

[1] Discher, D. E., Janmey, P., and Wang, Y. L. (2005) Tissue cells feel and respond to the stiffness of their substrate, Science (New York, N.Y 310, 1139-1143. [2] Cai, Y., and Sheetz, M. P. (2009) Force propagation across cells: mechanical coherence of dynamic cytoskeletons, Current opinion in cell biology 21, 47-50. [3] Wang, N., Tytell, J. D., and Ingber, D. E. (2009) Mechanotransduction at a distance: mechanically coupling the extracellular matrix with the nucleus, Nature reviews. Molecular cell biology 10, 75-82. [4] Parsons, J. T., Horwitz, A. R., and Schwartz, M. A. (2010) Cell adhesion: integrating cytoskeletal dynamics and cellular tension, Nature reviews. Molecular cell biology 11, 633-643. [5] Mammoto, T., and Ingber, D. E. (2010) Mechanical control of tissue and organ development, Development 137, 1407-1420. [6] Shin, J. W., Swift, J., Ivanovska, I., Spinler, K. R., Buxboim, A., and Discher, D. E. (2013) Mechanobiology of bone marrow stem cells: from myosin-II forces to compliance of matrix and nucleus in cell forms and fates, Differentiation; research in biological diversity 86, 77-86. [7] Ross, T. D., Coon, B. G., Yun, S., Baeyens, N., Tanaka, K., Ouyang, M., and Schwartz, M. A. (2013) Integrins in mechanotransduction, Current opinion in cell biology 25, 613618. [8] Davies, P. F., Spaan, J. A., and Krams, R. (2005) Shear stress biology of the endothelium, Ann Biomed Eng 33, 1714-1718. [9] Hahn, C., and Schwartz, M. A. (2009) Mechanotransduction in vascular physiology and atherogenesis, Nature reviews. Molecular cell biology 10, 53-62.

21


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

[10] Brown, A. E., and Discher, D. E. (2009) Conformational changes and signaling in cell and matrix physics, Current biology : CB 19, R781-789. [11] Ehrlicher, A. J., Nakamura, F., Hartwig, J. H., Weitz, D. A., and Stossel, T. P. (2011) Mechanical strain in actin networks regulates FilGAP and integrin binding to filamin A, Nature 478, 260-263. [12] Rognoni, L., Stigler, J., Pelz, B., Ylanne, J., and Rief, M. (2012) Dynamic force sensing of filamin revealed in single-molecule experiments, Proc Natl Acad Sci U S A 109, 19679-19684. [13] Nakamura, F., Stossel, T. P., and Hartwig, J. H. (2011) The filamins: organizers of cell structure and function, Cell adhesion & migration 5, 160-169. [14] Nakamura, F., Song, M., Hartwig, J. H., and Stossel, T. P. (2014) Documentation and localization of force-mediated filamin A domain perturbations in moving cells, Nature communications 5, 4656. [15] van der Loop, F. T., Schaart, G., Timmer, E. D., Ramaekers, F. C., and van Eys, G. J. (1996) Smoothelin, a novel cytoskeletal protein specific for smooth muscle cells, J Cell Biol 134, 401-411. [16] van Eys, G. J., Niessen, P. M., and Rensen, S. S. (2007) Smoothelin in vascular smooth muscle cells, Trends in cardiovascular medicine 17, 26-30. [17] Niessen, P., Rensen, S., van Deursen, J., De Man, J., De Laet, A., Vanderwinden, J. M., Wedel, T., Baker, D., Doevendans, P., Hofker, M., Gijbels, M., and van Eys, G. (2005) Smoothelin-a is essential for functional intestinal smooth muscle contractility in mice, Gastroenterology 129, 1592-1601. [18] Rensen, S. S., Niessen, P. M., van Deursen, J. M., Janssen, B. J., Heijman, E., Hermeling, E., Meens, M., Lie, N., Gijbels, M. J., Strijkers, G. J., Doevendans, P. A., Hofker, M. H., De Mey, J. G., and van Eys, G. J. (2008) Smoothelin-B deficiency results in reduced arterial contractility, hypertension, and cardiac hypertrophy in mice, Circulation 118, 828-836. [19] Nakamura, F., Pudas, R., Heikkinen, O., Permi, P., Kilpelainen, I., Munday, A. D., Hartwig, J. H., Stossel, T. P., and Ylanne, J. (2006) The structure of the GPIb-filamin A complex, Blood 107, 1925-1932. [20] Nakamura, F., Osborn, T. M., Hartemink, C. A., Hartwig, J. H., and Stossel, T. P. (2007) Structural basis of filamin A functions, J Cell Biol 179, 1011-1025. [21] Nakamura, F., Osborn, E., Janmey, P. A., and Stossel, T. P. (2002) Comparison of filamin A-induced cross-linking and Arp2/3 complex-mediated branching on the mechanics of actin filaments, The Journal of biological chemistry 277, 9148-9154. [22] Cox, J., Matic, I., Hilger, M., Nagaraj, N., Selbach, M., Olsen, J. V., and Mann, M. (2009) A practical guide to the MaxQuant computational platform for SILAC-based quantitative proteomics, Nature protocols 4, 698-705. [23] Cox, J., Neuhauser, N., Michalski, A., Scheltema, R. A., Olsen, J. V., and Mann, M. (2011) Andromeda: a peptide search engine integrated into the MaxQuant environment, Journal of proteome research 10, 1794-1805. [24] Bolte, S., and Cordelieres, F. P. (2006) A guided tour into subcellular colocalization analysis in light microscopy, Journal of microscopy 224, 213-232. [25] Calderwood, D. A., Huttenlocher, A., Kiosses, W. B., Rose, D. M., Woodside, D. G., Schwartz, M. A., and Ginsberg, M. H. (2001) Increased filamin binding to beta-

22


Page 22 of 26

Page 23 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

integrin cytoplasmic domains inhibits cell migration, Nature cell biology 3, 10601068. [26] Nakamura, F., Heikkinen, O., Pentikainen, O. T., Osborn, T. M., Kasza, K. E., Weitz, D. A., Kupiainen, O., Permi, P., Kilpelainen, I., Ylanne, J., Hartwig, J. H., and Stossel, T. P. (2009) Molecular basis of filamin A-FilGAP interaction and its impairment in congenital disorders associated with filamin A mutations, PLoS ONE 4, e4928. [27] Kwon, M., Hanna, E., Lorang, D., He, M., Quick, J. S., Adem, A., Stevenson, C., Chung, J. Y., Hewitt, S. M., Zudaire, E., Esposito, D., Cuttitta, F., and Libutti, S. K. (2008) Functional characterization of filamin a interacting protein 1-like, a novel candidate for antivascular cancer therapy, Cancer research 68, 7332-7341. [28] Sakane, A., Alamir Mahmoud Abdallah, A., Nakano, K., Honda, K., Kitamura, T., Imoto, I., Matsushita, N., and Sasaki, T. (2013) Junctional Rab13-binding protein (JRAB) regulates cell spreading via filamins, Genes to cells : devoted to molecular & cellular mechanisms 18, 810-822. [29] Takafuta, T., Saeki, M., Fujimoto, T. T., Fujimura, K., and Shapiro, S. S. (2003) A new member of the LIM protein family binds to filamin B and localizes at stress fibers, The Journal of biological chemistry 278, 12175-12181. [30] Gay, O., Gilquin, B., Nakamura, F., Jenkins, Z. A., McCartney, R., Krakow, D., Deshiere, A., Assard, N., Hartwig, J. H., Robertson, S. P., and Baudier, J. (2011) RefilinB (FAM101B) targets filamin A to organize perinuclear actin networks and regulates nuclear shape, Proc Natl Acad Sci U S A 108, 11464-11469. [31] Chantaravisoot, N., Wongkongkathep, P., Loo, J. A., Mischel, P. S., and Tamanoi, F. (2015) Significance of filamin A in mTORC2 function in glioblastoma, Molecular cancer 14, 127. [32] Gomez-Mouton, C., Fischer, T., Peregil, R. M., Jimenez-Baranda, S., Stossel, T. P., Nakamura, F., and Manes, S. (2014) Filamin A interaction with the CXCR4 third intracellular loop regulates endocytosis and signaling of WT and WHIM-like receptors, Blood. [33] Li, C., Yu, S., Nakamura, F., Yin, S., Xu, J., Petrolla, A. A., Singh, N., Tartakoff, A., Abbott, D. W., Xin, W., and Sy, M. S. (2009) Binding of pro-prion to filamin A disrupts cytoskeleton and correlates with poor prognosis in pancreatic cancer, The Journal of clinical investigation 119, 2725-2736. [34] Playford, M. P., Nurminen, E., Pentikainen, O. T., Milgram, S. L., Hartwig, J. H., Stossel, T. P., and Nakamura, F. (2010) Cystic fibrosis transmembrane conductance regulator interacts with multiple immunoglobulin domains of filamin A, The Journal of biological chemistry 285, 17156-17165. [35] Zhou, X., Massol, R. H., Nakamura, F., Chen, X., Gewurz, B. E., Davis, B. M., Lencer, W. I., and Waldor, M. K. (2014) Remodeling of the intestinal brush border underlies adhesion and virulence of an enteric pathogen, mBio 5. [36] Kiema, T., Lad, Y., Jiang, P., Oxley, C. L., Baldassarre, M., Wegener, K. L., Campbell, I. D., Ylanne, J., and Calderwood, D. A. (2006) The molecular basis of filamin binding to integrins and competition with talin, Mol Cell 21, 337-347. [37] Quensel, C., Kramer, J., Cardoso, M. C., and Leonhardt, H. (2002) Smoothelin contains a novel actin cytoskeleton localization sequence with similarity to troponin T, Journal of cellular biochemistry 85, 403-409.

23


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

[38] Niessen, P., Clement, S., Fontao, L., Chaponnier, C., Teunissen, B., Rensen, S., van Eys, G., and Gabbiani, G. (2004) Biochemical evidence for interaction between smoothelin and filamentous actin, Experimental cell research 292, 170-178. [39] van Eys, G. J., Voller, M. C., Timmer, E. D., Wehrens, X. H., Small, J. V., Schalken, J. A., Ramaekers, F. C., and van der Loop, F. T. (1997) Smoothelin expression characteristics: development of a smooth muscle cell in vitro system and identification of a vascular variant, Cell structure and function 22, 65-72. [40] Rovner, A. S., Murphy, R. A., and Owens, G. K. (1986) Expression of smooth muscle and nonmuscle myosin heavy chains in cultured vascular smooth muscle cells, The Journal of biological chemistry 261, 14740-14745. [41] Reusch, P., Wagdy, H., Reusch, R., Wilson, E., and Ives, H. E. (1996) Mechanical strain increases smooth muscle and decreases nonmuscle myosin expression in rat vascular smooth muscle cells, Circ Res 79, 1046-1053. [42] Chamley-Campbell, J. H., and Campbell, G. R. (1981) What controls smooth muscle phenotype?, Atherosclerosis 40, 347-357. [43] Pauly, R. R., Bilato, C., Cheng, L., Monticone, R., and Crow, M. T. (1997) Vascular smooth muscle cell cultures, Methods in cell biology 52, 133-154. [44] Alexander, M. R., and Owens, G. K. (2012) Epigenetic control of smooth muscle cell differentiation and phenotypic switching in vascular development and disease, Annual review of physiology 74, 13-40. [45] Straight, A. F., Cheung, A., Limouze, J., Chen, I., Westwood, N. J., Sellers, J. R., and Mitchison, T. J. (2003) Dissecting temporal and spatial control of cytokinesis with a myosin II Inhibitor, Science (New York, N.Y 299, 1743-1747. [46] Uehata, M., Ishizaki, T., Satoh, H., Ono, T., Kawahara, T., Morishita, T., Tamakawa, H., Yamagami, K., Inui, J., Maekawa, M., and Narumiya, S. (1997) Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension, Nature 389, 990-994. [47] van der Flier, A., Kuikman, I., Kramer, D., Geerts, D., Kreft, M., Takafuta, T., Shapiro, S. S., and Sonnenberg, A. (2002) Different splice variants of filamin-B affect myogenesis, subcellular distribution, and determine binding to integrin [beta] subunits, J Cell Biol 156, 361-376. [48] Thompson, T. G., Chan, Y. M., Hack, A. A., Brosius, M., Rajala, M., Lidov, H. G., McNally, E. M., Watkins, S., and Kunkel, L. M. (2000) Filamin 2 (FLN2): A muscle-specific sarcoglycan interacting protein, J Cell Biol 148, 115-126. [49] Chen, H., Chandrasekar, S., Sheetz, M. P., Stossel, T. P., Nakamura, F., and Yan, J. (2013) Mechanical perturbation of filamin A immunoglobulin repeats 20-21 reveals potential non-equilibrium mechanochemical partner binding function, Scientific reports 3, 1642. [50] Jiang, J., Nakayama, T., Shimodaira, M., Sato, N., Aoi, N., Sato, M., Izumi, Y., Kasamaki, Y., Ohta, M., Soma, M., Matsumoto, K., Kawamura, H., Ozawa, Y., and Ma, Y. (2012) Haplotype of smoothelin gene associated with essential hypertension, Hereditas 149, 178-185. [51] Jiang, J., Nakayama, T., Shimodaira, M., Sato, N., Aoi, N., Sato, M., Izumi, Y., Kasamaki, Y., Ohta, M., Soma, M., Matsumoto, K., Kawamura, H., Ozawa, Y., Hinohara, S., Doba, N., and Ma, Y. (2012) Association of the smoothelin (SMTN) gene with cerebral

24


Page 24 of 26

Page 25 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

infarction in men: a haplotype-based case-control study, Vascular medicine 17, 317325. [52] Jiang, J., Nakayama, T., Shimodaira, M., Sato, N., Aoi, N., Sato, M., Izumi, Y., Kasamaki, Y., Ohta, M., Soma, M., Matsumoto, K., Kawamura, H., Ozawa, Y., and Ma, Y. (2012) A haplotype of the SMTN gene associated with myocardial infarction in Japanese women, Genetic testing and molecular biomarkers 16, 1019-1026. [53] Hao, H., Gabbiani, G., Camenzind, E., Bacchetta, M., Virmani, R., and Bochaton-Piallat, M. L. (2006) Phenotypic modulation of intima and media smooth muscle cells in fatal cases of coronary artery lesion, Arteriosclerosis, thrombosis, and vascular biology 26, 326-332. [54] Lad, Y., Jiang, P., Ruskamo, S., Harburger, D. S., Ylanne, J., Campbell, I. D., and Calderwood, D. A. (2008) Structural basis of the migfilin-filamin interaction and competition with integrin beta tails, The Journal of biological chemistry 283, 3515435163. [55] Smith, L., Page, R. C., Xu, Z., Kohli, E., Litman, P., Nix, J. C., Ithychanda, S. S., Liu, J., Qin, J., Misra, S., and Liedtke, C. M. (2010) Biochemical basis of the interaction between cystic fibrosis transmembrane conductance regulator and immunoglobulin-like repeats of filamin, The Journal of biological chemistry 285, 17166-17176. [56] Coco, D. P., Hirsch, M. S., and Hornick, J. L. (2009) Smoothelin is a specific marker for smooth muscle neoplasms of the gastrointestinal tract, The American journal of surgical pathology 33, 1795-1801. [57] Johnson, K., Zhu, S., Tremblay, M. S., Payette, J. N., Wang, J., Bouchez, L. C., Meeusen, S., Althage, A., Cho, C. Y., Wu, X., and Schultz, P. G. (2012) A stem cell-based approach to cartilage repair, Science (New York, N.Y 336, 717-721. ACCESSION CODES SMTN P53814 FLNA P21333

25


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Page 26 of 26

Identification of a filamin A mechanobinding partner I: Smoothelin

Recommend Documents