Improved Antithrombotic Function of Oriented Endothelial Cell

Subscriber access provided by UNIVERSITY OF ADELAIDE LIBRARIES

Article

Improved Antithrombotic Function of Oriented Endothelial Cell Monolayer on Microgrooves jiayan Chen, Mi Hu, He Zhang, Bochao Li, Hao Chang, Ke-Feng Ren, Yunbing Wang, and Jian Ji ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.7b00496 • Publication Date (Web): 14 Aug 2017 Downloaded from http://pubs.acs.org on August 17, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Biomaterials Science & Engineering is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Improved Antithrombotic Function of Oriented Endothelial Cell Monolayer on Microgrooves Jia-yan Chen,a Mi Hu,a He Zhang,a Bo-chao Li,a Hao Chang,a Ke-feng Ren,*,a Yun-bing Wangb and Jian Jia

a

MOE Key Laboratory of Macromolecule Synthesis and Functionalization, Department of

Polymer Science and Engineering, Zhejiang University, Hangzhou 310027, China b

National Engineering Research Center for Biomaterials, Sichuan University, Chengdu 610064,

China

ABSTRACT: Achievement of an endothelial cell (EC) monolayer (re-endothelialization) on the vascular implant surface with competent and functioning features is critical for long-term safety after implantation. Oriented EC monolayer is beneficial to improve endothelial function such as enhanced athero-resistent property. However, the information about antithrombotic property of oriented EC monolayer is limited. Here, we used the microgrooved polydimethylsiloxane substrates to guide EC orientation and obtain oriented EC monolayer. The effects of anisotropic topography on EC behaviors and antithrombotic function of the EC monolayer were then evaluated. Our data demonstrated that ECs responded to grooves in a size-dependent way as shown in oriented cell cytoskeleton and nuclei, enhanced directed migration and overall velocity.

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 40

Furthermore, compared to the EC monolayer on the flat surface, the oriented EC monolayer formed on the grooved substrates exhibited improved antithrombotic capability as indicated by higher expression of functional related genes, production of prostacyclin and tissue plasminogen activator, and prolonged activated coagulation time. The improvement of antithrombotic function was especially notable on the smaller-size groove. These findings reveal the responses of ECs to varisized topography and antithrombotic function of the oriented EC monolayer, providing insights into optimal design of vascular implants.

KEYWORDS: microgrooved polydimethylsiloxane, behaviors, oriented endothelial cell monolayer, antithrombotic function

INTRODUCTION Percutaneous coronary interventions (PCI) are effective and widely performed methods for the treatment of coronary artery disease (CAD).1 However, failed cases inevitably exist due to disruption of vascular endothelium during the process of implantation, which causes acute postimplantation complications including thrombosis and neointimal hyperplasia.2-4 In the vasculature, endothelium composed of an intact endothelial cell (EC) monolayer lies between the vessel wall and blood, and plays a pivotal role in maintaining vascular health. On the one hand, endothelium as a semipermeable barrier controls the substance exchange between tissues and


2

Page 3 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


blood; On the other hand, it also regulates numerous functions through production of substances involved in blood coagulation, inflammation and vasodilatation, and so on.5-7 Hence, reendothelialization on the surfaces of implants is widely considered to be a useful strategy for avoiding undesired postimplantation outcomes and a lot of efforts have been made to promote endothelialization.8-11 For instance, Shin et.al accelerated endothelialization by immobilization of vascular endothelial growth factor on the surface.12 In addition, through synergic effects of the nonspecific resistance of phosphorylcholine and the specific recognition of the REDV peptide, Wei et.al enhanced ECs competitiveness over smooth muscle cells (SMCs) to achieve endothelialization.13 However, it should be noted that improving endothelialization is not enough and healthy function of regenerated endothelium is of great importance as well.14 Improving endothelialization is not synonymous with performing normal endothelial function as the regenerated incompetent EC monolayer might be dysfunctional and lack antithrombotic and antiatherogenic properties, which can lead to the development of late stent thrombosis and neoatherosclerosis.5 Therefore, much more attention should be paid to function of the regenerated EC monolayer. Among a variety of vital endothelial functions, antithrombosis is one of the most important properties for the EC monolayer and the regenerated EC monolayer with antithrombotic property on the surface of vascular stents is of great benefit for reducing the incidence of late stent thrombosis, which leads to acute myocardial infarction and remains a major cause of death and morbidity after PCI.15-16 The antithrombotic property of EC monolayer


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 40

is achieved by inhibition of blood coagulation and platelet aggregation through many functional molecules including prostacyclin (PGI2), thrombomodulin (THBD), nitric oxide (NO) and so on, as well as by production and secretion of tissue plasminogen activator (tPA) that activates the fibrinolysis system.5 In the blood vessels, native ECs are elongated and aligned with the direction of blood flow as a result of hemodynamic shear stress and natural extracellular matrix with nano/micro-scale topography.17-18 Previous studies found that this oriented EC monolayer showed better endothelial function as it can be resistant to inflammation while the non-aligned endothelium at bends and braches of vessels tends to induce the atherosclerosis.19-20 For instance, Huang and coworkers demonstrated that oriented EC monolayer formed on both microgrooves and aligned nanofibrillar substrates reduced its adhesiveness for platelets and monocytes, which indicated its better athero-resisitent property.21 However, the antithrombotic function of oriented EC monolayer is mainly unclear. Here, we aim to study the responses of ECs on grooved surfaces with varying sizes and pay particular attention to antithrombotic function of EC monolayer. In the present study, we utilized microgrooved polydimethylsiloxane (PDMS) with different sizes to guide EC orientation and study its behaviours, including adhesion, migration and proliferation. Then we detailedly evaluated the antithrombotic function of EC monolayer in terms of its morphology, expression levels of endothelial function related genes, production of antithrombotic substances and anticoagulation.


4

Page 5 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


EXPERIMENTAL SECTION Materials. Poly(dimethylsiloxane) (PDMS, Sylgard 184 kit, Dow Corning, USA). The patterned silicon mold was prepared by Suzhou Institute of Nano-Tech and Nano-Bionics (SINANO), Chinese Academy of Sciences using photolithography. Phosphate buffered saline (PBS), tris-buffered saline (TBS) and bovine serum albumin (BSA) were purchased from Sangon Biotech (Shanghai, China). Human umbilical vein endothelial cells (HUVECs, Catalog #8000) and Endothelial Cell Medium (ECM, Catalog #1001) were obtained from Sciencell Research Laboratories (USA). 0.25% trypsin-EDTA solution and penicillin and streptomycin (P/S) were purchased from Genom Biomedical-tech (Hangzhou, China).Type I collagen (10KDa) was purchased from Chengdu Kele Biological Technology Co.Ltd.(China). Fabrication and characterization of grooved substrates. The grooved surface was fabricated by casting PDMS onto a silicon mold. For preparation of grooved and flat PDMS, a solution of PDMS resin and curing agent (10:1 w/w ratio) was mixed and placed under vacuum for 30min to remove bubbles. Then the mixture was poured onto the patterned mold and cured at 120℃ for 15min. Finally, the samples were peeled off from the mold carefully and cut into small pieces (1×1cm). The surface morphologies of PDMS were characterized using scanning electron microscopy (SEM, Hitachi SU8010, Japan). Given that PDMS is highly hydrophobic, collagen was absorbed onto the surface in order to promote cell adhesion on the PDMS. Firstly, the PDMS substrates were treated by air plasma for


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 40

20min at 20Pa to improve surface hydrophilicity. Then 0.5mg/ml solution of type I collagen in PBS was adsorbed onto the surface and incubated at 37℃ for 2h. Cell culture. Human umbilical vein ECs were cultured in endothelial cell medium at 37 °C in an atmosphere containing 5% CO2. The culture medium was changed every 3 days, and ECs at 80-90% confluence were used for further cell experiments. The ECs used for experiments were between three and eight passages. Cell adhesion assay and image analysis. ECs were seeded on the PDMS substrates at a density of 2 × 104 cells/cm2. After 4 h of culture, ECs were fixed in 4% paraformaldehyde in PBS for 20 min and permeabilized in TBS containing 0.1% Triton X-100 (T8787, Sigma, USA) for 15 min. After rinsing 3 times with TBS, ECs were blocked with 1mg/ml BSA in TBS for 1 h. The cells were then incubated with phalloidin-tetramethyl-rhodamine B isothiocyanate (phalloidin-TRITC, P1951, Sigma, USA, 1:300 v/v) in TBS with 1mg/ml BSA for 45 min. Finally, cell nuclei were stained with 4′, 6-diamidino-2-phenylindole (DAPI, D8417, Sigma, USA, 1:100v/v) in TBS for 20 min and samples were washed in TBS. All of the samples were placed mounted onto coverslips with ProLong gold antifade reagent (P36934, Invitrogen, USA) and viewed under an Olympus DP72 inverted microscope (Olympus, Japan) using a 10×objective and the confocal laser scanning microscope（Zeiss LSM 780，Germany） using a 63×objective. The fluorescence images were quantitatively analyzed with ImageJ software. The analysis of cell density was performed by counting the nuclei in the DAPI-labelling images, using the cell


6

Page 7 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


counter plugin. The alignment and elongation of nuclei were analyzed according to previous study.22 Briefly, the outlines of nuclei were best fitted to ellipses. The aspect ratio refers to major axis/minor axis. The alignment angle was defined by |θ|, whereas θ refers to the angle between groove direction and the nuclei major axis. The scope of θ is -90°~90°. (Scheme 1).

Scheme 1. Schematic representation of the alignment angle.

Cell migration and proliferation assays. ECs were initially seeded at a density of 104cells/cm2 so as to minimize the influence of intercellular interactions. After culturing for 10 hours, migration of ECs was in situ monitored by a time-lapse phase-contrast microscope (DMI6000B, Leica) with an incubation chamber, offering the humidified atmosphere of 37℃ and 5% CO2. Behaviours of ECs were studied on several positions of a same substrate and the timelapse images were taken every 10 min for 8 h for a total of 48 images. Each individual cell was


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 40

then traced using the manual tracking plugin in ImageJ software. The trajectories, average migration velocity and effective displacement were obtained using the Chemotaxis Tool. As for cell proliferation assay, cell seeding density was 5× 103 cells/cm2. The culture medium was changed every day. After 6 hours, 1 day, 2 days and 4 days, cells were fixed and then were stained with DAPI as described in Cell adhesion assay. Cell numbers at different time periods were counted using the cell counter plugin in ImageJ software. Morphology of the EC monolayer. ECs were seeded on all the PDMS substrates at a density of 105cells/cm2. The culture medium was replaced every day. After reaching confluence, ECs continued to be cultured for 2 days. The EC monolayer was obtained and then stained with monoclonal anti-Human PECAM-1 (CD31) (mouse IgG1 isotype, P8590, Sigma, USA, 1:300 v/v), Alexa Fluor 488-conjugated goat antimouse IgG Secondary antibody (Invitrogen, USA, 1:300 v/v) and DAPI (1:100v/v). All of the samples were placed mounted onto coverslips with antifade reagent and viewed under a fluorescence microscope (Axio-vert 200 M, Zeiss, Germany) using a 10×objective. ECs of EC monolayer were analyzed with Image J in terms of cell circularity and the alignment angle. The circularity was defined as 4π (area/perimeter2) and a circularity value of 1 refers to the shape of a circle while a value of 0 indicates that of a straight line. The alignment angle of cells refers to nuclei alignment angle mentioned above and the outlines of cells were best fitted to ellipses.


8

Page 9 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Real-Time PCR assay. The expression of genes related to endothelial function was analyzed, including collagen IV, biglycan, platelet endothelial cell adhesion molecule-1 (PECAM1/CD31), vascular endothelial cadherin (CD144) and endothelial nitric oxide synthase (eNOS). RNA was extracted from ECs after the EC monolayer formation using a TRIzol Reagent kit (Haogene Biotech, China). The extracted and purified RNA samples (500 ng) were reverse transcribed into cDNA using a 1stStrand cDNA Synthesis Kit (Haogene Biotech, China). Generated cDNA samples were used as templates to perform a standard PCR analysis using Power SYBR® Master Mix (Invitrogen). PCR primers were designed to amplify human genes (Table 1). PCR products were detected by Real-Time PCR Detection Systems (CFX384, BioRad, Hercule, CA, USA).

Table 1. RT-PCR primers and conditions Gene

Genbank Accession

Human Collagen IV

NM_001845.5

Primer Sequences(5' to 3')

Size(bp)

Annealing (℃)

104

60

90

60

163

60

142

60

CCACAGGGACCACCAGGACAAA GGGTTTCCAGGGTAGCCAGATG CACCTCCAGCCAACTTCACCAT Human CD31

NM_000442.4 CACTGTCCGACTTTGAGGCTATCT CCAAGCCCTACCAGCCCAAAGT

Human CD144

NM_001795.3 GCCGTGTTATCGTGATTATCCGTGA CCGAGTCCTCACCGCCTTCT

Human eNOS

NM_000603.4 GGTAACATCGCCGCAGACAAA


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 40

GCGGGAACCCACTGGAGAACA Human Biglycan

NM_001711.4

162

60

127

60

CGATGGCCTGGATTTTGTTGTGGTC GAAGGTCGGTGTGAACGGATTTG GAPDH

NM_017008.4 CATGTAGACCATGTAGTTGAGGTCA

PGI2 and tPA production of EC monolayer. ECs continued to be cultured for 2 days after formation of the EC monolayer. The culture medium was collected and the concentration of prostacyclin (PGI-2) and tissue-type plasminogen activator (tPA) were measured by applying human PGI2 ELISA Kit (CK-E16079H, Rapid Bio, China) and human TPA ELISA Kit (EK0897,Boster Bio-engineering, China) respectively. Anti-coagulation assay. In terms of activated partial thromboplastin time (APTT) and thrombin time (TT) assays, all the operations were carried out according to corresponding instructions. The fresh whole blood was obtained from New Zealand white rabbit. A solution of trisodium citrate (0.109M, 1:9 v/v ratio) was added to the whole blood to prevent clotting. Platelet-poor plasma was prepared by centrifuging the whole blood at 3000 rpm for 15 min. The supernatant plasma was collected and then the EC monolayer formed on different substrates were incubated with the supernatant plasma and APTT/TT reagents (APTT: F008-1; TT: F009, Jiancheng Bio-engineering, China) successively to measure the plasma clotting time. Statistical analysis. All data were presented as mean±standard deviation (SD) and obtained from at least three independent experiments with at least three parallel samples per condition.


10

Page 11 of 40

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Statistical significance was assessed by ANOVA and student’s t test and the probability values of p

Improved Antithrombotic Function of Oriented Endothelial Cell

Recommend Documents