Article pubs.acs.org/JAFC
Immobilization of Clostridium cellulolyticum D‑Psicose 3‑Epimerase on Artificial Oil Bodies Chih-Wen Tseng,†,Δ Chien-Yi Liao,†,Δ Yuanxia Sun,‡ Chi-Chung Peng,§ Jason T. C. Tzen,# Rey-Ting Guo,*,‡ and Je-Ruei Liu*,†,∥,⊥ †
Institute of Biotechnology, National Taiwan University, Taipei, Taiwan Institute of Industrial Biotechnology, Chinese Academy of Sciences, Tianjin, China § Department of Biotechnology, National Formosa University, Huwei Township, Taiwan # Graduate Institute of Biotechnology, National Chung Hsing University, Taichung, Taiwan ∥ Department of Animal Science and Technology, National Taiwan University, Taipei, Taiwan ⊥ Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan ‡
S Supporting Information *
ABSTRACT: The rare sugar D-psicose possesses several fundamental biological functions. D-Psicose 3-epimerase from Clostridium cellulolyticum (CC-DPEase) has considerable potential for use in D-psicose production. In this study, CC-DPEase was fused to the N terminus of oleosin, a unique structural protein of seed oil bodies and was overexpressed in Escherichia coli as a CC-DPEase−oleosin fusion protein. After reconstitution into artificial oil bodies (AOBs), refolding, purification, and immobilization of the active CC-DPEase were simultaneously accomplished. Immobilization of CC-DPEase on AOB increased the optimal temperature but decreased the optimal pH of the enzyme activity. Furthermore, the AOB-immobilized CC-DPEase had a thermal stability and a bioconversion rate similar to those of the free-form enzyme and retained >50% of its initial activity after five cycles of enzyme use. Thus, AOB-immobilized CC-DPEase has potential application in the production of D-psicose at a lower cost than the free-form enzyme. KEYWORDS: immobilization, Clostridium cellulolyticum, D-psicose 3-epimerase, artificial oil body
■
at the C-3 position, producing D-psicose.6 Following an extensive literature review, only a few of the DTEase family of enzymes were investigated and reported, including DTEases from Pseudomonas cichorii7 and Rhodobacter sphaeroides,8 and Dpsicose 3-epimerases (DPEases) from Agrobacterium tumefaciens,9 Clostridium cellulolyticum,10 and Ruminococcus sp.11 Among the DTEase family of enzymes, Clostridium cellulolyticum DPEase (CC-DPEase) is an attractive and potential candidate for industrial use because it possesses a remarkable thermal stability as compared to the other DPEases.10 If CCDPEase could be immobilized on carriers and reused during industrial applications, the cost of D-psicose production would be reduced significantly. Conventional techniques for enzyme immobilization require an appropriate enzyme purification procedure before the immobilization step. If the purification and immobilization procedures can be combined into a single step, the time and cost of immobilized enzyme production would be substantially reduced. Artificial oil body (AOB) based immobilization is an easy and effective way to immobilize recombinant enzymes.12 With this method, the target enzyme is fused to sesame oleosin, a protein possessing a lipophilic central region and two
INTRODUCTION According to the definition provided by the International Society of Rare Sugars, rare sugars are monosaccharides and their derivatives that are rarely found in nature.1 Despite their extremely small quantities in nature, some rare sugars, such as D-allose, D-psicose, L-ribose, D-tagatose, and L-xylose, possess various biological functions and have considerable potential for use in certain industrial applications, such as cosmetics, flavors, food additives, and pharmaceutics.2 D-Psicose (D-ribo-2hexulose or D-allulose), an epimer of D-fructose at the C3 position, possesses several biological functions, including hypoglycemic,3 hypolipidemic,4 and antioxidant activities.5 In addition, D-psicose has about 70% of the sweetness of sucrose, no calories, and a low glycemic response in humans. Thus, it is an ideal substitute for sucrose.3 D-Psicose has just attained generally recognized as safe (GRAS) status under U.S. Food and Drug Administration (FDA) regulations, thereby permitting its use as an ingredient in foods and beverages, such as diet soft drinks, cakes, pies, ice creams, yogurts, jellies, and puddings. Large-scale, efficient production of D-psicose is valuable because it will lead to further commercial use of Dpsicose. D-Psicose can be synthesized using organic chemical reactions. However, the chemical synthesis is time-consuming and produces much waste.2,3 Hence, a biocatalytic procedure called Izumoring was developed for bioconversion of D-fructose to D-psicose.6 In the Izumoring process, the key enzyme Dtagatose 3-epimerase (DTEase) catalyzes the epimerization of © 2014 American Chemical Society
D-fructose
Received: Revised: Accepted: Published: 6771
April 30, 2014 June 30, 2014 July 1, 2014 July 1, 2014 dx.doi.org/10.1021/jf502022w | J. Agric. Food Chem. 2014, 62, 6771−6776
Journal of Agricultural and Food Chemistry
Article
scopic observation of the AOB-immobilized CC-DPEase was performed using a Leica TCS SP5 II spectral confocal microscope mounted on a Leica DMI 6000B inverted microscope (Leica Microsystems, Heidelberg, Germany) with a HCX PLAPO CS 63×/ 1.4-0.6 oil immersion objective. CC-DPEase Activity Analysis. The enzyme activity of the AOBimmobilized CC-DPEase was determined using D-fructose (50 g/L; Sigma-Aldrich Co.) as the substrate in a reaction mixture containing sodium phosphate buffer (50 mM, pH 7.0), Co2+ (0.1 mM), and enzyme (0.5 μM) at 72 °C for 10 min. The reaction was stopped by boiling for 10 min, and then the amount of D-psicose epimerized from D-fructose was determined by using a high-performance liquid chromatography (HPLC) method.10 The concentrations of D-psicose and D-fructose in the samples were determined by HPLC performed on a Shimadzu (Kyoto, Japan) LC-20 AT delivery system equipped with an RID-10A refractive index detector (Shimadzu), a Sugar-Pak I column (Waters Corp., Milford, MA, USA; 300 × 5 mm i.d.), and a Rheodyne injector (Rheodyne Inc., Cotati, CA, USA). The column was eluted at 80 °C with deionized water and a flow rate of 0.4 mL/ min. One unit of enzyme activity was defined as that producing 1 μmol of D-psicose per minute from D-fructose under the assay conditions, with specific activity expressed as units per milligram of protein. The protein concentration was determined using the Lowry assay against a standard curve of bovine serum albumin, fraction V (Sigma-Aldrich Co.).20 The bioconversion rate of D-fructose to D-psicose by the AOBimmobilized CC-DPEase was determined using D-fructose (50 g/L; Sigma-Aldrich Co.) as substrate in a reaction mixture containing sodium phosphate buffer (50 mM, pH 7.0), Co2+ (0.1 mM), and enzyme (0.5 μM) at 72 °C for 30 min. Optimal pH and Temperature of the AOB-Immobilized CCDPEase. The pH and temperature are the key factors affecting enzyme activity of CC-DPEase;10 therefore, we chose pH (denoted X1) and temperature (denoted X2) as the factors and CC-DPEase activity (denoted Y) as the response in the statistical experimental design. The optimal pH and temperature for the AOB-immobilized CC-DPEase were determined by applying CCD experimental design combined with RSM and regression analyses. On the basis of the CCD, a set of 13 experiments including 4 factorial points, 4 axial points, and 5 central points were performed. The experimental index numbers, scaled values, and actual values are shown in Table 1. The scaled values were defined as follows: X1 = (pH − 7); X2 = (T − 72.5)/7.5. The statistical experimental design, data, and regression analyses were carried out
amphipathic termini, and is expressed by Escherichia coli as an insoluble recombinant protein. The insoluble fusion protein was mixed with triacylglycerol and phospholipid and reconstituted as AOBs, in which the lipophilic portion of oleosin is embedded in the triacylglycerol core and the amphipathic arms, fused with the target enzyme, are protruding on the surface13 As illustrated in previous studies, the target enzyme tends to refold itself naturally and present itself in a biologically functional form on the surface of the AOB.12,14 Therefore, AOB-based immobilization is an efficient way to achieve purification and immobilization of the recombinant enzyme in one step. In this study, the CC-DPEase gene was constructed to allow E. coli to reveal the oleosin-fused protein. The purification, refolding, and immobilization of CC-DPEase were simultaneously accomplished upon reconstitution of the AOBs. To examine the alterations of enzyme characteristics due to the immobilization, central composite design (CCD) combined with response surface modeling (RSM) was employed for the planned statistical optimization of enzyme activity. The reusability and thermal stability of the AOB-immobilized CCDPEase were also determined.
■
MATERIALS AND METHODS
Construction of CC-DPEase Expression Plasmid. The DNA fragments encoding CC-DPEase (GenBank accession no. ACL75304) were amplified by polymerase chain reaction (PCR) from the plasmid pET-21a-CC-DPEase15 using the forward primer (5′ AGATCTATGAAACATGGTATATAC 3′) and reverse primer (5′ GGTACCGGAGTGTTTATG 3′). These two primers were designed to place a BglII site at the 5′ end and a KpnI site at the 3′ end of the PCR products, respectively. The PCR fragments encoding CC-DPEase were digested with restriction endonucleases BglII and KpnI. The fragments were then ligated with the BglII−KpnI-digested plasmid pET29Ole,16 generating pET29-DPEase-Ole, which was then sequenced to ensure that no errors were introduced during PCR. The resultant plasmids were used to transform E. coli BL21 (DE3) (Novagene, Madison, WI, USA) by standard techniques.17 The E. coli BL21 (DE3) transformants were selectively grown at 37 °C on Luria−Bertani (LB) agar plates (Difco Laboratories, Detroit, MI, USA) containing kanamycin (50 μg/ mL) (Sigma-Aldrich Co., St. Louis, MO, USA). Expression of Recombinant Proteins. The E. coli BL21 (DE3) transformants were cultured in LB broth at 37 °C with shaking at 250 rpm for overnight. The overnight culture was subsequently seeded at a 1:100 dilution into 50 mL of fresh LB broth. The cell cultures were maintained at 37 °C with shaking at 250 rpm, and the cell proliferation was measured turbidimetrically at 600 nm (OD600). Once the cells reached an OD600 of 0.5, the cells were induced to express the recombinant protein with 100 μM isopropyl-D-1-thiogalactopyranoside (IPTG; Sigma-Aldrich Co.). After 4 h of induction, the E. coli cells were harvested by centrifugation at 5000g for 10 min at 4 °C. Immobilization of CC-DPEase on AOB. The preparation of AOBs was carried out according to the method described by Chiang et 18 al. The E. coli cell pellet was resuspended in 1 mL of 50 mM sodium phosphate buffer (pH 7.4), ultrasonicated (Misonix, Farmingdale, NY, USA) for 10 min, and then fractionated into supernatant and pellet by centrifugation at 13000g for 10 min at 4 °C. To reconstitute the AOBs, the pellet fraction of the E. coli cell lysate containing 550 μg of oleosinfused recombinant proteins was resuspended in 1 mL of 50 mM sodium phosphate buffer (pH 7.4) and then mixed with 15 mg of olive oil (Sigma-Aldrich Co.) and 150 μg of phospholipid (Sigma-Aldrich Co.). The mixture was subjected to ultrasonication for 10 min. The reconstituted AOBs were collected after centrifugation at 13000g for 10 min at 4 °C and were washed with 50 mM sodium phosphate buffer solution (pH 7.4). The results of each step of AOB reconstitution were monitored using sodium dodecyl sulfate− polyacrylamide gel electrophoresis (SDS-PAGE).19 Confocal micro-
Table 1. Process Variables Used in the CCD and Treatment Combinations and Mean Experimental Responses for AOBImmobilized CC-DPEase scaled values (X1 = pH; X2 = T) index no.
X1
X2
X1
X2
CC-DPEase activitya (U/mg of total protein)
1 2 3 4 5 6 7 8 9 10 11 12 13
−1 0 −1.41 0 1 0 0 1.41 0 1 0 0 −1
−1 −1.41 0 0 1 0 0 0 0 −1 1.41 0 1
6 7 5.59 7 8 7 7 8.41 7 8 7 7 6
65 61.89 72.5 72.5 80 72.5 72.5 72.5 72.5 65 83.11 72.5 80
77.94 130.43 0.26 160.92 72.83 165.96 161.91 12.94 165.87 66.93 118.49 155.69 73.37
a
6772
actual values (X1 = pH; X2 = T)
Results represent the mean of three experiments. dx.doi.org/10.1021/jf502022w | J. Agric. Food Chem. 2014, 62, 6771−6776
Journal of Agricultural and Food Chemistry
Article
Figure 1. Immobilization of CC-DPEase on artificial oil bodies (AOBs): (A) scheme of production of AOB-immobilized CC-DPEase; (B) SDSPAGE analysis of CC-DPEase immobilized on AOBs (lanes: M, molecular weight marker; 1, cell lysate of the recombinant E. coli before IPTG induction; 2, cell lysate of the recombinant E. coli after IPTG induction; 3, soluble fraction of the cell lysate after centrifugation; 4, insoluble fraction of the cell lysate after centrifugation; 5, AOBs; 6, remaining supernatant after AOB recovery); (C) confocal microscopic observation of AOBimmobilized CC-DPEase (bar = 7.5 μm).
■
using Design Expert software (version 8.0.6, Stat-Ease Inc., Minneapolis, MN, USA). Regression analysis of the experimental data yielded linear, quadratic, and cubic polynomial models. Model analyses, lack-of-fit tests, and R-squared analyses were performed to validate the reliability of these models. A model with a significant P value (P < 0.05) in the model analyses, insignificant P value (P > 0.05) in lack-of-fit tests, maximum R-squared value, and smallest predicted residual sum of the squares (PRESS) was selected. Analysis of variance (ANOVA) was employed to determine the significance of the optimized model. After the optimal pH and temperature for the AOB-immobilized CC-DPEase were predicted, the actual activity of the AOBimmobilized CC-DPEase was determined at the optimal conditions to compare the predicted values and experimental data and check the reliability of the RSM. Student’s t test was used to detect the differences between the predicted and actual values.21 Thermal Stability of AOB-Immobilized CC-DPEase. The thermal stability of AOB-immobilized CC-DPEase was determined by incubation of the enzyme at 55 or 72 °C in sodium phosphate buffer (50 mM, pH 7.0) containing 0.1 mM Co2+. Aliquots were withdrawn at intervals of 0, 10, 30, 60, and 120 min, and the residual enzyme activities were measured as specified. Reusability of AOB-Immobilized CC-DPEase. The reusability of AOB-immobilized CC-DPEase was determined by incubation of the enzyme at 72 °C for 10 min in sodium phosphate buffer (50 mM, pH 7.0) containing 0.1 mM Co2+ and D-fructose (50 g/L). At the end of the reaction, the immobilized enzyme was recovered by centrifugation, and the supernatant was removed for analysis of the amount of Dpsicose epimerized from D-fructose. The reaction was restarted by administration of the recovered enzymes in a fresh substrate solution.
RESULTS AND DISCUSSION Simultaneous Refolding, Purification, and Immobilization of CC-DPEase on AOBs. The scheme of production of AOB-immobilized CC-DPEase is shown in Figure 1A. The DNA fragments encoding CC-DPEase were fused to the oleosin gene and overexpressed in E. coli. After induction with IPTG at 37 °C, a band of about 51 kDa corresponding to the CC-DPEase−oleosin fusion proteins was observed in the induced recombinant E. coli (Figure 1B, lane 2). The CCDPEase−oleosin fusion proteins were generally found in the insoluble fraction of the cell lysate after centrifugation (Figure 1B, lane 4). After reconstitution into AOBs, most of the CCDPEase−oleosin fusion proteins were present in the oil body fraction after centrifugation, and almost none of the CCDPEase−oleosin fusion protein was found in the supernatant fraction (Figure 1B, lanes 5 and 6). According to the confocal microscopic observation (Figure 1C), the sizes of the AOBs ranged from 0.5 to 3.5 μm, with a mean size of 2.0 μm. The CC-DPEase activities of proteins obtained from each step of the AOB reconstitution were determined by HPLC using Dfructose as the substrate. Detectable levels of CC-DPEase activity were observed in the reconstituted AOBs but not in the insoluble fraction of the cell lysate of the induced recombinant bacteria, indicating that CC-DPEase was immobilized on the AOB surface and folded into the active structure. From 1.0 g (wet weight) of E. coli cells, we obtained 17.33 mg of CCDPEase−oleosin fusion proteins and reconstituted 1.65 mL of 6773
dx.doi.org/10.1021/jf502022w | J. Agric. Food Chem. 2014, 62, 6771−6776
Journal of Agricultural and Food Chemistry
Article
specificity, or stability.22 Thus, we determined the optimal pH and temperature for the maximum enzyme activity of the AOBimmobilized CC-DPEase. We found that the maximum enzyme activity of the AOB-immobilized CC-DPEase occurred at pH 7.0 and 72 °C, which was different from that of the free-form CC-DPEase (pH 8.0 and 55 °C).10 Therefore, we suggest that immobilization of CC-DPEase on AOB increased the optimal temperature but decreased the optimal pH of the enzyme activity. To compare the bioconversion rate of D-fructose to Dpsicose by the AOB-immobilized CC-DPEase and by the freeform CC-DPEase, we performed epimerization reactions mediated by the AOB-immobilized CC-DPEase in the optimal reaction conditions for the free-form CC-DPEase (pH 8.0 and 55 °C) or for the AOB-immobilized CC-DPEase (pH 7.0 and 72 °C). The bioconversion rate of D-fructose to D-psicose by the AOB-immobilized CC-DPEase at pH 8.0 and 55 °C was 32.5%. This rate was similar to that of the free-form CCDPEase reported by Mu et al.10 In contrast, the bioconversion rate of D-fructose to D-psicose by the AOB-immobilized CCDPEase at pH 7.0 and 72 °C was higher (45.8 vs 32.5%) than at the optimal reaction conditions for free-form CC-DPEase (pH 8.0 and 55 °C). In many cases, immobilization has an adverse effect upon enzyme activity because the interaction of the enzyme with carrier causes the distortion of the enzyme. To avoid degradation of enzyme properties, immobilization of the enzyme on a carrier via a linker is useful because the enzyme is flexible and reacts with the substrate more easily.22 In this study, we introduced a linker polypeptide between the CCDPEase and oleosin domains in the CC-DPEase−oleosin fusion protein. The AOB-immobilized CC-DPEase showed a bioconversion rate similar to that of the free-form enzyme, indicating that the CC-DPEase domain in the fusion protein was able to present its original conformation and maintain its functionality. Thermal Stability of the AOB-Immobilized CCDPEase. The thermal stability of AOB-immobilized CCDPEase was evaluated by exposing the enzyme to 55 or 72 °C for 120 min. The residual activity of the AOB-immobilized CC-DPEase after incubation at 55 °C for 120 min was 85%, which was similar to that of the free-form CC-DPEase reported by Mu et al.10 When the AOB-immobilized CC-DPEase was incubated at 72 °C for 120 min, the residual activity was 71% (Supporting Information Figure S1). Thermal stability is an essential requirement for industrial enzymes because the reaction at higher temperatures can increase the bioconversion rate, reduce the reactants solubility, and reduce the risk of contamination during biocatalytic processes.23 CC-DPEase has considerable potential in industrial practice because it possesses a remarkable thermal stability. Compared to A. tumefaciens DPEases, CC-DPEase has a similar bioconversion rate of 32%, but the half-life of CC-DPEase (9.5 h at 55 °C) is much longer than that of A. tumefaciens DPEase (8.9 min at 55 °C).10,15 For the purpose of recovery and reuse, we immobilized CC-DPEases on AOBs and demonstrated that the bioconversion rate of D-fructose to D-psicose by the AOBimmobilized CC-DPEase was similar to that of the free-form enzyme. Thus, the AOB-immobilized CC-DPEase has potential application in the production of D-psicose at a lower cost than that of the free-form enzyme. Reusability of the AOB-Immobilized CC-DPEase. To evaluate the feasibility of recovery and recycle of the AOBimmobilized CC-DPEase, the relative activity of the AOBimmobilized CC-DPEase was determined during five consec-
AOBs. The protein concentration of the reconstituted AOBs was 10.5 mg/mL. Optimization of Reaction Conditions for the AOBImmobilized CC-DPEase. Mu et al. indicated that environmental pH and temperature were the key factors affecting the activity of CC-DPEase.10 Therefore, we chose these two factors and employed a CCD experimental design and RSM analysis to determine the reaction conditions for optimal enzyme activity of the AOB-immobilized CC-DPEase. On the basis of the CCD experimental design, a set of 13 experiments were performed. The scaled and actual values of pH and temperature performed in the experiments and the results for enzyme activities are shown in Table 1. Regression analysis of the experimental data yielded linear, quadratic, and cubic polynomial models. In the analysis of the mathematical models, the quadratic model appeared to be the most accurate (P < 0.05), with insignificant lack-of-fit (P > 0.05) and the smallest PRESS value (Supporting Information Table S1). These results suggested that the quadratic model was more reliable and accurate than the other models. The quadratic regression equation obtained was Y = −4956.10 + 1038.45 × pH + 41.11 × T − 75.93 × pH2 − 0.30 × T 2 + 0.35 × pH × T
(1)
where Y is the predicted response for a specific activity (U/mg of total protein) of the AOB-immobilized CC-DPEase and pH and T are the actual values for pH and temperature (see Table 1). The three-dimensional plot as functions of pH and temperature on the specific activities of the AOB-immobilized CC-DPEase is shown in Figure 2. The model predicted that the
Figure 2. Response surface plot for the effects of pH and temperature on the specific activity of AOB-immobilized CC-DPEase.
maximum specific activity of the AOB-immobilized CC-DPEase (162.13 ± 6.83 U/mg) would be observed at 72 °C and pH 7.0. To confirm the applicability of the model, the specific activity of AOB-immobilized CC-DPEase was determined at the suggested optimum conditions. The experimental activity of 166.22 ± 0.53 U/mg confirmed the accuracy of the model. Immobilization of enzymes can cause slight distortions in the enzyme structure, resulting in alterations in their activity, 6774
dx.doi.org/10.1021/jf502022w | J. Agric. Food Chem. 2014, 62, 6771−6776
Journal of Agricultural and Food Chemistry
■
utive rounds of bioconversion of D-fructose to D-psicose at pH 7.0 and 72 °C. The AOB-immobilized CC-DPEase retained >50% of its initial activity after five cycles of enzyme use (Supporting Information Figure S2). Immobilized enzymes are preferred in biocatalytic processes for industrial applications because immobilized enzymes can be recycled and thus reduce the cost of production. AOB-immobilized enzymes can be easily and simply recovered from the surface of the reaction mixture by flotation centrifugation. Therefore, several enzymes, including D-hydantoinase, xylanase, and glucanase, have been immobilized on AOBs in previous studies.12−14 Results in the previous and in our studies proved that, under optimal conditions, AOB-immobilized enzymes could be reused many times, thereby lowering the cost of enzymes for industrial application where the cost of enzymes is high. In conclusion, the gene encoding CC-DPEase was cloned and expressed as an oleosin-fused protein in E. coli. Simultaneous refolding, purification, and immobilization of the active C-DPEase were accomplished as a result of reconstituting the AOBs. CCD experimental design combined with RSM and regression analyses were successfully applied to determine the optimal pH and temperature for the AOBimmobilized CC-DPEase. The optimum conditions for maximum enzyme activity of the AOB-immobilized CCDPEase were observed at 72 °C and pH 7.0. Moreover, the AOB-immobilized CC-DPEase had a bioconversion rate and thermal stability similar to those of the free-form enzyme, but could be reused five times while retaining >50% of its activity. These results prove that the AOB-immobilized CC-DPEase has potential application in the production of D-psicose at a lower cost than the free-form enzyme does.
■
ASSOCIATED CONTENT
Table S1 and Figurs S1 and S2. This material is available free of charge via the Internet at http://pubs.acs.org.
AUTHOR INFORMATION
Corresponding Authors
*(R.-T.G.) Phone: 86-22-84861999. Fax: 86-2-24828701. Email:
[email protected]. *(J.-R.L.) Phone: 886-2-33666011. Fax: 886-2-33666001. Email:
[email protected]. Author Contributions Δ
REFERENCES
(1) International Society of Rare Sugars. Definition of rare sugars. In Proceedings of the 5th Symposium of International Society of Rare Sugars, Kagawa, Japan, 2011. (2) Tang, S.-Y. Rare sugars: applications and enzymatic production. J. Biocatal. Biotransformation 2012, 01, 2. (3) Chung, M.-Y. M.; Oh, D.-K. D.; Lee, K. W. K. Hypoglycemic health benefits of D-psicose. J. Agric. Food Chem. 2012, 60, 863−869. (4) Baek, S. H. S.; Park, S. J. S.; Lee, H. G. H. D-psicose, a sweet monosaccharide, ameliorate hyperglycemia, and dyslipidemia in C57BL/6J db/db mice. J. Food Sci. 2010, 75, H49−H53. (5) Suna, S. S.; Yamaguchi, F. F.; Kimura, S. S.; Tokuda, M. M.; Jitsunari, F. F. Preventive effect of D-psicose, one of rare ketohexoses, on di-(2-ethylhexyl) phthalate (DEHP)-induced testicular injury in rat. Toxicol. Lett. 2007, 173, 107−117. (6) Granströ m, T. B.; Takata, G.; Tokuda, M.; Izumori, K. Izumoring: a novel and complete strategy for bioproduction of rare sugars. J. Biosci. Bioeng. 2004, 97, 89−94. (7) Itoh, H.; Okaya, H.; Khan, A. R.; Tajima, K.; Hayakawa, S.; Izumori, K. Purification and characterization of D-tagatose 3-epimerase from Pseudomonas Sp, St-24. Biosci., Biotechnol., Biochem. 1994, 58, 2168−2171. (8) Zhang, L.; Mu, W.; Jiang, B.; Zhang, T. Characterization of Dtagatose-3-epimerase from Rhodobacter sphaeroides that converts Dfructose into D-psicose. Biotechnol. Lett. 2009, 31, 857−862. (9) Kim, H. J.; Hyun, E. K.; Kim, Y. S.; Lee, Y. J.; Oh, D. K. Characterization of an Agrobacterium tumefaciens D-psicose 3-epimerase that converts D-fructose to D-psicose. Appl. Environ. Microbiol. 2006, 72, 981−985. (10) Mu, W.; Chu, F.; Xing, Q.; Yu, S.; Zhou, L.; Jiang, B. Cloning, expression, and characterization of a D-psicose 3-epimerase from Clostridium cellulolyticum H10. J. Agric. Food Chem. 2011, 59, 7785− 7792. (11) Zhu, Y. Y.; Men, Y. Y.; Bai, W. W.; Li, X. X.; Zhang, L. L.; Sun, Y. Y.; Ma, Y. Y. Overexpression of D-psicose 3-epimerase from Ruminococcus sp. in Escherichia coli and its potential application in Dpsicose production. Biotechnol. Lett. 2012, 34, 1901−1906. (12) Hung, Y.-J. Y.; Peng, C.-C. C.; Tzen, J. T. C. J.; Chen, M.-J. M.; Liu, J.-R. J. Immobilization of Neocallimastix patriciarum xylanase on artificial oil bodies and statistical optimization of enzyme activity. Bioresour. Technol. 2008, 99, 8662−8666. (13) Chiang, C.-J.; Chen, H.-C.; Kuo, H.-F.; Chao, Y.-P.; Tzen, J. T. C. A simple and effective method to prepare immobilized enzymes using artificial oil bodies. Enzyme Microb. Technol. 2006, 39, 1152− 1158. (14) Zeng, Y.-F.; Hung, Y.-J.; Chen, M.-J.; Peng, C.-C.; Tzen, J. T. C.; Liu, J.-R. Simultaneous refolding, purification, and immobilization of recombinant Fibrobacter succinogenes 1,3−1,4-β-D-glucanase on artificial oil bodies. J. Chem. Technol. Biotechnol. 2009, 84, 1480−1485. (15) Chan, H.-C. H.; Zhu, Y. Y.; Hu, Y. Y.; Ko, T.-P. T.; Huang, C.H. C.; Ren, F. F.; Chen, C.-C. C.; Ma, Y. Y.; Guo, R.-T. R.; Sun, Y. Y. Crystal structures of D-psicose 3-epimerase from Clostridium cellulolyticum H10 and its complex with ketohexose sugars. Protein Cell 2012, 3, 123−131. (16) Peng, C.-C.; Shyu, D. J. H.; Chou, W.-M.; Chen, M.-J.; Tzen, J. T. C. Method for bacterial expression and purification of sesame cystatin via artificial oil bodies. J. Agric. Food Chem. 2004, 52, 3115− 3119. (17) Green, M. R.; Sambrook, J. Molecular Cloning: A Laboratory Manual, 4th ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2012. (18) Chiang, C.-J.; Chen, H.-C.; Chao, Y.-P.; Tzen, J. T. C. Efficient system of artificial oil bodies for functional expression and purification of recombinant nattokinase in Escherichia coli. J. Agric. Food Chem. 2005, 53, 4799−4804. (19) Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680− 685.
S Supporting Information *
■
Article
These authors contributed equally to this work.
Funding
This research was conducted using funds partially provided by Grant NSC 102-2628-B-002-007-MY2 from the National Science Council, Taiwan, Republic of China. Notes
The authors declare no competing financial interest.
■
ABBREVIATIONS USED AOB, artificial oil body; CCD, central composite design; DPEase, D-psicose 3-epimerase; DTEase, D-tagatose 3-epimerase; HPLC, high-performance liquid chromatography; IPTG, isopropyl-L-D-thiogalactopyranoside; RSM, response surface modeling; SDS-PAGE, sodium dodecyl sulfate−polyacrylamide gel electrophoresis 6775
dx.doi.org/10.1021/jf502022w | J. Agric. Food Chem. 2014, 62, 6771−6776
Journal of Agricultural and Food Chemistry
Article
(20) Lowry, O. H.; Rosebrough, N. J.; Farr, A. L.; Randall, R. J. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 1951, 193, 265−275. (21) Montgomery, D. C. Design and Analysis of Experiments, 8th ed.; Wiley: New York, 2012. (22) Rodrigues, R. C.; Ortiz, C.; Berenguer-Murcia, Á .; Torres, R.; Fernández-Lafuente, R. Modifying enzyme activity and selectivity by immobilization. Chem. Soc. Rev. 2013, 42, 6290−6307. (23) Ward, O. P.; Moo-Young, M. Thermostable enzymes. Biotechnol. Adv. 1988, 6, 39−69.
6776
dx.doi.org/10.1021/jf502022w | J. Agric. Food Chem. 2014, 62, 6771−6776
