Identification of Immunogenic Antigen Candidate for Chlamydophila pneumoniae Diagnosis Sung-Ha Park,†,§ Su-Jin Kwon,† Sun-Jin Lee,‡ Young-Chang Kim,‡ Kwang Yeon Hwang,§ Yeon-Ho Kang,† and Kwang-Jun Lee*,† Laboratory of Pathogenic proteomics, Division of Bacterial Respiratory, Center for Infectious Diseases, National Institute of Health, Korea Centers for Disease Control and Prevention, Seoul, Korea, Microbiology and Biotechnology, Chungbuk National University, Chungbuk, Korea, and Graduate School of Biotechnology, Korea University, Seoul, Korea Received January 20, 2009
Chlamydophila pneumoniae is a Gram-negative intracellular obligate human pathogen and accounts for 5-10% of cases of community-acquired pneumonia. However, isolating and culturing this pathogen is difficult, so there have been several studies searching for new biomarkers for its diagnosis. In this study, we obtained immunogenic proteins of C. pneumoniae KNIH-1 for diagnosis using immunoproteomics. C. pneumoniae infection sera were selected for the highest index value of C. pneumoniaespecific IgG using microimmunofluorescence (MIF). The detected protein spots in common from C. pneumoniae infection sera using proteome analysis were identified as Omp11, type III secretion system ATPase, and PmpG by LC-MS/MS and MS databases. They were selected as candidate antigens. In addition, using in silico prediction we also identified proteins encoded by Omp11, PmpG and IncA as antigens. And then, IncA acts as an effector by a type III secretion system ATPase, as identified by mass spectrometry, and was selected as a candidate antigen. Thus, we predict proteins encoded by Omp11, the PmpG family and by IncA as candidate diagnostic immunogens. Keywords: Chlamydophila pneumoniae • Tandem liquid chromatography • Mass spectrometry • Twodimensional gel electrophoresis • Immunoproteomics • Omp11 • PmpG • IncA • Immunogenic antigen
Introduction Chlamydophila pneumoniae is a species of intracellular bacterium that has recently been recognized as a third species of its genus. C. pneumoniae has a complex life cycle and must infect another cell to reproduce. Therefore, it is classified as an obligate intracellular pathogen. C. pneumoniae exists as an elementary body (EB) that travels from an infected person to the lungs of a noninfected person where it transforms into a reticulate body (RB) to replicate within cellular endosomes.1 The organism was first isolated in 1965 from the conjunctiva of a Taiwanese child, who was participating in a trachoma vaccine trial. C. pneumoniae causes several acute respiratory diseases, including pneumonia, bronchitis, sinusitis and pharyngitis.2 This pathogen causes, on average, 10% of cases of community-acquired pneumonia and 5% of cases of bronchitis and sinusitis. The clinical symptoms produced by such pulmonary infections are similar to those caused by other respiratory pathogens, with the addition of a few distinguishing features.3 * To whom correspondence should be addressed. Dr. Kwang-Jun Lee, Division of Bacterial Respiratory, Center for Infectious Diseases, National Institute of Health, Korea Centers for Disease Control and Prevention, 5 Nokbun-dong Eunpyung-gu, Seoul 122-701, Korea. E-mail: kwangjun@ nih.go.kr. Phone: +82-2-380-2132. Fax: +82-2-380-1487. † Korea Centers for Disease Control and Prevention. § Korea University. ‡ Chungbuk National University. 10.1021/pr900055g CCC: $40.75
2009 American Chemical Society
Until recently, tests such as MIF serology have been performed for the diagnosis of C. pneumoniae but present with difficult isolation and culture techniques. Such diagnostic methods sometimes lead to a misdiagnosis of C. pneumoniae and most have not been validated compared with culture or other diagnostic methods such as polymerase chain reaction (PCR) amplification and enzyme-linked immunosorbent assay (ELISA). Moreover, there is evidence of major problems with both inter- and intralaboratory reproducibility.4,5 So, the investigation of immunogenic antigens to improve the sensitivity and reproducibility of diagnosis is necessary. Therefore, the aim of our research was to discover new immunogenic proteins for the diagnosis of C. pneumoniae infection using immunoproteomics. Immunoproteomics is a term used to describe the study of proteomics involved in the immune response. The applications of immunoproteomics include purification and identification of protein antigens binding specific antibodies, and comparative immunoproteomics to identify proteins and pathways modulated by a specific infectious organism, disease or toxin.6 A new Korean strain of C. pneumoniae designated KNIH-1 was isolated from a patient with pharyngitis in 2006. In the present study, sera were selected with the highest IgG index values by MIF. We used proteomics system using twodimensional electrophoresis (2-DE) and immunoblotting and in silico prediction to screen antigens against C. pneumoniae. Journal of Proteome Research 2009, 8, 2933–2943 2933 Published on Web 04/27/2009
research articles All protein spots detected using an immunoproteomics system based on sera from patients with C. pneumoniae infections (n ) 20) were identified using tandem liquid chromatography and mass spectrometry (LC-MS/MS) and MS databases. Of these, proteins shown by immunoblotting to be common between infections were selected as candidate antigens.
Experimental Details Cultivation and Inoculation. Hep-2 cells (ATCC, Rockville, MD) were cultured in Eagle’s minimum essential medium (MEM; Invitrogen, NY, USA) with L-glutamine and 10% fetal calf serum (Invitrogen), plus 10 000 U penicillin and 10 mg/L streptomycin dissolved in 0.9% sodium chloride, under 5% CO2 at 37 °C. Aliquots of 2.5 × 105/mL cells in 96-well cell culture plates (SPL, Gyeonggi, South Korea) were incubated at 37 °C for 24 h. Monolayers were inoculated with C. pneumoniae EBs from a frozen stock of 1.0 × 109 inclusion-forming units (IFU)/ mL C. pneumoniae suspension obtained by the slow-expansion procedure.7 The inoculated cells were centrifuged at 3500g for 30 min at 10 °C and incubated at 37 °C under 5% CO2 for 72 h. Cells were then fixed in absolute methanol for 10 min and stained with a fluorescein isothiocyanate (FITC)-labeled Chlamydial-specific antibody (Pathfinder; Bio-Rad Laboratories, Hercules, CA) for 30 min. The labeled cells were then washed with distilled water and examined using epifluorescence microscopy to verify an adequate level of infection.8 Serological Analysis. Up to 1 mL of each patient’s serum obtained on admission was stored at -20 °C for subsequent analysis at the end of the study period. The analysis of Legionella pneumophila serogroup 1-specific anti-human IgG and C. pneumoniae γ-chain specific anti-human IgG (Sigma, St. Louis, MO) in serum was used for a microimmunofluorescence (MIF) testing. Sera of high antibody rate (>1:128), compatible with a current C. pneumoniae and L. pneumophila infection, was obtained. PLATELIA Mycoplasma pneumoniae IgG TMB kit (Bio-Rad, Marnes-la-Coquette, France) was used for semiquantitative detection of anti-M. pneumoniae IgG in human serum by enzyme immunoassay. The optical density reading, obtained with a spectrophotometer set at 450/620 nm, is proportional to the amount of M. pnuemoniae IgG antibodies present in the test sample and is converted into AU/mL (Arbitrary Unit) using a standard curve. Sera of high antibody rate (>40 AU/mL), compatible with a current M. pnuemoniae infection, was obtained. Elementary Body Preparation. The inoculated cells were freed gently from monolayers using a cell scraper and then lysed by sonication on ice. EBs were separated from host cell debris by centrifuging at 40 000g for 1 h. The supernatant was removed and Hank’s balanced salt solution with Ca2+ and Mg2+ (WelGENE, Daegu, South Korea) was added. For EB protein purification, Renocal-76 density gradient solution was used, because urografin that had been used for EB protein purification is no longer available. Renocal-76 is 37% organically bound iodine containing diatrizonate meglumine and diatrizoate sodium.9 EBs were separated on 20-50% (v/v) Renocal-76 density gradients (Bracco Diagnostics, East Princeton, NJ) in sterile 38 mL high-speed centrifuge tubes at 60 000g for 1 h at 4 °C.10 Extraction of Elementary Body Protein. The EBs were pelleted and the pellets washed three times with a washing buffer (5% 1 M Tris-HCl, pH 7.5, and 1.742 mL PMSF). The supernatant was removed, 1 mL of lysis buffer (7 M urea, 2 M thiourea, 30 mM Tris, and 4% CHAPS, pH 8.5) was added, and 2934
Journal of Proteome Research • Vol. 8, No. 6, 2009
Park et al. the cell was lysed by sonication on ice. Endonuclease solution (5% of 1 M pH 8.0, Tris-HCl, 1 M MgCl2, and 0.1% DNase) was added to the cell lysate, which was then centrifuged at 60 000g for 1 h. The supernatant was obtained and trichloroacetic acid solution (25 g in 11.35 mL of acetone) was added at 10% of the supernatant volume to obtain pellets of EB.11 IEF and 2DE. A total of 50 µg of extracted EB protein samples was loaded on 18 cm immobilized pH gradient (IPG) strips (linear pH 4-7 gradient; Amersham Biosciences, Piscataway, NJ) using an IPGphor system (Amersham Biosciences, Piscataway, NJ) for isoelectric focusing (IEF). Focusing times were 12 h for rehydration, 1 h at 500 V, 1 h at 1000 V, then 8000 V at 32 000 V/h. While the sample was still on the IPG strip, 1% dithiothreitol (DTT) was added in a sodium dodecyl sulfate (SDS) equilibration buffer (50 mM Tris-Cl, pH 8.8, 30% glycerol, 2% SDS, and 6 M urea) and allowed to equilibrate for 15 min. The solution was then removed and equilibrated again with the SDS equilibration buffer, which this time included 4% iodoacetamide.12 Agarose sealing solution was then added and the samples were run in an SDS-12.5% polyacrylamide gel electrophoresis (PAGE) large gel caster using 2 W for 12-15 h. SDS-PAGE. The protein sample was mixed 4:1 with the 5× sample buffer (0.5 M Tris, pH 6.8, 50% Glycerol, 10% SDS, and 5% 2-β mercaptoethanol) and was boiled for 5 min, and this sample was left on ice for 30 min. The sample was loaded to prepared polyacrylamide gel (30% acrylamide, 10% SDS, 10% APS, TEMED, and 1.5 M Tris pH 8.8 for resolving gel, 1.0 M Tris, pH 6.8 for stacking gel) in 1× SDS running buffer (3.03 g of Tris base, 14.4 g of Glycine, and 1 g of SDS per 1 L) at 200 V for 1 h. This gel was stained by colloidal coomassie blue (0.1% Coomassie Brilliant Blue R-250, 50% methanol and 10% glacial acetic acid).13 Western Blot. Electrophoresis was performed with supernatants loaded in 12% bis-poly acrylamide gels and samples were transferred to polyvinylidene fluoride (PVDF) membranes (Bio-Rad). The transferred membranes were blocked using TTBS buffer containing 0.05% Tween 20 and 3% skim milk. After diluting each sample to 1/1000 using serum from patients with C. pneumoniae infections, it was transferred onto the blocked membranes, left for 1 h at 37 °C, washed three times for 10 min each, and then incubated with blocking solution containing a 1:10 000 dilution of streptavidin-horseradish peroxidase (HRP)-conjugated anti-human IgG secondary polyclonal antibody. Signals were detected by enhanced chemiluminescence (ECL; Amersham Biosciences). Silver Staining of 2-D Gel. For silver staining of 2-D gels, each 2-D gel was fixed in 50% methanol, 12% acetic acid and 0.05% formalin in water for 2 h and then washed three times in 35% ethanol for 20 min each, followed by sensitization in 0.02% sodium thiosulfate for 2 min. After three rinses with water for 5 min, the 2-D gel was stained for 20 min in a 0.2% silver nitrate solution containing 0.076% formalin. This was discarded and then the 2-D gel was washed twice with water for 1 min each. The 2-D gel was developed in a solution containing 6% disodium carbonate, 0.05% formalin and 0.0004% sodium thiosulfate with intensive shaking. After the desired intensity of staining was achieved, the developer solution was discarded and the reaction stopped in a solution of 50% methanol and 12% acetic acid for 5 min. The silver-stained 2-D gel was stored in 1% acetic acid at 4 °C.14 In-Gel Protein Digestion. Protein bands of interest were excised and digested in-gel with modified sequencing-grade trypsin (Promega, Madison, WI). In brief, each protein spot was
research articles
Immunogenic Antigen Candidate for C. pneumoniae Diagnosis Table 1. Oligonucleotide Primers Used in This Study gene name
primer name
primer sequences (5′-3′)
mer
cloning sites
product size (bp)
Tm (°C)
Pmp G
PmpG-(L) PmpG-(R) Omp11-(L) Omp11-(R) IncA-(L) IncA-(R)
GGACTGCCATATGTTGAGGGAAAAAAAGGT AATGTCGACCAAATGGAGTGTACTC CTATGTTCATATGTTGTCAGCAGGCATTGC CGCGTCGACGAAAATAATACGGATA AGTCGTCCA TAT GTC ATC TCC TGT AAA TA ATAGAATTC ATC TGA CCA TCT CCT GTT GCT
30 25 30 25 29 30
Nde I SalI Nde I SalI Nde I EcoR I
2160
61.8 61.7 65 61.8 58.4 62.3
Omp 11 Inc A
excised from the gel, placed in a polypropylene tube and washed four to five times until the gel was clear with 150 µL of 1:1 acetonitrile/25 mM ammonium bicarbonate, pH 7.8. The gel slices were dried in a Speedvac concentrator and then rehydrated in 30 µL of 25 mM ammonium bicarbonate, pH 7.8, containing 20 ng of trypsin. After incubation at 37 °C for 20 h, the liquid was transferred to a new tube. Tryptic peptides remaining in the gel matrix were extracted for 40 min at 30 °C with 20 µL of 50% (v/v) aqueous acetonitrile containing 0.1% (v/v) formic acid. The combined supernatants were evaporated in a Speedvac concentrator and dissolved in 8 µL of 5% (v/v) aqueous acetonitrile solution containing 0.1% (v/v) formic acid for mass spectrometry.15 Identification of Proteins by LC-MS/MS. The resulting tryptic peptides were separated and analyzed using reversedphase capillary high performance liquid chromatography (HPLC) directly coupled with a Finnigan LCQ ion trap mass spectrometer with a slight modification. Both a 0.1 µm, 20 mm trapping and a 0.075 µm, 130 mm resolving column were packed with Vydac 218MS low trifluoroacetic acid C18 beads (5 µm diameter, 300 Å pore size; Vydac, Hesperia, CA) and placed in-line. The peptides were bound to the trapping column for 10 min with 5% (v/v) aqueous acetonitrile containing 0.1% (v/v) formic acid and then the bound peptides were eluted with a 50 min gradient of 5-80% (v/v) acetonitrile containing 0.1% (v/v) formic acid at a flow rate of 0.2 µL/min. For tandem mass spectrometry, a full mass scan range mode was m/z ) 450-2000 Da. After determination of the charge states of an ion on zoom scans, product ion spectra were acquired in MS/ MS mode with a relative collision energy of 55%. The individual spectra from MS/MS were processed using TurboSEQUEST software (Thermo Quest, San Jose, CA). The generated peak list files were used to query either the MSDB database or NCBI using the MASCOT program (http://www.matrixscience.com). Modifications of methionine and cysteine, peptide mass tolerance at 2 Da, MS/MS ion mass tolerance at 0.8 Da, allowance of missed cleavage at 2 and charge states (+1, +2 and +3) were taken into account. Only significant hits as defined by MASCOT probability analysis were considered initially. Protein scores were derived from ion scores as a nonprobabilistic basis for ranking protein hits (P < 0.05).16 Identification of Proteins by MALDI-TOF. Analysis of peptides using MALDI-TOF MS and identification of proteins mass measurement of tryptic peptides were carried out with a Voyager-DE STR mass spectrometer (PerSpective Biosystems) in reflectron positive ion mode. Close external calibration was performed for every four samples with calibration mixtures of adrenocorticotropic fragment 18-39 (monoisotopic mass, 2465.1989), Neurotensin (monoisotopic mass, 1672.9175), and Angiotensin I (monoisotopic mass, 1296.6853) as standard calibrants. Mass spectra were acquired for the mass range of 900-3500 Da. The proteins were identified by peptide mass fingerprinting searching, against the MASCOT program. The following mass search parameters were set: peptide mass
4764 1173
tolerance, 50 ppm; a mass window between 0 and 100 kDa; allowance of missed cleavage, 2; consideration for variable modifications such as oxidation of methionine and propionamides of cysteines. Only significant hits as defined by each programs were considered initially with at least 4 matching peptide masses.17 Protein Expression Constructs and Purification. The Omp11, PmpG and IncA genes were amplified by PCR with appropriate primers and Taq DNA polymerase (TaKaRa, Shiga, Japan) from C. pneumoniae strain KNIH-1, introducing restriction enzyme sites (Table 1). The PCR amplification product was purified using DNA-midi SV Plasmid DNA Purification kits (Intron, Seongnam, South Korea) and was confirmed by agarose gel electrophoresis (0.5 × TAE buffer, 0.7% (w/v) QA-Agarose; Q-biogene, Irvine, CA). The pET-21c plasmid was obtained using DNA-spin Plasmid DNA Extraction kits (Intron, Seongnam, South Korea). After the pET-21c and PCR amplification product had been digested using a restriction enzyme, they were purified using MEGA-spin Agarose Gel Extraction kits (Intron, Seongnam, South Korea). Purified insert DNA and pET21c were ligated at 16 °C for 16 h with T4 DNA Ligase (Roche, Mannheim, Germany) and transformed into Escherichia coli BL21 by electroporation.18 The E. coli BL21 transformant was inoculated in LB medium containing ampicillin (50 µg/mL) in a 50 mL flask and was cultured at 37 °C overnight. The overnight culture (2.5 mL) was inoculated in 50 mL of prewarmed media (with ampicillin) and was grown at 37 °C with vigorous shaking until an OD 600 of 0.7 was reached. Protein expression was induced by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) to a final concentration of 1 mM. After incubating the cultures for an additional 4-5 h, samples were collected, pelleted and washed three times with washing buffer (20 mM Tris-HCl, pH 7.8). Protein purification was carried out using Ni-NTA superflow system (Qiagen, Chatsworth, CA). ELISA. Diluted antigen to 0.1 µg/25 µL (4.0 µg/mL) with 100 mL of a coating buffer (0.1 M NaHCO3, pH 8.6) was added, and the solution was incubated at 4 °C for 24 h. At the end of the incubation, 100 mL of PBS with 0.05% Tween 20 (TPBS) was added; the solution was washed five times. Then, 100 mL of blocking buffer (TPBS and 3% BSA) was added, and the solution was incubated at 37 °C for 1 h. Human serum samples were diluted 1/100 in blocking buffer and 100 µL was added to the wells and incubated at 37 °C for 1 h. Then, 100 µL of TPBS was added, the culture was washed five times, 100 mL of TPBS with anti-human IgG peroxidase conjugate diluted to 1:1000 was added, and the culture was incubated at 37 °C for 1 h. After this, 100 µL of TPBS was added, and the culture was washed five times. ABTS peroxidase substrate solution (KPL, MD) was added, and the reaction allowed to proceed in the dark for 1 min. Sample concentration was estimated at 405 nm using a SPECTRAMax 250 microplate reader (MetaMorph, Molecular Devices). Journal of Proteome Research • Vol. 8, No. 6, 2009 2935
research articles
Park et al.
Figure 1. Two-dimensional gel electrophoresis images of C. pneumoniae EB and 2D Western blot using C. pneumoniae, L. pneumophila, and M. pneumoniae infection sera, healthy control and enlarged views of detected C. pneumoniae EB protein spots by C. pneumoniae infection sera. The 50 µg aliquots of proteins were used and isoelectric focusing was carried out with a pH gradient of 4-7. The samples were simultaneously separated on the electrophoresis gel (A). Western blot was used to screen candidate antigens. The 2-DE gel was transferred onto a PVDF membrane for 1 h at 100 V and analyzed with C. pneumoniae (B), L. pneumophila (C), M. pneumoniae (D) infection sera and healthy sera (E). Spot detection was carried out using an ECL system. Enlarged protein spots of partial 2-DE gels showing the detected spots through comparison between total spots of C. pneumoniae EB protein on the 2-DE map and reacted spots by C. pneumoniae infection sera on the PVDF membranes (F).
Results EB Separation and Definition of Potential Immunogenic Antigens in C. pneumoniae. Proteomics tools were used because they provide the ability to separate and identify individual proteins from complex biological samples. Total protein extracts from the C. pneumoniae KNIH-1 strain EBs using this Renocal-76 density gradient method were separated by 2-DE (Figure 1A). Immunoproteomics was used to define potential antigens from C. pneumoniae as the basis for developing a rapid and accurate diagnostic test. The separated protein spots by 2-DE were applied to Western blot using sera 2936
Journal of Proteome Research • Vol. 8, No. 6, 2009
from subjects with C. pneumoniae infection. C. pneumoniae infection sera were taken from volunteers. Samples were masked and prepared and tests were done and interpreted according to the manufacturer’s instructions. Table 2 shows the MIF results and comprehensive data of C. pneumoniae infection sera for this research. To determine the presence of C. pneumoniae infection, the detection of IgM and IgG antibody was performed using a microimmunofluorescence (MIF). Twenty samples were selected with IgG and IgM antibody titer and above the positive range (IgG antibody titer g1:128 and IgM antibody titer g1:16) and were treated according to ethical
Immunogenic Antigen Candidate for C. pneumoniae Diagnosis Table 2. IgG/IgM Antibody Titer Result Using Microimmunofluorescence (MIF) and Comprehensive Data of C. pneumoniae Infection Sera normal range
Mean age (years) IgG
256), 10 of M. pneumoniae infection sera (titer g40 AU/mL), and 10 of healthy sera (titer 64 or
