In Vitro and in Vivo Atheroprotective Effects of Gossypetin against

Article pubs.acs.org/crt

In Vitro and in Vivo Atheroprotective Effects of Gossypetin against Endothelial Cell Injury by Induction of Autophagy Hui-Hsuan Lin*,†,‡ †

School of Medical Laboratory and Biotechnology, Chung Shan Medical University, Taichung 402, Taiwan Clinical Laboratory, Chung Shan Medical University Hospital, Taichung 402, Taiwan

‡

ABSTRACT: Oxidized low-density lipoprotein (ox-LDL) contributes to the pathogenesis of atherosclerosis by promoting vascular endothelial cell injury. Gossypetin, a naturally occurring hexahydroxyflavone, has been shown to possess antimutagenic, antioxidant, antimicrobial, and antiatherosclerotic effects. In this study, the atheroprotective role of gossypetin was examined in endothelial cells. The protective effect of gossypetin against ox-LDL-induced injury in human umbilical vein endothelial cells (HUVECs) was first noted at 0.1−0.5 μM. Gossypetin showed potential in reducing ox-LDL-dependent apoptosis, as demonstrated by morphological and biochemical features, including formation of apoptotic bodies, distribution of hypodiploid phase, and activation of caspase-3. Next, the ox-LDLinduced formation of acidic vesicular organelles and the upregulation of autophagyrelated genes (LC3 and Beclin-1) were enhanced by gossypetin. Gossypetintriggered autophagic flux was further confirmed by an increase in the level of LC3-II under pretreatment conditions with an autophagy inhibitor, chloroquine (CQ). In addition, silencing Beclin-1 inhibited both the gossypetin-mediated protective affects and the autophagic process. Molecular data indicated that the autophagic effect of gossypetin might be mediated via the class III PI3K/Beclin-1 and PTEN/class I PI3K/Akt signaling cascades, as demonstrated by the use of a class III PI3K inhibitor, 3-methyladenine (3-MA), and a PTEN inhibitor, SF1670. Finally, gossypetin improved atherosclerotic lesions and endothelial injury in vivo. These data imply that gossypetin upregulates the autophagic pathway, which led to subsequent reduction of ox-LDL-induced atherogenic endothelial cell injury and apoptosis, and provide a new mechanism for the antiatherosclerotic activity of gossypetin.

■

INTRODUCTION Low-density lipoprotein (LDL) is implicated as a major risk factor for the development of atherosclerosis, a complex vascular disorder.1 Oxidized LDL (ox-LDL), the most atherogenic form of LDL, contributes to endothelial dysfunction. It not only elicits endothelial cell death and an increase in endothelial permeability but also induces the adhesion and migration of monocytes across the endothelial monolayer, promoting the initiation and progression of atherosclerosis.2,3 Apoptosis, one of the critical mechanisms triggered by ox-LDL, causes endothelial dysfunction and results in elimination of vascular endothelial cells and an increase in permeability of the vessel wall. These changes trigger atherosclerotic lesion rupture and later lead to clinical complications.4 Therefore, the inhibition of apoptosis of vascular endothelial cells is an attractive strategy for clinical therapy to treate atherosclerosis. Autophagy is a physiological process in the routine turnover of cellular constituents and serves as a temporary survival mechanism during inadequate nutrient availability, when selfdigestion provides an alternative energy source. Previous studies have reported that autophagy has another biological function, that is, the clearing of nonfunctional proteins under certain stress conditions, such as atherosclerosis.2,5 The induction of autophagy under pathological conditions has © XXXX American Chemical Society

been suggested to provide an adaptive strategy that allows the cells to survive under bioenergetic stress.6 In human umbilical endothelial vein cells (HUVECs), ox-LDL exposure activates the autophagy−lysosomal pathway through the microtubule associated protein light chain 3 (LC3)/autophagy-related genes (Atg) 6 (also known as Beclin-1) pathway. This pathway reduces ox-LDL-mediated cell injury by degrading ox-LDL, suggesting that autophagy plays a protective role in ox-LDLtriggered apoptotic cell death.3 Therefore, enhancing autophagy may be of benefit in the protection against atherosclerosis. Furthermore, a major signaling pathway believed to play a central role in autophagy is class I phosphatidylinositol-3 kinase (PI3K)/protein kinase B (PKB, also known as Akt)/ mammalian target of rapamycin (mTOR). This signaling pathway is activated under the presence of adequate nutrients and causes the inhibition of serine/threonine kinase Atg1, a major mediator of autophagy induction. Under nutrient-limited conditions or in the presence of mTOR inhibitors (e.g., rapamycin), mTOR is not activated, and Atg1 is able to form an Atg1 protein kinase autophagy-regulatory complex that signals the induction of autophagy.7 Formation of autophagosomes further depends on the assembly of a lipid kinase signaling Received: August 28, 2014

A

DOI: 10.1021/tx5003518 Chem. Res. Toxicol. XXXX, XXX, XXX−XXX

Article

Chemical Research in Toxicology

cell number is directly proportional to the production of formazan, following solublization with isopropanol, which was determined spectrophotometrically at 563 nm. Assessment of Cytotoxicity. To evaluate cytotoxicity, lactate dehydrogenase (LDH) released into the culture medium from the cells was analyzed using an assay kit (Pierce, Rockford, IL, USA). Briefly, 100 μL of cell-free supernatant, 250 μL of buffer, and 50 μL of coenzyme were mixed and incubated for 15 min at 37 °C, followed by the addition of 250 μL of 2,4-dinitrophenylhydrazine for another 15 min at 37 °C in the dark. Afterward, 2.5 mL of NaOH (0.4 M) was added to the reaction mixture. Three minutes later, 200 μL of each reaction mixture was transferred into the wells of a 96-well plate. The absorbance was determined at 440 nm. To calculate the LDH fold increase, the LDH activity of the spontaneous LDH release control (water-treated) was subtracted from that of the chemical (ox-LDL with or without gossypetin)-incubated sample, which was divided by the total LDH activity [(maximum LDH release control activity) − (spontaneous LDH release control activity)]. The fold increase of LDH in control was set to 1. The following formula was used:

complex containing Beclin-1 and class III PI3K that mediates nucleation of the preautophagosomal membrane (phagophore or isolation membrane) as well as on two ubiquitin-like conjugation pathways that stimulate expansion of the isolation membrane, including the Atg5−Atg12 conjugate and LC3-II (LC3-I C-terminally conjugated to phosphatidylethanolamine (PE)).8 In this way, autophagy is antiapoptotic and contributes to cellular recovery in an adverse environment. Gossypetin (3,5,7,8,3′,4′-hexahydroxyflavone), originally isolated from the flowers of Hibiscus species, is a kind of flavonoid and has been shown to have antimutagenic,9 antioxidant,10 antiatherosclerotic,11 and antimicrobial effects.12 Previous studies indicated that the consumption of food rich in gossypetin and quercetin, such as Hibiscus sabdariffa, helps to neutralize cancer-causing agents and to decrease oxidative stress and atherosclerosis.13 A recent study has shown that gossypetin not only inhibits ox-LDL uptake and foam cell formation but also promotes cholesterol efflux.14 This implies that gossypetin can be a potential antiatherogenic agent. However, the effect of gossypetin on the apoptotic damage and autophagic level in endothelial cells exposed to ox-LDL is still unknown. In this study, we attempted to explore this effect and the role of autophagy in it. We also delineated the underlying mechanisms with an emphasis on the protective autophagic pathway in vitro and in vivo.

■

LDH fold increase = (chemical compound − treated LDH activity − spontaneous LDH activity) /(maximum LDH activity − spontaneous LDH activity) Assessment of Cell Proliferation. The bromodeoxyuridine (BrdU) assay (Oncogene, Cambridge, MA, USA) was used to assay cell proliferation according to the manufacturer’s instructions. HUVECs were seeded into a 96-well plate (3.5 × 103 cells/well) and grown overnight. The cells were rinsed with serum-free medium once and then treated with ox-LDL (100 μg/mL) in the presence or absence of gossypetin at various concentrations (0.1, 0.5, 1.0, 2.0, 5.0, and 10.0 μM) in serum-free medium. In most of the experiments, pulse labeling of synthesized DNA was used. For this, the BrdU label was added 1 h before the end of the experiment. Cells were fixed, denatured, and probed with anti-BrdU antibody. Absorbance was determined at dual wavelengths of 450 and 540 nm in a microplate reader. The proliferation value (BrdU incorporation) was expressed as a percentage of absorbance of the treated cells to the absorbance of the nontreated control cells. The BrdU incorporation of control group was set to 100%. 4,6-Diamidino-2-phenylindole (DAPI) Staining. Apoptotic cell morphology characteristics were assayed by fluorescence microscopy of DAPI-stained cells. After treatment, the monolayer of cells was washed with PBS and fixed in 4% paraformaldehyde for 30 min at room temperature. The fixed cells were permeabilized with 0.2% Triton X-100 in PBS three times and then incubated with 1 μg/mL of DAPI solution for 30 min. After washing with PBS three times, the nuclei (intensely stained, fragmented nuclei and condensed chromatin) of apoptotic cells were observed under 400× magnification using a fluorescent microscope with a 340/380 nm excitation filter. The percentage of apoptosis was calculated as the proportion of apoptotic cells relative to total cells counted. At least three separate experiments were conducted, and at least 300 cells were counted for each experiment. Cell Cycle Analysis by DNA Content. The quantification of apoptosis of a 24 h cell culture was examined using a FACScan cytometer (Becton Dickinson). The treated cells were washed twice with PBS, and the cell suspension was then centrifuged at 1500 rpm for 5 min at room temperature. After removing the supernatant, 1 mL of 70% methanol was added to the pellet and incubated at −20 °C for 24 h. One milliliter of cold propidium iodide (PI) stain solution including 20 μg/mL PI, 20 μg/mL RNase A, and 0.1% Triton X-100 was added to the mixture and then incubated for another 15 min in the dark at room temperature. The samples were analyzed by flow cytometry. PI was excited at 488 nm, and fluorescence signal was subjected to logarithmic amplification, with PI fluorescence (red) being detected above 600 nm. Cell cycle distribution was presented as the number of cells versus the DNA content, as indicated by the intensity of fluorescence, and divided into subG1, G0/G1, S, and G2/

MATERIALS AND METHODS

Cell Culture and Treatment. HUVECs (BCRC H-UV001) were obtained from the Bioresource Collection and Research Center (Food Industry Research and Development Institute, Hsinchu, Taiwan, ROC). HUVECs from passages 7−9 were used in this study. Cells were maintained in medium 199 supplemented with 20 mmol/L HEPES, pH 7.4, 30 mg/L endothelial cell growth supplement, 100 mg/L heparin, 20% fetal bovine serum, and antibiotics (100 μg/mL streptomycin and 100 U/mL penicillin) at 37 °C under 5% CO2. Before treatment, cells were seeded at a density of 7.0 × 105 onto 100 mm Petri dishes for 24 h. For the inhibition test, chloroquine (CQ; 50 μM, Sigma-Aldrich), 3-methyladenine (3-MA; 10 mM, SigmaAldrich), or SF1670 (500 nM, Sigma-Aldrich) was added 2 h, 30 min, or 30 min, respectively, before ox-LDL incubation with or without gossypetin (ChromaDex Inc., Irvine, CA, USA; purity ≥99.0%). ox-LDL Preparation. Blood was obtained from healthy volunteers and collected in the presence of 0.01% ethylenediaminetetraacetic acid (EDTA). LDL (1.019 to 1.063 g/mL) was isolated by density ultracentrifugation at 4 °C in an Optima TL Beckman ultracentrifuge (Beckman Instruments, USA).15 After the isolation, EDTA in the LDL samples was removed by a Sephadex G-25 column (Pharmacia PD-10) equilibrated with phosphate-buffered saline (PBS). Protein concentration was measured using the BCA protein assay (Pierce, Rockford, IL, USA). LDL was diluted in PBS (100 μg/mL) and incubated at 37 °C in the presence of CuSO4 (10 μM) for 24 h to prepare ox-LDL. After the incubation, the formation of ox-LDL was measured with a thiobarbituric acid reactive substances (TBARS) assay to determine the extent of oxidation as described previously.14 The extent of LDL oxidative modification was expressed as nanomoles of malondialdehyde (MDA) per milligram of LDL protein. In this study, ox-LDL with TBARS values between 100 and 120 nmol/mg LDL protein was used and sterilized by filtration (pore size 0.45 μm). Assessment of Cell Viability. 3-(4,5-Dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) assay was used to evaluate the effect of the tested chemicals on cell viability as described previously.16 HUVECs were seeded into a 24-well plate (7.0 × 104 cells/well) and treated with ox-LDL (100 μg/mL) in the presence or absence of gossypetin at various concentrations (0.1, 0.5, 1.0, 2.0, 5.0, and 10.0 μM) for 24 h. Afterward, the medium was replaced with the MTT solution (0.1 mg/mL), and the cells were incubated for 4 h. The viable B


Article


Figure 1. Effects of various doses of gossypetin in combination with ox-LDL on HUVEC viability and proliferation. HUVECs were treated with various concentrations (0−10.0 μM) of gossypetin in the presence or absence of 100 μg/mL of ox-LDL for 24 or 48 h. Cell viability was analyzed by MTT assay. Dose- and time-dependent effects (A) or growth inhibitory effects (B) are presented as the mean ± SD (n = 3) from three independent experiments. #p < 0.05, ##p < 0.01 compared with control (Student’s t test). *p < 0.05, **p < 0.01, compared with the ox-LDL group (one-way ANOVA with Dunnett’s posthoc test). (C) LDH release assay of media from HUVECs treated with various concentrations (0−10.0 μM) of gossypetin in the presence or absence of 100 μg/mL of ox-LDL for 24 h. (D) Under the same treatment conditions as those in (C), cell proliferation was detected by BrdU assay. The quantitative data are presented as the mean ± SD (n = 3) from three independent experiments. #p < 0.05, ##p < 0.01 compared with control (Student’s t test). *p < 0.05 compared with the ox-LDL group (one-way ANOVA with Dunnett’s posthoc test). siRNA Oligonucleotides and Recombinant Adenovirus. Stealth RNAiTM siRNA duplex oligoribonucleotides were used as siRNAs to target human Beclin-1 (si-beclin), and the production of recombinant adenovirus was carried out according to a previously described method.18 The synthesized oligonucleotides against Beclin-1 were as follows: forward, 5′-GATCCCCCAGTTTGGCACAATCAATATTCAAGAGATATTGATTGTGCCAAACTGTTTTT A-3′; reverse, 5′-AGCTTAAAAACAGTTTGGCACAATCAATATCTCTTGAATATTGATTGTGCCAAACTGGGG-3′. Immunoprecipitation Assay. After treatment, 500 μg of protein from the cell lysates was precleared with protein A-Sepharose (Amersham Pharmacia Biotech), followed by immunoprecipitation (IP) using polyclonal anti-class III PI3K antibody. Immune complexes were harvested with protein A, and the immunoprecipitated proteins were assayed by western blotting as described above. Immunodetection was performed using polyclonal anti-Beclin-1 antibody. Evaluation of Atherosclerotic Lesions in Vivo. New Zealand white male rabbits (Animal Center of Chung Shan Medical University) weighing between 1800 and 2200 g were randomly divided into four groups: normal control (Purina Lab Diet 5031), normal diet with 10 mg/kg gossypetin (cytotoxicity group of gossypetin), high-cholesterol diet (HFD), and HFD with 10 mg/kg gossypetin (HFD + 10 mg/kg gossypetin). The rabbits on HFD were fed for 10 weeks with a HFD containing 95.7% standard Purina Chow (Purina Mills, Inc.), 3% lard oil, and 1.3% cholesterol to promote the atherosclerotic process. Animals receiving gossypetin treatment were orally fed wtih gossypetin at a dose of 10 mg/kg. The use of animals

M phases with CELLQuest, version 3.3, software. The portion of subG1 phase (hypodiploid cells) over total cells was calculated and expressed as the percentage apoptosis. Western Blotting. Western blot analysis was performed as previously described.17 Antibodies against LC3, Atg5, p62, and Beclin-1 were purchased from Novus Biological Inc. (Littleton, CO, USA), and those against caspase-3, PARP-1, class III PI3K, p-mTOR (Ser2448), mTOR, p-Akt (Ser473), Akt, class I PI3K, PTEN, and βactin (as an internal control) were from Santa Cruz (Santa Cruz, CA, USA). Immunodetection was performed using an enhanced chemiluminescence (ECL) detection kit. Acridine Orange (AO) Staining. The volume of the cellular acidic compartment, a marker of autophagy, was examined by staining with lysosomotropic agent AO (Sigma, St. Louis, MO, USA). AO moves freely across biological membranes and accumulates in acidic compartments, where its bright red fluorescence is observed. After incubation with ox-LDL (100 μg/mL) in the presence or absence of gossypetin (0.1 and 0.5 μM), the cells were stained with 1 μg/mL of AO for 15 min at room temperature in the dark. Acidic vesicular organelles were observed under a fluorescent microscope and photographed. The extent of acidic vesicular organelle formation was further quantified using a FACScan cytometer with the CELLQuest program. AO uptake was calculated by subtracting the mean fluorescent intensity of untreated control cells (autofluorescence) from that of ox-LDL-treated cells, with the group incubated with oxLDL alone designated as 100%. C


Article

Chemical Research in Toxicology was reviewed and approved by the Chung Shan Medical University Animal Care Committee. At the end of 10 weeks, the rabbits were sacrificed by exsanguination after deep anesthesia with sodium pentothal (120 mg/kg) via the marginal ear vein. Serum was stored at −80 °C until measurement of serum lipids and serum variables. To protect the endothelial lining, the aortic arch was treated carefully during removal and cleaning from the adherent soft tissue. Aortic arches were rapidly dissected out and kept in 10% neutral buffered formalin or at −80 °C. For pathological analysis, paraffin-embedded tissue sections of the aortic arch were stained with hematoxylin and eosin (H&E). In addition, commercial monoclonal anti-LDH antibody (an endothelial marker of cell injury) was used for target detection in the paraffin-embedded tissues. Western blot analysis was also performed with tissue extracts of the aortic arch from the rabbits. Serum Biochemical Assays. Serum samples were collected using EDTA tubes and centrifuged at 3000 rpm for 10 min at 4 °C. The concentration of total cholesterol, triglycerides, LDL-cholesterol (LDL-c), HDL-cholesterol (HDL-c), alanine transaminase (ALT), and aspartate aminotransferase (AST) was analyzed by enzymatic colorimetric methods using commercial kits (HUMAN, Germany). Statistical Analysis. Three or more separate experiments were performed. Data are reported as the mean ± standard deviation (SD) of three independent experiments. Student’s t test was used for analysis between two groups with only one factor involved. For the gossypetin dose−response experiments, one-way ANOVA with Dunnett’s posthoc test was used to calculate the p value for each dose treatment relative to the control (ox-LDL alone, without gossypetin). Regression was used to test the p value of the dependence of a parameter on dosage. Significant differences were established at p < 0.05.

was more pronounced when gossypetin at a dose of less than 0.5 μM was used in conjunction with ox-LDL exposure. Next, the protective effect of gossypetin against ox-LDL was examined to determine whether it is attributed to an increase in DNA synthesis or inhibition of cell death. For this purpose, the level of DNA synthesis was measured by a BrdU incorporation assay in cells grown under low-serum conditions. As shown in Figure 1D, ox-LDL inhibited BrdU incorporation, and the inhibition was strengthened by high doses of gossypetin (5.0 and 10.0 μM). However, lower doses of gossypetin (0.1 and 0.5 μM) had a small effect on DNA synthesis in the presence of ox-LDL (Figure 1D), suggesting that gossypetin does not promote DNA synthesis in the ox-LDL-treated HUVECs. Since the use of low doses of gossypetin (0.1 and 0.5 μM) together with ox-LDL (100 μg/mL) has the best antagonistic inhibition of ox-LDL-mediated cytotoxicity, these doses were selected for all further studies of the functional mechanism of this effect. Gossypetin Inhibits ox-LDL-Induced HUVEC Apoptosis. The possible effect of gossypetin on ox-LDL-induced HUVEC apoptosis was examined next. HUVECs treated with ox-LDL showed morphological changes that are characteristic of apoptosis, including cell shrinkage and nuclear condensation and fragmentation. Treatment with gossypetin protected against such injuries (Figure 2A). The proportion of apoptotic cells was further quantified by DAPI staining (Figure 2B). After treatment with ox-LDL for 24 h, the percentage of DAPIpositive cells, representing DNA fragmentation, increased by 25%. In the gossypetin-cotreated cells, the proportion of DAPIpositive cells decreased. In order to confirm the above observations, the number of apoptotic cells (hypodiploid cells) that were stained less intensely with PI and that can be unequivocally detected from the peak of the subG1 phase by flow cytometry was determined (Figure 2C) . When cells were exposed to ox-LDL for 24 h, more cells accumulated in the subG1 phase, from 2.40 to 23.70%. There was a nearly 20% increase in apoptotic cells (Figure 2D). However, when HUVECs were exposed to 0.1 and 0.5 μM of gossypetin, a concomitant dose-dependent decrease in the number of apoptotic cells was observed compared to that in the ox-LDL-treated group. To investigate the effect of gossypetin on ox-LDL-induced apoptotic pathways, changes in the expression of caspase-3 and poly(ADPribose) polymerase 1 (PARP-1), two markers of apoptosis, were detected in the HUVECs (Figure 2E). Stimulation with 100 μg/mL ox-LDL for 24 h significantly induced the cleavage of caspase-3 and PARP-1 compared to that in the control group (lane 1, Figure 2E). The cotreatment with gossypetin inhibited the ox-LDL-induced cleavage of both proteins in a dosedependent manner, with higher concentrations being more effective (lanes 3 and 4, Figure 2E). Gossypetin Enhances ox-LDL-Induced HUVEC Autophagy. A previous study found that ox-LDL activates the autophagy−lysosomal pathway, which reduces ox-LDL-mediated HUVEC injury.3 The molecular events responsible for activating the autophagic mechanism were further studied after ox-LDL treatment together with or without gossypetin. The results of AO staining showed that the cells exposed to ox-LDL at 100 μg/mL for 24 h had an increase in red fluorescent dots present in the cytoplasm, indicating the formation of acidic autophagolysosomal vacuoles (Figure 3A). The addition of gossypetin to the ox-LDL treatment induced a dose-dependent synergistic effect on autophagic levels, as evidenced by an

■

RESULTS Gossypetin Attenuated the Cytotoxic Effect of ox-LDL in HUVECs. HUVEC viability was tested following incubation with various concentrations of ox-LDL (from 1.0 to 200 μg/ mL), and it was found that ox-LDL decreased the cell viability dose dependently (data not shown). On the basis of these results, treatment with 100 μg/mL ox-LDL for 24 h was chosen for use in subsequent experiments in order to provide a maximum dynamic range for quantifying harmful responses. In our previous study, gossypetin at dosages above 5.0 μM functioned as an antioxidant agent, as evidenced by its ability to inhibit the protein oxidation and lipid peroxidation of LDL in a cell-free system.14 Therefore, a preliminary screen using an MTT assay was performed to study the effect of gossypetin in combination with ox-LDL (100 μg/mL) on the cellular growth of HUVECs at different time points. The viability of HUVECs was increased by treatment with 0.1 and 0.5 μM gossypetin in the presence of ox-LDL in a time- and dose-dependent manner when compared to that of the ox-LDL alone group (Figure 1A). In contrast, the proliferation of HUVECs under the combined use of ox-LDL and gossypetin at dosages above 2.0 μM was significantly lower than that of cells treated with oxLDL or gossypetin alone (Figure 1B). It is worth noting that the combination of ox-LDL and gossypetin demonstrated significant antagonistic efficacy, especially at doses of 0.5 μM for gossypetin and 100 μg/mL for ox-LDL, under which the oxLDL-mediated inhibition of cell growth was almost completely blocked. In addition, the cytotoxic effect of various doses of gossypetin in combination with 100 μg/mL of ox-LDL was further tested with an LDH cytotoxicity assay (Figure 1C). After a 24 h incubation, ox-LDL significantly increased the release of LDH from the cells. Supplementing high doses of gossypetin (5.0 and 10.0 μM) enhanced the cytotoxicity induced by ox-LDL. Importantly, the LDH assay confirmed that the protective effect D


Article

Chemical Research in Toxicology Figure 2. continued

treatment conditions as those in (A), the DNA content was analyzed using fluorescence flow cytometry. The position of the subG1 peak (hypodiploidy), composed of apoptotic cells, and those of the G0/G1, S, and G2/M peaks are indicated. (D) Quantitative assessment of the percent of cells in subG1 phase was indicated by PI staining and represents the mean ± SD (n = 3) of three independent experiments. ## p < 0.01 compared with control (Student’s t test). *p < 0.05, **p < 0.01 compared with the ox-LDL group (one-way ANOVA with Dunnett’s posthoc test). (E) Western blot analysis of the expression of caspase-3 and PARP-1 in HUVECs treated with the indicated concentrations of gossypetin in the presence or absence of 100 μg/ mL ox-LDL for 24 h. The protein levels below the blots represent relative density of the bands normalized to β-actin. The quantitative data are presented as the mean ± SD (n = 3) from three independent experiments. ##p < 0.01 compared with control (Student’s t test). *p < 0.05, **p < 0.01 compared with ox-LDL (one-way ANOVA with Dunnett’s posthoc test).

increase in the formation of autophagic vacuoles (Figure 3A,B) and the uptake of AO (Figure 3C). Treatment with 0.5 μM of gossypetin resulted in a 135% increase in AO uptake (Figure 3C). To study the autophagy-promoting role of gossypetin, the autophagic levels in HUVECs among different treatment groups were evaluated by detecting LC3 processing and LC3II accumulation by western blotting. LC3 processing, namely, an increased ratio of LC3-II/β-actin, was clearly enhanced in HUVECs exposed to ox-LDL (100 μg/mL) for 24 h, indicating that ox-LDL indeed induced autophagy in HUVECs (lane 2, Figure 3D). However, ox-LDL treatment also increased p62 expression, whose level is negatively correlated to autophagic flux19 (Figure 3D, lane 2), suggesting that ox-LDL could inhibit autophagic flux. Treatment with gossypetin further enhanced significantly the expression of LC3-II and Atg5−Atg12 conjugate and reduced the protein level of p62 compared to that in the ox-LDL alone group (lanes 3 and 4, Figure 3D). In order to confirm the induction of autophagic flux by gossypetin, a lysosomal inhibitor, CQ (50 μM for 2 h), was applied during gossypetin treatment to inhibit autophagolysosome degradation.20 Figure 3E,F shows that CQ alone induced a significant accumulation of LC3-II, which reflected an increase in autophagosomes due to the inhibition of autophagic flux. The presence of CQ, which disrupts lysosomal function, caused a higher level of LC3-II in the cells exposed to ox-LDL and gossypetin than that in cells without CQ (lane 6 compared with lane 3, Figure 3E). The addition of CQ to the ox-LDL alone group did not affect LC3-II accumulation (Figure 3E, lane 5 compared with lane 2) and cell viability (Figure 3F). On the other hand, pretreatment with CQ significantly reduced the viability of cells in the ox-LDL and gossypetin combined treatment group, as determined by MTT assay (lane 6 compared with lane 3, Figure 3F). Altogether, these data demonstrated that gossypetin enhanced the fusion of autophagosomes with lysosomes, a definitive event in the induction of cellular autophagy, in ox-LDL-treated HUVECs. Gossypetin Regulated the Expression of Class III PI3K/ Beclin-1 and PTEN/Class I PI3K/Akt Signaling Proteins. To investigate the underlying mechanism(s) of gossypetin in HUVECs exposed to ox-LDL, the cellular levels of autophagyrelated proteins, including class III PI3K/Beclin-1 and class I PI3K/Akt/mTOR signaling factors, were detected. Figure 4A shows that ox-LDL upregulated the expression of Beclin-1 and

Figure 2. Effect of gossypetin on ox-LDL-induced HUVEC apoptosis. (A) HUVECs were treated with the indicated concentrations (0, 0.1, and 0.5 μM) of gossypetin in the presence or absence of 100 μg/mL ox-LDL for 24, and the cells were assayed by DAPI staining. Arrows indicate apoptotic cells. Panels show (from left to right) phase-contrast microscopy and DAPI staining. (B) Apoptotic values were calculated as the percentage of apoptotic cells relative to the total number of cells in each random field (>100 cells) and represent the average of three independent experiments ± SD. ##p < 0.01 compared with control (Student’s t test). **p < 0.01 compared with the ox-LDL group (oneway ANOVA with Dunnett’s posthoc test). (C) Under the same E


Article


Figure 3. continued

F


Article


Figure 3. Effect of gossypetin on ox-LDL-induced HUVEC autophagy. (A) HUVECs were treated with the indicated concentrations (0, 0.1, and 0.5 μM) of gossypetin in the presence or absence of 100 μg/mL ox-LDL for 24, and autophagic cells were assayed by AO staining. Arrows indicate autophagic cells. Panels show (from left to right) phase-contrast microscopy (left), AO staining (middle), and merged (right) images. (B) Autophagic values were calculated as the percentage of AO+ cells relative to the total number of cells in each random field (>100 cells) and represent the average of three independent experiments ± SD. #p < 0.05 compared with control (Student’s t test). *p < 0.05, **p < 0.01 compared with the oxLDL group (one-way ANOVA with Dunnett’s posthoc test). (C) Under the same treatment conditions as those in (A), uptake of AO was analyzed by flow cytometry. AO uptake was calculated by subtracting the mean fluorescent intensity of untreated control cells (autofluorescence) from that of ox-LDL-incubated cells, with the group treated with ox-LDL alone indicated as 100%. The quantitative data are presented as the mean ± SD (n = 3) from three independent experiments. **p < 0.01, compared with the ox-LDL group (one-way ANOVA with Dunnett’s posthoc test). (D) Western blot analysis of the expression of autophagic factors, including LC3, Atg5−Atg12 conjugate, and p62, in HUVECs treated with the indicated concentrations of gossypetin in the presence or absence of 100 μg/mL ox-LDL for 24 h. The quantitative data are presented as the mean ± SD (n = 3) from three independent experiments. #p < 0.05 compared with control (Student’s t test). *p < 0.05, **p < 0.01 compared with ox-LDL (one-way ANOVA with Dunnett’s posthoc test). (E, F) HUVECs were pretreated with CQ for 2 h and then treated with 0.5 μM gossypetin in the presence or absence of 100 μg/mL ox-LDL for 24 h; LC3-II accumulation and cell viability were analyzed by western blotting (E) and MTT assay (F), respectively. The protein levels below the blots represent the relative density of the bands normalized to β-actin. The quantitative data are presented as the mean ± SD (n = 3) from three independent experiments. #p < 0.05 compared with control (lane 1) (Student’s t test). *p < 0.05, **p < 0.01 compared with the ox-LDL group (lane 2) (Student’s t test). $p < 0.05 compared with the ox-LDL + gossypetin group (lane 3) (Student’s t test).

class III PI3K, which are recognized as being autophagic initiators that mediate nucleation of the preautophagosomal membrane. It was found that the cellular levels of both proteins were significantly enhanced in cells cotreated with 0.1 and 0.5 μM gossypetin for 24 h. siRNA was used to repress the level of Beclin-1, which is essential for autophagosome generation, to confirm the role of autophagic machinery in the effect of gossypetin.21 As shown in Figure 4B,C, silencing Beclin-1 markedly reduced the gossypetin-induced LC3-II accumulation and cell viability in the ox-LDL-treated HUVECs. Together, these data strongly indicate that the protective effect of gossypetin against ox-LDL-induced HUVEC injury and death involves activating Beclin-1-mediated autophagy. It has been shown that class I PI3K/Akt/mTOR signaling is involved in atherosclerotic lesions22 and that mTOR signaling is a major negative regulatory axis of autophagy.7 Consequently, we examined the phosphorylation of mTOR (Ser2448) and Akt (Ser473) as well as the expression of class I PI3K and phosphatase and tensin homologue (PTEN), an antagonist of class I PI3K signaling, by western blotting. As shown in Figure 4D, the expression of p-Akt and class I PI3K were significantly increased by 100 μg/mL ox-LDL, whereas the phosphorylation of mTOR was decreased, indicating that the ox-LDL-mediated activation of class I PI3K/Akt and inhibition of mTOR are separate pathways in HUVECs. Under the oxidative stress of ox-LDL, gossypetin treatment dose-dependently decreased the levels of phosphorylated mTOR and Akt as well as class I PI3K (Figure 4D). PTEN expression, which was unaffected by ox-

LDL, was markedly enhanced by gossypetin in HUVECs (Figure 4D). 3-MA and SF1670 Blocked the Protective Effect of Gossypetin by Inhibiting Autophagy. To further examine the role of autophagy in the protective effect of gossypetin, we analyzed whether 3-MA, a class III PI3K inhibitor,23 could reverse the effect of gossypetin on cell viability. The cell viability of the ox-LDL treated group, the ox-LDL and gossypetin cotreatment group, and the 3-MA (10 mM) supplement group was 72.4 ± 10%, 95.2 ± 7.3%, and 70.5 ± 8.6% of the control group, respectively. The results of an MTT assay indicated that 3-MA nearly abolished the protective effect of gossypetin on HUVECs treated with ox-LDL (left, Figure 5A), whereas 3-MA alone had no affect. When cells were exposed to ox-LDL alone (black bar 5 compared with black bar 2) or ox-LDL plus gossypetin (black bar 6 compared with black bar 3), changes in the formation of acidic autophagolysosomal vacuoles (right, Figure 5A) and the expression of class III PI3K, LC3-II (Figure 5B), and Beclin-1/class III PI3K complex (Figure 5C) confirmed the inhibition of autophagy by 3-MA. The protein expression of PTEN and class I PI3K were not affected by the addition of 3-MA (Figure 5B). Since the cellular levels of class I PI3K and p-Akt were diminished as the expression of PTEN markedly increased in the ox-LDL and gossypetin cotreatment group when compared to that of the ox-LDL alone group (Figure 4D), the dependence of gossypetin-enhanced autophagy on the PTEN pathway was evaluated. Pretreatment with SF1670, a G


Article


Figure 4. Effect of gossypetin on the expression of autophagy-related proteins, including Beclin-1/class III PI3K and class I PI3K/Akt/mTOR signaling factors, in ox-LDL-treated HUVECs. (A) HUVECs were treated with the indicated concentrations (0, 0.1, and 0.5 μM) of gossypetin in the presence or absence of 100 μg/mL ox-LDL for 24, and protein levels of Beclin-1 and class III PI3K were determined by western blotting. The quantitative data are presented as the mean ± SD (n = 3) from three independent experiments. #p < 0.05, ##p < 0.01 compared with control (Student’s t test). *p < 0.05, **p < 0.01 compared with ox-LDL (one-way ANOVA with Dunnett’s posthoc test). (B, C) Western blot analysis of Beclin-1 and LC3 expression (B) and MTT assay (C) in HUVECs transfected with Beclin-1 siRNA (si-beclin) or control siRNA (si-NT, nontargeting siRNA) and then treated with 0.5 μM gossypetin in the presence or absence of 100 μg/mL ox-LDL for 24 h. The quantitative data are presented as the mean ± SD (n = 3) from three independent experiments. #p < 0.05 compared with control (lane 1) (Student’s t test). *p < 0.05, **p < 0.01 compared with the ox-LDL group (lane 2) (Student’s t test). $p < 0.05, $$p < 0.01 compared with the ox-LDL + gossypetin group (lane 3) (Student’s t test). (D) HUVECs were treated with the indicated concentrations of gossypetin in the presence or absence of 100 μg/mL ox-LDL for 24 h, and protein levels of p-mTOR, mTOR, p-Akt, Akt, class I PI3K, and PTEN were determined by western blotting. The protein levels above the blots represent the relative density of the bands normalized to β-actin. The quantitative data are presented as the mean ± SD (n = 3) from three independent experiments. #p < 0.05, ##p < 0.01 compared with control (Student’s t test). *p < 0.05, **p < 0.01 compared with ox-LDL (one-way ANOVA with Dunnett’s posthoc test).

pharmacological PTEN inhibitor,24 partially blocked gossypetin-enhanced cell viability and formation of autophagic vacuoles in the presence of ox-LDL (Figure 5A). It should be noted that the inhibition of PTEN also abolished the gossypetin-induced expression of PTEN and LC3-II (lane 9 compared with lane 3, Figure 5B). However, the inhibitor did not change the

augmenting effect of gossypetin on the ox-LDL-induced expression of class III PI3K (line 1) (lane 9 compared with lane 3, Figure 5B) and the formation of the Beclin-1/class III PI3K complex (lane 9 compared with lane 3, Figure 5C). Taken as a whole, inhibition of class III PI3K or PTEN impaired the gossypetin-mediated autophagic cellular events. H


Article


Figure 5. Effects of autophagy inhibitor 3-MA and a pharmacological PTEN inhibitor, SF1670, on gossypetin-regulated cell viability, autophagosome formation, and autophagic signaling cascades. (A) HUVECs were pretreated with 3-MA or SF1670 for 30 min and then treated with 0.5 μM gossypetin in the presence or absence of 100 μg/mL ox-LDL for 24 h; cell viability and the formation of autophagic vacuoles were analyzed by MTT assay (left) and AO staining (right), respectively. (B) Under the same treatment conditions as those in (A), the expressions of class III PI3K, PTEN, class I PI3K, and LC3 were analyzed by western blotting. The protein levels above the figures represent the relative density of the bands normalized to β-actin. (C) Cell extracts prepared from the same treatment condition were immunoprecipitated (IP) with class III PI3K. The precipitated complexes were examined be western blotting (IB) using a Beclin-1 antibody. The quantitative data are presented as the mean ± SD (n = 3) from three independent experiments. #p < 0.05, ##p < 0.01 compared with control (lane 1) (Student’s t test). *p < 0.05, **p < 0.01 compared with the oxLDL group (lane 2) (Student’s t test). $p < 0.05, $$p < 0.01 compared with the ox-LDL + gossypetin group (lane 3) (Student’s t test). (D) Schematic representation of the protective effects of gossypetin against ox-LDL-induced injury. ox-LDL activates both apoptosis and autophagy in HUVECs. While apoptosis definitely leads to cellular injury, autophagy is activated as a prosurvival mechanism (indicated by solid arrows). Gossypetin functions against the effects of ox-LDL via the activation of class III PI3K/Beclin-1/LC3 and inhibition of class I PI3K/Akt pathways that subsequently induce the augmentation of autophagy (by hollow arrows). This mechanism provides sustained cellular survival under conditions of oxLDL-mediated HUVEC injury.

Table 1. Effect of Gossypetin on the Serum Biochemical Parameters of Rabbits Induced by a HFDa variableb cholesterol (mg/dL) triglycerides (mg/dL) LDL-c (mg/dL) HDL-c (mg/dL) LDL-c/HDL-c ALT (U/L) AST (U/L) BUN (mg/dL) CRE (mg/dL)

control group 72.18 41.34 43.62 29.41 1.48 24.93 34.12 17.29 1.67

± ± ± ± ± ± ± ± ±

39.65 10.93 7.63 6.44 0.40 6.43 8.56 4.07 0.18

gossypetin group 74.34 51.48 46.86 31.92 1.46 26.63 37.83 15.97 1.60

± ± ± ± ± ± ± ± ±

41.49 14.74 7.72 5.64 0.34 13.37 13.11 3.59 0.22

HFD group 782.34 84.16 647.46 83.44 7.76 69.82 198.65 25.80 1.50

± ± ± ± ± ± ± ± ±

95.12c 13.98c 87.12c 12.98 2.30c 11.67c 26.49c 9.50 0.33

HFD + gossypetin group 547.84 49.13 389.67 144.13 2.71 31.38 66.43 22.02 1.46

± ± ± ± ± ± ± ± ±

59.98e 7.79e 61.12e 36.67d 0.90e 10.22e 5.52e 7.78 0.23

Each value is expressed as the mean ± SD (n = 6/group). Duration of the experiment = 10 weeks. Results were statistically analyzed with Student’s t test. bLDL-c, low-density lipoprotein-cholesterol; HDL-c, high-density lipoprotein-cholesterol; ALT, alanine transaminase, AST, aspartate aminotransferase; BUN, blood urea nitrogen; CRE, creatinine. cp < 0.05 compared with the control group. dp < 0.05 compared with the HFD group. e p < 0.01 compared with the HFD group. a

I


Article


Figure 6. Effect of gossypetin on atherosclerotic lesions and endothelial injury in vivo. New Zealand white rabbits fed a HFD were divided into two groups. At the same time, one of the groups was orally treated with gossypetin at a dose of 10 mg/kg. These rabbits were sacrificed after 10 weeks, and their aortic arch was collected for (A) H&E stain, (B) immunohistochemical staining of LDH (indicated by arrows), and (C) western blot analysis of LC3, class III PI3K, and PTEN protein expression. The protein levels below the blots represent the relative density of the bands normalized to β-actin. The quantitative data are presented as the mean ± SD (n = 3) from three independent experiments. #p < 0.05 compared with control (Student’s t test). *p < 0.05 compared with ox-LDL (Student’s t test).

indicating improved liver function, in the HFD-fed rabbits. Our study showed that, in addition to possessing benefits regarding liver protection, gossypetin can effectively decrease serum total cholesterol, triglycerides, LDL-c, and the LDL-c/HDL-c ratio, thus improving atherosclerosis. The most remarkable alterations were observed in the aortic arch. The extent of atherosclerosis in the aorta was evaluated as the area of fatty region by detecting the formation of foam cells (macrophages with ingested ox-LDL) in the atherosclerotic lesions. Figure 6A showed that the subintimal deposition of extracellular lipids and foam cells in the HFD-treated rabbits was improved after the administration of gossypetin. In addition, immunohistochemical staining revealed the expression of LDH, a well-established marker of cell injury and death, in the endothelial cell layer of advanced atherosclerotic lesions from the aortic roots of the HFD-treated rabbits. As shown in Figure 6B, significant endothelial injury was observed in the atherosclerotic lesions in the HFD-treated rabbits; on the other hand, there was a very low level of expression of LDH in the

These results suggested that the class III PI3K/Beclin-1 and PTEN/class I PI3K/Akt signaling cascades mediated the action of gossypetin to regulate autophagy and control the balance of survival and apoptosis (Figure 5D). Effect of Gossypetin on Atherosclerotic Lesions and Endothelial Injury in a Rabbit Model. Because endothelial dysfunction is an early sign of atherosclerosis, improvements in endothelial injury will prevent the development of atherosclerosis.25 The protective effect of gossypetin against endothelial injury was investigated by an atherosclerotic rabbit model to evaluate the clinical use of gossypetin for atherosclerosis. As shown in Table 1, gossypetin can significantly reduce the elevation of the serum concentrations of cholesterol, triglycerides, and LDL-c as well as the ratio of LDL-c/HDL-c induced by HFD. Previous studies have demonstrated that a reduction in the LDL-c/HDL-c ratio, not just the LDL-c level alone, is important for decreasing the atheroma burden.26,27 Additionally, treatment with gossypetin significantly reduced the serum levels of ALT and AST, thus J


Article


LDL-mediated apoptosis and thus promote cell survival.34 The findings of this study reveal, for the first time, a protective effect of gossypetin toward ox-LDL-treated HUVECs. This effect, in part, may have been contributed by the antioxidant effects of gossypetin. Therefore, it is convincing that gossypetin could potentially be used in the treatment of atherosclerosis. Using cell-free systems, it has been shown that gossypetin exhibits free radical scavenging and antioxidant properties.10,14 However, the results of in vitro studies are controversial as to whether gossypetin acts as an antioxidant and is protective against oxidative stress35,36 or is biotransformed to a compound(s) that lacks antioxidant properties and induces oxidative stress.11,37 The findings reported herein with HUVECs are in accordance with the studies of Salvamani et al., which showed that gossypetin, at lower dosages, acts as an inhibitor of oxidative stress.36 Furthermore, it is still a matter of debate as to whether natural products, such as resveratrol, not only suppress cancer cells by activating apoptosis but also protect normal cells from oxidative injury via induction of autophagy.38,39 This study demonstrated the role of gossypetin as a protector in normal cells based on the evidence of morphology and molecular biology. As already indicated, ox-LDL can induce an apoptotic process in endothelial cells,32 which was confirmed in this study (Figure 2A−D). Furthermore, it has been reported that ox-LDL induces the activation of caspase-3 through its receptor LOX-1 (lectin-like endothelial ox-LDL receptor).32 Caspase-3 is a widely expressed protease and is considered to be an executor protease in apoptotic cells. It is known that caspase-3 is a cysteine protease that cleaves PARP, nuclear lamins, gelsolin, and DNA fragment factor.40 In murine aortic endothelial cells, pretreatment with caspase-3 inhibitor DEVD-CHO inhibits apoptosis.32 Consistent with previous reports, this study confirmed that ox-LDL significantly reduced HUVEC growth and increased caspase-3 and PARP-1 activation (Figure 2E). In contrast, gossypetin cotreatment dramatically reduced ox-LDLdependent HUVEC apoptosis and the expression of cleaved caspase-3 and PARP-1 (Figure 2). However, the detailed mechanism(s) of the inhibitory effect of gossypetin on caspase3 activation is not well-understood. Increasing evidence suggests that oxidative stress contributes to cellular damage and appears to be a common apoptotic mediator, most likely via lipid peroxidation.41 Recent results showed that gossypetin possesses the potential to inhibit LDL oxidation14 and in turn to protect HUVECs from oxidative toxicity and apoptosis. Until recently, it has been considered that autophagy, in addition to its role in cell survival, can also cause cell death (referred to as type II programmed cell death).5,42 Autophagy promotes cell survival by generating the fatty acids and amino acids required to maintain function during starvation or by removing injured organelles and intracellular pathogens. On the other hand, autophagy may induce cell death through excessive self-digestion and degradation of essential cellular constituents. It is also of paramount importance to note that a natural flavonoid found in grapes and red wine, resveratrol, induced basic autophagy.38,43 Although autophagy has been accepted to be a cell death pathway, recent evidence indicates that it is mostly a cytoprotective mechanism that allows cells to mobilize their energy reserves and to recycle injured organelles under conditions of oxidative stress.44 Consistent with these findings, the present data from immunofluorescent staining and western blotting confirmed that autophagy was induced in HUVECs by treatment with ox-LDL for 24 h (Figure 3). The results in

HFD plus gossypetin-fed rabbits, which was consistent with the in vitro results in which gossypetin reduced the level of cytotoxicity in ox-LDL-treated HUVECs (Figure 1C). During the treatment period, administration of gossypetin did not have an apparent effect on body weight or liver and renal function when compared with that of the untreated control (data not shown). Furthermore, western blotting the tissue extracts of the aortic arch demonstrated that the expression of LC3-II, class III PI3K, and PTEN were highly increased in the HFD plus gossypetin-fed rabbits compared to that of the gossypetin or HFD-fed groups (Figure 6C). These results indicate that gossypetin can significantly improve endothelial injury in HFDtreated rabbits by enhancing the autophagic pathway in vivo.

■

DISCUSSION Flavonoids are polyphenolic compounds found in vegetables, fruits, and plant-derived products like tea and red wine. Previous studies have shown that the consumption of flavonoids mitigates the risk of cardiovascular diseases, including atherosclerosis.28 The average daily human intake of these compounds in the U.S. and U.K. has been estimated to be 1.0 g or more.29 These positive health effects associating with intake of flavonoids have been ascribed to their wellknown antioxidant properties and to their inhibitory effects on a wide range of enzymes.30 The presence of the 3-hydroxyl group in flavonoids is important for their higher radicalscavenging capabilities than that of ascorbic acid.30 This study examined the protective effects of a natural 3-hydroxyl flavonoid, gossypetin, against ox-LDL-triggered injury and death in endothelial cells. The mechanism(s) by which gossypetin protected HUVECs from apoptotic injury in response to ox-LDL could be in part by downregulating the caspase-3-dependent cell death pathway and by activating autophagy−lysosomal signaling. To our knowledge, this is the first report revealing the protective effect of gossypetin against ox-LDL-mediated atherogenic endothelial cell injury and apoptosis through the upregulation of autophagy in vitro and in vivo. ox-LDL-induced endothelial cell injury is a major endothelial dysfunction event in the initial step of the atherosclerotic process.31 A model of ox-LDL-impaired endothelial cells has been applied to mimic the oxidative endothelial injury that occurs during atherogenesis.32 Therefore, the atheroprotective effects of gossypetin were first investigated in a model of oxLDL-injured HUVECs in vitro. HUVECs were exposed to 100 μg/mL ox-LDL for 24 h, which induced a decrease in the formation of formazan after MTT uptake (Figure 1A,B) and an increase in LDH leakage (Figure 1C). The protective effect of gossypetin treatment was examined by MTT, LDH, and BrdU assays (Figure 1). These tests provided contradictory results. The flavonoid, at a concentration in the range 0.1−0.5 μM, demonstrated protective cellular effects, as evidenced by increased MTT uptake, decreased LDH leakage (significant), and increased BrdU incorporation (insignificant). The effect of the higher concentration (>5.0 μM) was puzzling because it repressed TBARS formation,14 cell viability, and DNA synthesis, but it enhanced LDH leakage (Figure 1). Nevertheless, a high concentration of flavonoid is usually not achievable in the human body. Das et al. reported that the mechanisms of action of flavonoids against cardiovascular diseases include the protection of endothelial cells from apoptosis.33 Further study has indicated that flavonoids may function as potent antioxidants to prevent copper-oxidized K


Article


PI3K in the regulation of autophagy by gossypetin in HUVECs (Figure 5B). Additionally, SF1670 partially abolished the protective effects of gossypetin that result from inhibiting autophagy (Figure 5A). This finding revealed the crucial role of PTEN in gossypetin’s protective effects through the induction of autophagy. However, the mechanism of gossypetin-induced PTEN activation is in need of further study. As demonstrated above, the autophagic effect of gossypetin in the ox-LDLexposed HUVECs was via the upregulation of class III PI3K/ Beclin-1 and downregulation of class I PI3K/Akt pathway cascades that subsequently activated the expression of Atg5− Atg12 conjugate and LC3-II. Considerable evidence suggests that ox-LDL may regulate cellular fate through mTOR,22,48 which is not only an important player in cellular energy homeostasis but also a major regulator of autophagy.49 ox-LDL could active mTOR during the formation of THP-1 macrophage foam cells and in rabbit femoral smooth muscle cells.50,51 By contrast, a recent report indicates that ox-LDL inhibited mTOR activity in vascular endothelial cells and suggests that the effect of ox-LDL on the mTOR pathway might be cell-type specific.52 Consistent with the previous study, this study showed that ox-LDL decreased the phosphorylation of mTOR in HUVECs (Figure 4D). Since mTOR is a negative regulator of autophagy,7 a decrease in its phosphorylation is actually consistent with an induction of autophagy. Further work is needed to clarify this issue. In addition, previous studies have reported that class I PI3K/ Akt not only activates mTOR but also influences the transcription factor FOXO3 (Forkhead box 3).53,54 Through phosphorylation of FOXO3, Akt represses the expression of Atgs. FOXO3 induces autophagy by controlling the transcription of autophagy factors, such as LC3.54 However, phosphorylation of FOXO3 by Akt sequesters it in an inactive state in the cytosol.55 Therefore, it is possible that class I PI3K/ Akt, in turn, may indirectly regulate ox-LDL-mediated autophagy through FOXO3. The level of phosphorylated FOXO3 was found to be increased by the treatment with 100 μg/mL ox-LDL, and gossypetin repressed this increase (data not shown). However, their relevance needs to be demonstrated. These results suggest that ox-LDL could regulate the PI3K/Akt signaling pathway, which promotes cellular homeostasis. Further work is needed to clarify this issue. In summary, evidence is provided suggesting that gossypetin protects HUVECs from ox-LDL-induced injury through the upregulation of autophagy (Figure 5D). In particular, these results demonstrated that (I) gossypetin attenuated the detrimental effect of ox-LDL on the viability and apoptosis of HUVECs, (II) the protective effect of gossypetin on the vasculature was mediated in part by autophagy, and (III) the gossypetin-induced autophagy was activated through regulation of the class III PI3K/Beclin-1 and PTEN/class I PI3K/Akt signaling cascades. Most significantly, the administration of gossypetin improved serum lipid levels (Table 1) and atherosclerotic lesions (Figure 6A) as well as strongly reduced the expression of LDH-covered atherosclerotic plaques in HFD-fed rabbits (Figure 6B). The data also showed the protective effects of gossypetin against endothelial injury in vitro and in vivo (Figure 6C). The mechanisms are likely to be complex, and multiple signals may be involved in this process. One major mechanism underlying the atheroprotection by gossypetin may be through upregulation of autophagy. Taken together, our findings indicate that the effects of gossypetin on

Figure 3D showed that ox-LDL upregulated the accumulation of LC3-II and increased Atg5−Atg12 protein complex and p62 levels, which indicated an accumulation in autophagosomes rather than an increase in autophagic flux. LC3 and p62 are two well-known markers of autophagy. An enhanced ratio of LC3II/β-actin is a marker of an increase in autophagosomes, whereas p62 expression is inversely correlated with autophagic flux.18 Furthermore, the protective effect of gossypetin was accompanied by LC3-II accumulation, as demonstrated by the usage of a well-known autophagy inhibitor, CQ, thereby indicating upregulation of autophagy (Figure 3E,F). The AO staining detected autophagosomes, confirming the activation of autophagy (Figure 3A−C). It is therefore possible that gossypetin promoted protective autophagy in the ox-LDLtreated HUVECs. A novel favorable role of autophagy in the protective effect was demonstrated in the present study; however, determining how to turn on such cellular autophagy actions without inducing an unwanted death pathway will be both a promising strategy and a challenge for clinicians. Next, to study the mechanism(s) of gossypetin-induced autophagy, the contribution of the activation of class III PI3K/ Beclin-1 to the formation of autophagosomes was examined. ox-LDL (50−200 μg/mL) is known to upregulate the cellular level of Beclin-1 in a concentration-dependent manner.3 In parallel with its autophagic action, gossypetin enhanced the cellular levels of Beclin-1 and class III PI3K (Figure 4A). To demonstrate the possibility that an interaction between Beclin-1 and class III PI3K was being regulated during the gossypetinmediated autophagy in the presence of ox-LDL, the endogenous Beclin-1/class III PI3K complex was immunoprecipitated with an antibody against class III PI3K. The immunoprecipitation assay showed that the levels of Beclin-1 coimmunoprecipitating with class III PI3K increased steadily for 24 h in a dose-dependent manner (data not shown). The involvement of class III PI3K/Beclin-1 signaling in the autophagic effect of gossypetin on HUVECs was further confirmed in experiments using Beclin-1 siRNA (Figure 4B,C) or 3-MA (Figure 5), implying that increases in the expression of Beclin-1 and class III PI3K could not only promote LC3-II accumulation (Figures 4B and 5B), which is required for the subsequent formation of autophagosomes, but also retard oxLDL-impaired cell viability (Figure 4C and 5A). In agreement with the present findings, Xie et al. indicated that 3-MA aggravated the injury of HUVECs by advanced glycation end products (AGE), which are modified lipids or proteins.2 The drug, 3-MA, inhibits the formation of autophagic vacuoles23 and has been demonstrated to target class III PI3K enzymes.45,46 Class I and III PI3Ks act antagonistically at different steps in the autophagic process.46 Class III PI3K is probably engaged in the control of the formation of autophagic vacuoles by association with Beclin-1 recruited to the cytoplasmic membrane.45 In contrast, the plasma membraneassociated class I PI3K is required to transduce a negative signal for the biogenesis of the autophagic vacuole.46 The tumor suppressor PTEN, a dual protein/lipid phosphatase, has been known to dephosphorylate the 3′ position of class I PI3K product phosphatidylinositide (3,4,5)P3 and consequently downregulate PI3K/Akt pathway.47 Because class I PI3K/Akt signaling and PTEN are strongly intertwined, we used the PTEN inhibitor SF1670 to determine the relationship between PTEN and class I PI3K in the regulation of gossypetin-induced autophagy. The addition of SF1670 affected the expression of class I PI3K, indicating that PTEN may act upstream of class I L


Article


(9) Francis, A. R., Shetty, T. K., and Bhattacharya, R. K. (1989) Modulating effect of plant flavonoids on the mutagenicity of Nmethyl-N′-nitro-N-nitrosoguanidine. Carcinogenesis 10, 1953−1955. (10) de Whalley, C. V., Rankin, S. M., Hoult, J. R., Jessup, W., and Leake, D. S. (1990) Flavonoids inhibit the oxidative modification of low density lipoproteins by macrophages. Biochem. Pharmacol. 39, 1743−1750. (11) Wedworth, S. M., and Lynch, S. (1995) Dietary flavonoids in atherosclerosis prevention. Ann. Pharmacother. 29, 627−628. (12) Jeong, H. J., Ryu, Y. B., Park, S. J., Kim, J. H., Kwon, H. J., Kim, J. H., Park, K. H., Rho, M. C., and Lee, W. S. (2009) Neuraminidase inhibitory activities of flavonols isolated from Rhodiola rosea roots and their in vitro anti-influenza viral activities. Bioorg. Med. Chem. 17, 6816−6823. (13) Lin, H. H., Chen, J. H., and Wang, C. J. (2011) Chemopreventive properties and molecular mechanisms of the bioactive compounds in Hibiscus sabdarif fa Linne. Curr. Med. Chem. 18, 1245− 1254. (14) Chen, J. H., Tsai, C. W., Wang, C. P., and Lin, H. H. (2013) Anti-atherosclerotic potential of gossypetin via inhibiting LDL oxidation and foam cell formation. Toxicol. Appl. Pharmacol. 272, 313−324. (15) Havel, R. J., Eder, H. A., and Bragdon, J. H. (1955) The distribution and chemical composition of ultracentrifugally separated lipoproteins in human serum. J. Clin. Invest. 34, 1345−1353. (16) Alley, M. C., Scudiero, D. A., Monks, A., Hursey, M. L., Czerwinski, M. J., Fine, D. L., Abbott, B. J., Mayo, J. G., Shoemaker, R. H., and Boyd, M. R. (1988) Feasibility of drug screening with panels of human tumor cell lines using a microculture tetrazolium assay. Cancer Res. 48, 589−601. (17) Chen, J. H., Ou, H. P., Lin, C. Y., Lin, F. J., Wu, C. R., Chang, S. W., and Tsai, C. W. (2012) Carnosic acid prevents 6-hydroxydopamine-induced cell death in SH-SY5Y cells via mediation of glutathione synthesis. Chem. Res. Toxicol. 25, 1893−1901. (18) Guo, X. L., Li, D., Sun, K., Wang, J., Liu, Y., Song, J. R., Zhao, Q. D., Zhang, S. S., Deng, W. J., Zhao, X., Wu, M. C., and Wei, L. X. (2013) Inhibition of autophagy enhances anticancer effects of bevacizumab in hepatocarcinoma. J. Mol. Med. 91, 473−483. (19) Mizushima, N., Yoshimori, T., and Levine, B. (2010) Methods in mammalian autophagy research. Cell 140, 313−326. (20) Chen, M. L., Yi, L., Jin, X., Liang, X. Y., Zhou, Y., Zhang, T., Xie, Q., Zhou, X., Chang, H., Fu, Y. J., Zhu, J. D., Zhang, Q. Y., and Mi, M. T. (2013) Resveratrol attenuates vascular endothelial inflammation by inducing autophagy through the cAMP signaling pathway. Autophagy 9, 2033−2045. (21) Cao, Y., and Klionsky, D. J. (2007) Physiological functions of Atg6/Beclin 1: a unique autophagy-related protein. Cell Res. 17, 839− 849. (22) Shiu, S. W., Wong, Y., and Tan, K. C. (2012) Effect of advanced glycation end products on lectin-like oxidized low density lipoprotein receptor-1 expression in endothelial cells. J. Atheroscler. Thromb. 19, 1083−1092. (23) Caro, L. H., Plomp, P. J., Wolvetang, E. J., Kerkhof, C., and Meijer, A. J. (1988) 3-Methyladenine, an inhibitor of autophagy, has multiple effects on metabolism. Eur. J. Biochem. 175, 325−329. (24) Li, Y., Prasad, A., Jia, Y., Roy, S. G., Loison, F., Mondal, S., Kocjan, P., Silberstein, L. E., Ding, S., and Luo, H. R. (2011) Pretreatment with phosphatase and tensin homolog deleted on chromosome 10 (PTEN) inhibitor SF1670 augments the efficacy of granulocyte transfusion in a clinically relevant mouse model. Blood 117, 6702−6713. (25) Xu, J., and Zou, M. H. (2009) Molecular insights and therapeutic targets for diabetic endothelial dysfunction. Circulation 120, 1266−1286. (26) Nissen, S. E., Nicholls, S. J., Sipahi, I., Libby, P., Raichlen, J. S., Ballantyne, C. M., Davignon, J., Erbel, R., Fruchart, J. C., Tardif, J. C., Schoenhagen, P., Crowe, T., Cain, V., Wolski, K., Goormastic, M., Tuzcu, E. M., and ASTEROID Investigators (2006) Effect of very

endothelial cells could likely contribute to its protection against atherosclerosis and other cardiovascular diseases. However, the exact dose of gossypetin to be used in the human body to induce moderate autophagy has not yet been examined in full detail. In order to obtain a safe dose for gossypetin to induce moderate autophagy, more trials need to be done.

■

AUTHOR INFORMATION

Corresponding Author

*Tel: (886) 4-24730022, ext. 12410. Fax: (886) 4-23248171. Email: [email protected]. Funding

This work was supported by a grant from the National Science Council (NSC99-2632-B-040-001-MY3), Taiwan. Flow cytometry was performed in the Instrument Center of Chung Shan Medical University, which is supported by the National Science Council, Ministry of Education, and Chung Shan Medical University. Notes

The author declares no competing financial interest.

■

ABBREVIATIONS LDL, low-density lipoprotein; ox-LDL, oxidized LDL; HUVECs, human umbilical vein endothelial cells; LC3, microtubule associated protein 1 light chain 3; Atg, autophagy-related genes; PI3K, phosphatidylinositol-3 kinase; PKB, protein kinase B; mTOR, mammalian target of rapamycin; CQ, chloroquine; 3-MA, 3-methyladenine; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; LDH, lactate dehydrogenase; BrdU, bromodeoxyuridine; DAPI, 4,6-diamidino-2-phenylindole; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; TBS, Trisbuffered saline; ECL, enhanced chemiluminescence; AO, acridine orange; H&E, hematoxylin and eosin; HFD, highcholesterol diet; PTEN, phosphatase and tensin homologue

■

REFERENCES

(1) Ross, R. (1999) Atherosclerosisan inflammatory disease. N. Engl. J. Med. 340, 115−126. (2) Xie, Y., You, S. J., Zhang, Y. L., Han, Q., Cao, Y. J., Xu, X. S., Yang, Y. P., Li, J., and Liu, C. F. (2011) Protective role of autophagy in AGE-induced early injury of human vascular endothelial cells. Mol. Med. Rep. 4, 459−464. (3) Zhang, Y. L., Cao, Y. J., Zhang, X., Liu, H. H., Tong, T., Xiao, G. D., Yang, Y. P., and Liu, C. F. (2010) The autophagy−lysosome pathway: a novel mechanism involved in the processing of oxidized LDL in human vascular endothelial cells. Biochem. Biophys. Res. Commun. 394, 377−382. (4) Durand, E., Scoazec, A., Lafont, A., Boddaert, J., Al Hajzen, A., Addad, F., Mirshahi, M., Desnos, M., Tedgui, A., and Mallat, Z. (2004) In vivo induction of endothelial apoptosis leads to vessel thrombosis and endothelial denudation: a clue to the understanding of the mechanisms of thrombotic plaque erosion. Circulation 109, 2503− 2506. (5) Baehrecke, E. H. (2005) Autophagy: dual roles in life and death. Nat. Rev. Mol. Cell. Biol. 6, 505−510. (6) Mizushima, N., Levine, B., Cuervo, A. M., and Klionsky, D. J. (2008) Autophagy fights disease through cellular self-digestion. Nature 451, 1069−1075. (7) Martinet, W., and De Meyer, G. R. (2009) Autophagy in atherosclerosis: a cell survival and death phenomenon with therapeutic potential. Circ. Res. 104, 304−317. (8) Yorimitsu, T., and Klionsky, D. J. (2005) Autophagy: molecular machinery for selfeating. Cell Death Differ. 12, 1542−1552. M


Article

Chemical Research in Toxicology high-intensity statin therapy on regression of coronary atherosclerosis: the ASTEROID trial. JAMA, J. Am. Med. Assoc. 295, 1556−1565. (27) Choi, S. H., Chae, A., Miller, E., Messig, M., Ntanios, F., DeMaria, A. N., Nissen, S. E., Witztum, J. L., and Tsimikas, S. (2008) Relationship between biomarkers of oxidized low-density lipoprotein, statin therapy, quantitative coronary angiography, and atheroma: volume observations from the REVERSAL (Reversal of Atherosclerosis with Aggressive Lipid Lowering) study. J. Am. Coll. Cardiol. 52, 24−32. (28) Nicholson, S. K., Tucker, G. A., and Brameld, J. M. (2008) Effects of dietary polyphenols on gene expression in human vascular endothelial cells. Proc. Nutr. Soc. 67, 42−47. (29) Pierpoint, W. S. (1986) Flavonoids in the human diet. Prog. Clin. Biol. Res. 213, 125−140. (30) Middleton, E. J., and Kandaswami, C. (1993) The impact of plant flavonoids on mammalian biology: implications for immunity, inflammation and cancer, in The Flavonoids: Advances in Research since 1986 (Harborne, J. B., Ed.) pp 619−652, Chapman & Hall, London. (31) Steinberg, D. (1997) Lewis A. Conner Memorial Lecture. Oxidative modification of LDL and atherogenesis. Circulation 95, 1062−1071. (32) Chen, J., Mehta, J. L., Haider, N., Zhang, X., Narula, J., and Li, D. (2004) Role of caspases in ox-LDL-induced apoptotic cascade in human coronary artery endothelial cells. Circ. Res. 94, 370−376. (33) Das, D. K., Sato, M., Ray, P. S., Maulik, G., Engelman, R. M., Bertelli, A. A., and Bertelli, A. (1999) Cardioprotection of red wine: role of polyphenolic antioxidants. Drugs Exp. Clin. Res. 25, 115−120. (34) Jeong, Y. J., Choi, Y. J., Kwon, H. M., Kang, S. W., Park, H. S., Lee, M., and Kang, Y. H. (2005) Differential inhibition of oxidized LDL-induced apoptosis in human endothelial cells treated with different flavonoids. Br. J. Nutr. 93, 581−591. (35) Khan, A., Manna, K., Bose, C., Sinha, M., Das, D. K., Kesh, S. B., Chakrabarty, A., Banerji, A., and Dey, S. (2013) Gossypetin, a naturally occurring hexahydroxy flavone, ameliorates gamma radiation-mediated DNA damage. Int. J. Radiat. Biol. 89, 965−975. (36) Salvamani, S., Gunasekaran, B., Shaharuddin, N. A., Ahmad, S. A., and Shukor, M. Y. (2014) Antiartherosclerotic effects of plant flavonoids. Biomed. Res. Int. 2014, 480258. (37) Amrutha, K., Nanjan, P., Shaji, S. K., Sunilkumar, D., Subhalakshmi, K., Rajakrishna, L., and Banerji, A. (2014) Discovery of lesser known flavones as inhibitors of NF-κB signaling in MDA-MB231 breast cancer cells-A SAR study. Bioorg. Med. Chem. Lett. 24, 4735−4742. (38) Gurusamy, N., Lekli, I., Mukherjee, S., Ray, D., Ahsan, M. K., Gherghiceanu, M., Popescu, L. M., and Das, D. K. (2010) Cardioprotection by resveratrol: a novel mechanism via autophagy involving the mTORC2 pathway. Cardiovasc. Res. 86, 103−112. (39) Chen, Q., Ganapathy, S., Singh, K. P., Shankar, S., and Srivastava, R. K. (2010) Resveratrol induces growth arrest and apoptosis through activation of FOXO transcription factors in prostate cancer cells. PLoS One 5, e15288. (40) Wang, L. S., Liu, H. J., Zhang, J. H., and Wu, C. T. (2002) Purging effect of dibutyl phthalate on leukemia cells involves fas independent activation of caspase-3/CPP32 protease. Cancer Lett. 186, 177−182. (41) Buttke, T. M., and Sandstrom, P. A. (1994) Oxidative stress as a mediator of apoptosis. Immunol. Today 15, 7−10. (42) Shintani, T., and Klionsky, D. J. (2004) Autophagy in health and disease: a double-edged sword. Science 306, 990−995. (43) Guo, H., Chen, Y., Liao, L., and Wu, W. (2013) Resveratrol protects HUVECs from oxidized-LDL induced oxidative damage by autophagy upregulation via the AMPK/SIRT1 pathway. Cardiovasc. Drugs Ther. 27, 189−198. (44) Morselli, E., Maiuri, M. C., Markaki, M., Megalou, E., Pasparaki, A., Palikaras, K., Criollo, A., Galluzzi, L., Malik, S. A., Vitale, I., Michaud, M., Madeo, F., Tavernarakis, N., and Kroemer, G. (2010) Caloric restriction and resveratrol promote longevity through the Sirtuin-1-dependent induction of autophagy. Cell Death Dis. 1, e10.

(45) Arico, S., Petiot, A., Bauvy, C., Dubbelhuis, P. F., Meijer, A. J., Codogno, P., and Ogier-Denis, E. (2001) The tumor suppressor PTEN positively regulates macroautophagy by inhibiting the phosphatidylinositol 3-kinase/protein kinase B pathway. J. Biol. Chem. 276, 35243−35246. (46) Petiot, A., Ogier-Denis, E., Blommaart, E. F., Meijer, A. J., and Codogno, P. (2000) Distinct classes of phosphatidylinositol 3′-kinases are involved in signaling pathways that control macroautophagy in HT-29 cells. J. Biol. Chem. 275, 992−998. (47) Wu, X., Senechal, K., Neshat, M. S., Whang, Y. E., and Sawyers, C. L. (1988) The PTEN/MMAC1 tumor suppressor phosphatase functions as a negative regulator of the phosphoinositide 3-kinase/Akt pathway. Proc. Natl. Acad. Sci. U.S.A. 95, 15587−15591. (48) Brito, P. M., Devillard, R., Nègre-Salvayre, A., Almeida, L. M., Dinis, T. C., Salvayre, R., and Augé, N. (2009) Resveratrol inhibits the mTOR mitogenic signaling evoked by oxidized LDL in smooth muscle cells. Atherosclerosis 205, 126−134. (49) Nicklin, P., Bergman, P., Zhang, B., Triantafellow, E., Wang, H., Nyfeler, B., Yang, H., Hild, M., Kung, C., Wilson, C., Myer, V. E., MacKeigan, J. P., Porter, J. A., Wang, Y. K., Cantley, L. C., Finan, P. M., and Murphy, L. O. (2009) Bidirectional transport of amino acids regulates mTOR and autophagy. Cell 136, 521−534. (50) Zabirnyk, O., Liu, W., Khalil, S., Sharma, A., and Phang, J. M. (2010) Oxidized low-density lipoproteins upregulate proline oxidase to initiate ROS-dependent autophagy. Carcinogenesis 31, 446−454. (51) Yu, M., Kang, X., Xue, H., and Yin, H. (2011) Toll-like receptor 4 is up-regulated by mTOR activation during THP-1 macrophage foam cells formation. Acta Biochim. Biophys. Sin., 940−947. (52) Peng, N., Meng, N., Wang, S., Zhao, F., Zhao, J., Su, L., Zhang, S., Zhang, Y., Zhao, B., and Miao, J. (2014) An activator of mTOR inhibits oxLDL-induced autophagy and apoptosis in vascular endothelial cells and restricts atherosclerosis in apolipoprotein E−/− mice. Sci. Rep. 4, 5519. (53) Brunet, A., Bonni, A., Zigmond, M. J., Lin, M. Z., Juo, P., Hu, L. S., Anderson, M. J., Arden, K. C., Blenis, J., and Greenberg, M. E. (1999) Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell 96, 857−868. (54) Mammucari, C., Milan, G., Romanello, V., Masiero, E., Rudolf, R., Del Piccolo, P., Burden, S. J., Di Lisi, R., Sandri, C., Zhao, J., Goldberg, A. L., Schiaffino, S., and Sandri, M. (2007) FoxO3 controls autophagy in skeletal muscle in vivo. Cell. Metab. 6, 458−471. (55) Sini, P., James, D., Chresta, C., and Guichard, S. (2010) Simultaneous inhibition of mTORC1 and mTORC2 by mTOR kinase inhibitor AZD8055 induces autophagy and cell death in cancer cells. Autophagy 6, 553−554.

N


In Vitro and in Vivo Atheroprotective Effects of Gossypetin against

Recommend Documents