Increase in fatty acid ethyl ester content through ... - ACS Publications

Subscriber access provided by UNIV OF DURHAM

Food and Beverage Chemistry/Biochemistry

Increase in fatty acid ethyl ester content through ATF1 expression in an engineered Kluyveromyces marxianus UMPe-1 yeast improves the organoleptic properties of a craft Mezcal beverage Jesús Campos-García, Alejandra Vargas, Lorena Farías-Rosales, Ana Lissette Miranda, Victor Meza-Carmen, and Alma Laura Díaz-Pérez J. Agric. Food Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jafc.8b00730 • Publication Date (Web): 12 Apr 2018 Downloaded from http://pubs.acs.org on April 12, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 49

Journal of Agricultural and Food Chemistry

Increase in fatty acid ethyl ester content through ATF1 expression in an engineered Kluyveromyces marxianus UMPe-1 yeast improves the organoleptic properties of a craft Mezcal beverage

Jesús Campos-García1*, Alejandra Vargas1,2, Lorena Farías-Rosales1, Ana L. Miranda1, Víctor Meza-Carmen3 and Alma L. Díaz-Pérez1.

1

Lab. de Biotecnología Microbiana, Instituto de Investigaciones Químico Biológicas,

Universidad Michoacana de San Nicolás de Hidalgo, Morelia, Mich., México. ORCID: 0000-0002-8337-5830. Scopus Author ID: 6602224759 2

Tecnológico Nacional de México, Instituto Tecnológico de Morelia, Morelia, Mich.,

Mexico. 3

Lab. de Diferenciación Celular, Instituto de Investigaciones Químico Biológicas,

Universidad Michoacana de San Nicolás de Hidalgo, Morelia, Mich., Mexico.

Running title: Overexpression of ATF1 increases ester content.

*Corresponding author: Jesús Campos-García, Lab. de Biotecnología Microbiana, Instituto de Investigaciones Químico Biológicas, Universidad Michoacana de San Nicolás de Hidalgo, Edif. B-3, Ciudad Universitaria, 58030, Morelia, Michoacán, México. Phone/Fax: (52) 443 3265788. E-mail: [email protected]

ACS Paragon Plus Environment


ABSTRACT Mezcal, a traditionally consumed beverage originating in Mexico, is produced from the Agavaceae species. Esters associated with the yeasts utilized during fermentation are important to improve the organoleptic properties of the beverage. We improved ester content in a Mezcal beverage by using the yeast Kluyveromyces marxianus engineered with the ATF1 gene. The ATF1 expression in the recombinant yeast significantly increased compared to the parental yeast, but its fermentative parameters were unchanged. Volatile organic compound content analysis showed that esters significantly increased in the Mezcal produced with the engineered yeast. In a sensory panel test, 48% of panelists preferred Mezcal processed from the engineered yeast, 30% from wild type, and 15% and 7% preferred two Mezcal types produced following routine procedure. Correlation analysis showed that the fruitiness/sweetness description of the Mezcal produced using the ATF1engineered K. marxianus yeast correlated with ester content, whose presence improved the organoleptic properties of a Mezcal craft beverage.

Keywords: Kluyveromyces marxianus · 18S rDNA integration· ATF1 · alcohol acetyltransferase · acetate esters · Mezcal.


Page 2 of 49

Page 3 of 49


INTRODUCTION Mezcal and Tequila are famous traditional beverages originating in Mexico. These ethnic alcoholic beverages are produced using Agave pines as the raw material. Production of tequila exclusively utilizes Agave tequilana Weber var. Azul, whereas for Mezcal production, diverse agave species are utilized as raw material, such as A. cupreata, A. angustifolia, A. inaequidens, A. salmiana, A. esperrima, A. patatorum, and A. weberi (NORMA Oficial Mexicana NOM-070-SCFI-2016). Mezcal is a distilled beverage that has pronounced flavors and aromas, produced through traditional as well as craft processes. The organoleptic profile of Mezcal is dependent on the raw material used. Compound profiles are influenced by soil, weather, and agave plant cultivation, as well as other factors released during cooking of the agave pines, must fermentation, and distillation processes 13

. Additionally, the yeast used for beverage manufacturing is important for the fermentation

process and in defining the organoleptic properties imparted to the final product 4-7. Aromatic compounds are produced during agave pine cooking, including alcohols and aldehydes, but more importantly during the agave must fermentation process, native microorganism proliferation plays an important role in the generation of secondary metabolites, such as volatile organic compounds (VOCs) that may provide desirable organoleptic profiles 7. Therefore, the VOC content of a beverage (whether increased or absent) plays an important role in the determination of its organoleptic properties and consequently its quality and economic value 8. During Mezcal production, fermentation is traditionally carried out in a natural and spontaneous manner, without the addition of yeast seeds. This fact is reflected in the variable quality and yield between different production batches. Therefore, it is desirable to



utilize yeast with certain biological properties such as high ethanol yield, thermotolerance, osmotic tolerance, or increased VOC production for inoculation9. The chemical composition of beverages such as wine, constituted by more than 1,300 VOCs, is responsible for its sensorial quality10. Such compounds are derived from the feedstock, fermentation, or post-fermentation process6, 7. It has been established that these flavors are mainly generated during the fermentation process rather than being attributed to the raw materials used, thus highlighting the importance of microflora in the formation of prevalent compounds 10. Saccharomyces cerevisiae is the predominant specie utilized in fermented beverage production due to its high ethanol tolerance, thermotolerance, and resistance to toxic effects such as reactive oxygen species generation. Therefore, the contribution of fermentative yeasts to the synthesis of VOCs is a critical parameter for the beverage industry to consider 9, 11-13

. Among the microbe-derived compounds associated with flavors and aromas, the

main VOCs described are ethyl esters, acetate esters, fusel alcohols, carbonyls, and fatty acids 4, 6. Thus, esters are responsible for the fruity characteristics of alcoholic drinks 4, 14. In some beverages, fermentation is carried out by using yeast strains with a fruity flavor phenotype, which is related to their relative capacity to produce diverse esters 6, 15. Despite being found in trace amounts, two classes of esters that have been widely associated with wine ‘fruitiness’ are the acetate esters and medium-chain fatty acid (MCFA) ethyl esters (C3–C12). These flavor and aroma-associated molecules differ in their functional groups. The acetyl groups are activated by coenzyme A (FA-CoA) or acetyl-CoA and the alcohol groups are composed of ethanol or higher alcohols derived from amino acid metabolism, for MCFA ethyl ester or acetate ester synthesis, respectively 6. Examples of acetate esters and their characteristic aromas are as follows: ethyl acetate (fruity, solvent-like), isoamyl


Page 4 of 49

Page 5 of 49


acetate (banana-like), isobutyl acetate (honey), hexyl acetate (rose-like), and 2-phenylethyl acetate (flowery). The most significant MCFA ethyl esters are ethyl-hexanoate (sour applelike aroma) and ethyl-octanoate (apple-like aroma) 5, 6, 14. Although the importance of individual esters to the aroma profile is dependent on the beverage type, it has been suggested that acetate esters have greater contribution than MCFA ethyl esters to the aromatic bouquet of wine 16. In beer, the most important flavors are provided by the esters, ethyl acetate, isoamyl acetate, ethyl caproate, ethyl caprylate, and phenyl ethyl acetate 14. For example, the banana aroma of isoamyl acetate may provide a positive character in the bouquet of some young red wines (primeur or nouveau) 17. In the case of unoaked Chardonnay wines, hexyl acetate, 2-methylbutyl acetate and 3-methylbutyl acetate, belonging to the acetate esters group, and some ethyl esters such as ethyl hexanoate, ethyl octanoate, and ethyl decanoate are considered important for their bouquet 16

.

Ester synthesis is catalyzed by the alcohol acetyl transferase enzyme18-20. In S. cerevisiae, ATF1 and ATF2 encode the alcohol acetyl-transferase (AATase) enzymes I and II (Atf1p and Atf2p, respectively), which are responsible for acetate ester synthesis 21, 22. AATase I activity has been described to increase 10-200 fold during wine fermentation with respect to the AATase II enzyme 18, 22, 25, suggesting that AATase II plays a minor role in ester synthesis 22, 25. ATF1 is regulated primarily at the transcriptional level, where aeration and unsaturated fatty acids exert negative regulation by repression of response elements located 150 bp upstream from the 5´ untranslated region of ATF1 gene 26, 27. Further, ATF1 expression is controlled in hypoxic conditions by a low oxygen response cis-element (LORE) located in the regulatory region of ATF1 28. In addition, the ester content after



fermentation is dependent on the expression and activity of hydrolases (esterases), 23-25 which decrease the ester content. Esters are important for the organoleptic characteristics of fermented beverages, and are provided through yeast metabolism. S. cerevisiae and K. marxianus possess the ability to synthesize esters and are the most prevalent microorganisms used in the industry for their highly efficient alcoholic fermentation 7, 29. AATase overexpression has been described as an alternative to using native strains to increase ester content in fermented beverages 18-22. In S. cerevisiae, the ATF1 promoter contains a potential LORE (ACCCAACAA) 27, essential for ATF1 transcriptional activation and important to increase ester synthesis during alcoholic fermentation 28, 30. Another strategy to increase gene or protein expression involves the integration of endogenous gene copy number by insertion of homologous or heterologous genes using the 18S rDNA locus 31. Here, we increase ATF1 gene expression by insertion of the S. cerevisiae heterologous ATF1 gene into the 18S rDNA locus of the K. marxianus UMPe-1 yeast, rendering an engineered yeast that increases ester production during alcoholic fermentation of agave must. In addition, the chemical components and organoleptic characteristics in the produced craft Mezcal beverage were evaluated.

MATERIALS AND METHODS

Strains, media, and culture conditions The bacterial strain used in this work was Escherichia coli JM101 [supEthi∆(lac-proAB) F′(traD36 proAB′ lacIqlacZ∆M15)] 32, grown at 37 °C in Luria-Bertani (LB) medium (10


Page 6 of 49

Page 7 of 49


g/L peptone, 5 g/L yeast extract, and 5 g/L NaCl) and supplemented with 100 µg/mL ampicillin (when required). JM101 strain was transformed by electroporation of 100 µL suspension of competent cells with 10 ng of plasmid DNA into a 0.1-cm electroporation cell (BioRad, Hercules, CA) at 1.8 KV for 3.8 ms using a MicroPulser electroporator (BioRad, Hercules, CA) 32. Yeast strains, Saccharomyces cerevisiae BY4741 [MATa; his3∆1; leu2∆0; met15∆0; ura3∆0] (Applied Biosystems, Foster City, CA) and Kluyveromyces marxianus UMPe-1 7, 9 were grown at 30 °C and maintained on YPD plates containing 10 g/L yeast extract, 20 g/L peptone of casein, 20 g/L glucose (unless indicated otherwise), and 20 g/L agar. For selection of S. cerevisiae BY4741 and K. marxianus, UMPe-1 recombinant clones were plated on YPD plates with 100 µg/mL Zeocin (Invitrogen, Carlsbad, CA).

PCR amplification Genomic DNA from the native S. cerevisiae strain was prepared 33 and used as the template to amplify ATF1 and 18S rDNA genes, respectively by PCR. The 18S ribosomal gene was amplified using the forward oligonucleotide, O3F (CTGCCAGTAGTCATATGCTTGTCTC) and the reverse oligonucleotide, O3R (GTCCAAATTCTCCGCTCTGAGATGG). The ATF1 gene was PCR-amplified using the forward oligonucleotide, O1F (AGATCACGTGCAAACCGAAGAAATG) and the reverse oligonucleotide, O2R (CGAGGATATGCACACAAGGTTCCAA). Oligonucleotides were designed using the S. cerevisiae S288C strain DNA genome. Platinum Pfx DNA polymerase (Invitrogen, Carlsbad, CA) was used for the amplification of DNA fragments as follows: one cycle each of 5 min at 94 °C, 40 s at 94 °C, 35 s at 42 °C, and 1 min/kb extension at 68 °C for a total of 30 cycles, followed by a final extension of 5 min at 68 °C.



Following the DNA amplification by PCR, the DNA products were cloned into pGEM-T Easy (Promega, Madison, WI) and pJET1.2/blunt (Thermo Scientific, Waltham, MA) vectors and electroporated into the JM101 strain. DNA fragments cloned into plasmids were verified by endonucleases restriction analysis and DNA sequencing.

Yeast transformation Transformation of S. cerevisiae BY4741 and K. marxianus UMPe-1 yeasts was carried out using the DNA fragment obtained by PCR amplification using the oligonucleotides O3R and O3F with the plasmid pJATF1-18S-Zeo as template and the linearized plasmid pJATF118S-Zeo previously digested with the endonuclease ScaI (unique site located inside of the bla gene of the pJET1.2/blunt coning vector), respectively (see below; Fig. 1). Competent yeast cell suspensions were prepared according to supplier instructions (kit Frozen-EZ Yeast Transformation II; Zymo Research, Irvine, CA). Briefly, competent yeast cells were prepared by growing them at 30 °C in 10 mL YPD until mid-log phase, harvesting cells by centrifugation at 500 g for 4 min, and suspending them in 10 mL EZ1 solution to wash the pellet; following which, 1 mL EZ2 solution was added to resuspend the pellet and this was used for transformation or stored at -80 °C for further use. Yeast transformation was carried out by mixing 50 µL suspensions of competent cells with 0.2 µg DNA fragment and 500 µL EZ3 solution thoroughly and incubating at 30 °C for 45 min, followed by plated on selective Zeocin-YPD medium and incubation at 30 °C for 48-72 h. The zeocin-resistant clones were submitted to total DNA extraction using standard methods 33 and recombination events were confirmed by PCR and sequencing of the DNA fragments as described below.


Page 8 of 49

Page 9 of 49


Nucleic acid isolation, qPCR, and qRT-PCR S. cerevisiae BY4741 and K. marxianus UMPe-1 yeasts were harvested by centrifugation and washed with distilled water. Biological samples (30 mg) were transferred into a tube of MagNA Lyser Green Beads (Roche, Basilea, Switzerland) that were pre-cooled on ice. RLT buffer (700 µL) from the RNeasy Mini Kit (Qiagen, Germantown, MD) was immediately added prior to starting the cell lysis. Cell disruption took place when the tubes were placed in a MagNA Lyser Instrument (Roche, Basilea, Switzerland) and processed twice for 40 s at 6500 rpm. Immediately after any processing step, samples were cooled on ice for 1 min. Samples were centrifuged for 1 min at 20,000 g and the supernatant was used for DNA or RNA isolation, following the manufacturer's protocols. DNA was isolated by phenol-chloroform extraction method and RNA using the RNeasy Mini Kit (Qiagen, Germantown, MD). DNA or RNA in the samples was quantified using a SmartSpec Plus spectrophotometer (Bio-Rad, Hercules, CA). RNA samples were treated with DNase I (Promega, Madison, WI). Primers and hydrolysis probes for ATF1 and β-actin gene (ACT1) from S. cerevisiae were designed using Biosearch Technologies software (www.biosearchtech.com, Biosearch Technologies, Novato, CA). For ATF1 amplification: forward primer ATF1F (TTCAAGTACGAGGAGGATTACCAAT), reverse primer ATF1R (AAACAAGTACGGTGGTCTAAAGTC), and quencher probe primer ATF1probe (TGAGGAAACTTCCAGAACCGATCGA) were used. For β-actin amplification: forward primer ACT1F (CGTCTGGATTGGTGGTTCTATC), reverse primer ACT1R (GGACCACTTTCGTCGTATTCTTG), and quencher probe primer ACT1probe (TGGCTTCTTTGACTACCTTCCAACA) were used.



The ATF1probe and ACT1probe oligonucleotides were used as specific quencher probes in the qRT-PCR; these hydrolysis probes included a 5’ end labeled with FAM (Carboxyfluorescein) and a 3’ end modified with BHQ1 Black Hole Quencher 1. Primers and the hydrolysis probe were purchased from Biosearch Technologies, Inc. (Novato, CA). qRT-PCR in real time was performed using the LightCycler 480 II System (Roche Molecular Diagnostics, Basilea, Switzerland) employing the SuperScript III Platinum Onestep qRT-PCR reagent kit (Invitrogen, Carlsbad, CA). Reactions were set up with 5 µL of extracted total RNA template (50 ng), 0.5 µL of enzyme mix, 12.5 µL of 2X reaction mix, 0.5 µL of 10 µM forward primer, 0.5 µL of 10 µM reverse primer, 0.5 µL of 5 µM quencher probe, and 5.5 µL of water. qRT-PCR was initiated by reverse transcription at 50 °C for 30 min and initial denaturation at 95 °C for 5 min, followed by 45 amplification cycles at 95 °C for 30 s, and 60 °C for 30 s; fluorescence signals were collected at each 60 °C stage. Appropriate positive and non-template controls were included in each test run. qPCR in real time was carried out utilizing the qRT-PCR procedure as described above, but using total DNA extraction and except the RT reaction. Relative gene expression was determined by estimating the efficiency (E) of real-time PCR assay using β-actin as the reference gene 34.

ATF1-18S rDNA fusion and genetic recombination into the S. cerevisiae BY4741 yeast The ATF1 transcription unit (~2,936 bp) was obtained by PCR using oligonucleotides O1F and O2R, and then ligated into the pGEM-T Easy cloning vector to produce the pGO1FO2R plasmid. The blunt ended 18S rDNA PCR fragment (~1,716 bp) was obtained using oligonucleotides O3F and O3R, and was cloned into pJET1.2/blunt to generate the pJ18S


Page 10 of 49

Page 11 of 49


plasmid (Fig. 1). The DNA fragment SacI/SacII obtained from the pGO1F-O2R plasmid was then ligated into the SacI/SacII sites of the pJ18S plasmid, generating the pJATF1-18S plasmid, in which ATF1 was cloned in the opposite transcription sense to the 18S rDNA gene (Fig. 1). To select recombinant clones, a Zeocin resistance cassette (~1,400 bp) was cloned into the SacII site of pJATF1-18S plasmid, producing plasmid pJATF1-18S-Zeo (Fig. 1). The zeocin cassette was obtained from the pBS38ZeoB vector, flanked by PTEF1 and PEM7 promoters, which allowed expression in yeast and E. coli, respectively. Likewise, it contained the CYC1 transcriptional terminator. The PCR fragment (∼5.8 kb fragment obtained with oligonucleotides O3F and O3R and pJATF1-18S-Zeo plasmid as template) was used for recombination into the S. cerevisiae BY4741 strain. The resulting recombinant clones were selected by zeocin resistance and characterized by PCR and DNA sequencing to verify integration into the targeted genomic locus. When primers O1F and O3F were used to confirm the ATF1-18S genotype, a ∼ 4.9 kb product was amplified using as template, recombinant DNA from the S. cerevisiae BY4741-ATF1-18S-Zeo17 clone; in the parental yeast, PCR products were not detected (Fig. 2a). Furthermore, two bands of ∼ 2.9 kb and ∼ 4.9 kb were observed in the recombinant clone (using oligonucleotides O1F, O3F, and O2R), whose sizes corresponded with ATF1 itself and the ATF1-18S-Zeo integration, respectively (Fig. 2a). The amplification pattern and DNA sequencing of the ∼ 4.9 kb PCR fragment (Fig. S1, Supporting Information) confirmed that ATF1 was successfully integrated into the 18S locus in the recombinant yeast, indicating that the recombinant clone of S. cerevisiae BY4741 contains the genetic modification; this clone was used for further assays.



Genetic integration of heterologous ATF1 into the K. marxianus UMPe-1 yeast The pJATF1-18S-Zeo plasmid, linearized with the ScaI endonuclease (unique site located within the bla gene of the pJET1.2/blunt cloning vector), was utilized for the recombination event into the K. marxianus UMPe-1 yeast, as described above (Fig. 1). Once the recombinant clones from the UMPe-1 strain were obtained, we characterized the genetic integration by PCR and genomic DNA fragments sequence analyses. On total DNA from the recombinant K. marxianus UMPe-1::ATF1:18S-Zeo1 clone, using the oligonucleotide mix O3F and O3R from the 18S gene and O1F from ATF1 gene, DNA fragments of ∼4.9 kb and ∼1.7 kb were observed; whereas only a ∼1.7 kb amplification fragment was detected in the WT yeast (Fig. 2b). As expected, in the recombinant clone, 18S DNA amplification was also observed. Further, in the recombinant clone, in addition to the expected ∼4.9 kb DNA fragment (Fig. 2b-c), using the primers pairs O3F (forward primer to 18S gene) and ATF1F (internal and forward primer to ATF1 gene) and the O3R (reverse primer to 18S gene) and ATF1R (internal and reverse primer to ATF1 gene), ∼3.7 kb and a ∼1.8 kb fragments were observed, respectively (Fig. 2c). DNA sequencing of the ends of the ∼4.9 kb, ∼3.7 kb, and ∼1.8 kb PCR-obtained fragments confirmed that genetic integration of ATF1 into the 18S gene was successful (Fig. S1, Supporting Information). These results show that the complete ATF1 gene was integrated in the 18S rDNA locus, indicating that a heterologous ATF1 integration occurred and that this genetic modification did not provoke deletion of the 18S gene locus.

Total ester determination by colorimetric method


Page 12 of 49

Page 13 of 49


For screening recombinant clones overproducing putative esters, zeocin-resistant yeast clones were grown in fermentative conditions. Yeasts were pre-cultured in YPD with light shaking for 12 h and incubation at 30 °C, which were used to inoculate 1:20 (v:v) fresh medium YPD (10 g/L yeast extract, 20 g/L peptone of casein, and 80 g/L glucose), incubating with light shaking at 30 °C. For ester determination, 500 µL of cell free supernatants of the fermentation medium were treated with 334 µL of hydroxylamine hydrochloride (2 M, Sigma-Aldrich, St. Louis, MO) and 334 µL of sodium hydroxide (3.5 M, Merck, Kenilworth, NJ). To this, 334 µL of hydrochloric acid (4 M, J.T. Baker, Waltham, MA) and 334 µL of ferric chloride solution (J.T. Baker, Waltham, MA) was added and mixed by vortexing. Finally, spectrophotometric determination of esters was performed at 525 nm; quantitation of esters was based on a pure standard ethyl-acetate calibration curve 35.

Batch fermentation test in YPD medium and agave must Fermentations were carried out in modified YPD medium supplemented with glucose 200 g/L. Pre-cultures were grown on YPD medium by incubation for 12 h at 30 °C with light shaking and used to inoculate batch fermentation flasks with 100 mL of YPD (200 g/L glucose) at 0.1 OD600 followed by incubation at 30 °C without agitation. Yeast seeding for fermentations of agave must was carried out in high fructose agave syrup (containing approximately 9.4% glucose, 88.6% fructose, and 2% other sugars). The agave must was prepared following the routine procedure of the Mezcal factory (La Flor del Mezcal SPR de RL). Briefly, 3,000 kg of agave pines of the A. cupreata, A. angustifolia, and A. inaequidens species used as raw material were cooked and rested for 4 days, followed by milling to obtain concentrated agave juice with bagasse between 8–10 °Brix, known as



agave must. Two hundred liters of agave must was inoculated with 15 L of yeast seed grown previously (containing 145×106 cells/mL with >95% viability) and fermented in barrels of 400 L each. Simultaneously, barrels with agave must were fermented without addition of yeast-seed (natural and spontaneous fermentation process). Fermentation was carried out for 72 h at ambient temperature (22-28 °C) for the yeast seeding or 120 h for the uninoculated must. After incubation, the fermented agave must was submitted to double distillation as following routine factory procedures. The obtained Mezcal beverages were diluted to 46° alc. vol. and utilized for chemical compound analysis by GC-MS and beverage tasting as described below.

Analytical determination of fermented YPD medium and Mezcal beverage At the end of YPD fermentations, total esters were determined by the ferric-hydroxamate colorimetric method 36, 37 and VOCs by gas chromatography (GC-MS-FID). Ethanol production and sugar consumption in the fermented YPD medium were determined by liquid chromatographic analysis (HPLC, Varian Prostar 240, Santa Clara, CA) using a refractive index detector (Perkin-Elmer, San Jose, CA) 7. The fermented samples were filtered and separation was performed using an Aminex HPC-87Ca column (Bio-Rad, Hercules, CA), by injecting 25 µL of the sample. The operating conditions were as follows: 80 °C column temperature, using deionized water as the mobile phase at a rate of 0.7 mL/min for 20 min. Compound quantitation was based on calibration plots using sucrose, glucose, fructose, and ethanol as standard compounds at 0.125, 0.25, 0.5, 1.0, and 2% (w/v) each, and obtaining a linear correlation coefficient R2= 0.99 for each.


Page 14 of 49

Page 15 of 49


VOC extraction was carried out as described 7, 8. Briefly, VOCs were recovered from the fermented media or Mezcal samples by liquid-liquid extraction (ratio 1:1.5) with dichloromethane (Sigma-Aldrich, St. Louis, MO). Cell-free supernatants (5 mL) from fermentation flasks or from the distilled beverage after dilution (46° alc. vol.) obtained from the Mezcal factory, to which 2-pentanol was previously added (Sigma-Aldrich, St. Louis, MO) as an internal standard at a final concentration of 2 mg/mL, were extracted twice with 7.5 mL dichloromethane. The organic extracts were concentrated by solvent evaporation in a fume chamber, to a final volume of 0.5 mL using a water bath at 40 °C. VOC content analysis was performed by GC-FID and GC-MS. A sample volume of 1 µL was injected into a gas chromatographer (GC; Agilent 6850 Series II equipped with MS5973 and FID detectors, Santa Clara, CA), fitted with a Zebron ZB-WAX PLUS and a capillary column (30 m × 0.25 mm i.d., 0.5 µm film thickness; Phenomenex, Torrance, CA) using helium at a flow rate of 1 mL/min as the carrier gas. Sample injection was performed at splitless temperature of 280 °C and FID detector temperature of 300 °C. The oven temperature was programmed to 45 °C for the first 3 min, and then ramped up to 200°C at 4°C/min and to 240°C at 10 °C/min, and finally held for 2 min, giving a total run time of 56 min. To analyze using both the MS and FID detectors, at the exit of the capillarity column, a continuous-flow particle separation (50:50) was installed. The mass spectrometer was operated at an ionization voltage of 70 eV and with scanning between m/z 30-500 at 3.9 scans/s. Compounds were identified by comparison with the mass spectral library (NIST/EPA/NIH, ChemStation, Agilent Technologies Rev. D.04.00 2014, Santa Clara, CA). Retention indices for the compounds were calculated according to the Kovats method, by comparing with those from accessible scientific literature; additionally, peaks were analyzed using the ion deconvolution method with an accuracy of ≥95% identity in mass



fragmentation profiles of the ChemStation, Agilent Technologies Rev. D.04.00 2014. VOC and mass profile comparisons were determined using calibration curves generated by using chemical standards such as acetaldehyde, methanol, 2-methyl-2-butanol, 2-butanol, 1propanol, 2-methyl-1-propanol, 2-pentanol, 1-butanol, 3-methyl-2-butanol, 1-pentanol, 3ethyl-1-butanol, phenylethyl alcohol, phenol, ethyl-acetate, isoamyl-acetate, ethyl-lactate, 3-hydroxy-2-butanone, furfural, and acetic acid (all from Sigma-Aldrich, St. Louis, MO). In addition to these chemicals, the compounds used for GC-MS identification were propionic acid, isobutanoic acid, 3-methyl-butanoic acid, ethyl-3-methylbutanoate, ethylhexanoate, ethyl-octanoate, ethyl-decanoate, isoamyl-decanoate, geranyl-isovalerate, ethyltetradecanoate, ethyl-hexadecanoate, ethyl-linoleate, n-butanoic acid, n-hexanoic acid, noctanoic acid, n-decanoic acid, n-dodecanoic acid, n-tetradecanoic acid, n-hexadecanoic acid, and n-octadecanoic acid, obtained by chemical synthesis using the respective chemical precursors (from Sigma-Aldrich, Merck or T.J. Baker). Fatty acids were synthesized by oxidation of their respective alcohols with H2SO4 and KMnO4; fatty acidethyl esters were synthesized by esterification of the fatty acids treated with H2SO4 and ethanol at 130 °C for 30 min; and acetate esters were synthesized by esterification of the respective alcohol treated with H2SO4 and acetic acid at 130 °C for 30 min. All synthesized compounds were extracted with dichloromethane solvent, evaporated, weighed, and dissolved in dichloromethane for GC-MS analysis (mass fragmentation profiles are showed in Table S1, Supporting Information). Additionally, FAME Mix C4-C24, catalog no. 18919 (Supelco, Bellefonte, PA) were used as standards for GC-FID and GC-MS analysis. VOC quantitation was performed using the relative values of the peak areas in chromatograms obtained by using an FID detector, based on calibration plots using higher alcohols, esters, or organic acids as standard compounds at concentrations in the range of 1-100 mg/100


Page 16 of 49

Page 17 of 49


mL, and obtaining a linear correlation coefficient of R2= 0.99. Data normalization of compound concentration was conducted using the internal standard compound 2-pentanol, and it was used to determine the response factor and accurate normalization of the extraction procedure.

Sensorial analysis Sensorial evaluation of the Mezcal samples was conducted by a group of 13 certified drinkspecialized tasters of the Beer factory “Heineken-Cuauhtémoc Moctezuma, México”. For sample analysis, transparent glasses were filled with 20 mL Mezcal and covered with a glass cover. Four samples were arranged in pairs at separate randomized stations and labeled with random codes. Panelists assessed the Mezcal samples by sniffing and tasting coded samples in terms of their intensity of aroma and flavor perception using a value scale in the range of 0 to 10 for referring to the degree of organoleptic character perception, summation of values for each characteristic mentioned by the 13 tasters was divided by the total, rendering the numeric values to be used for correlation analysis. Also, the data matrix was analyzed and results expressed as a percentage of preferences. Additionally, a list of descriptors perceived by the panelists in the Mezcal beverages tasting was recorded.

Statistical analysis A comparative analysis of the VOCs identified in each sample was conducted by two independent assays in triplicate and the average was used for statistical analysis. For correlation analysis, the samples corresponding to response variables and compound concentrations were the dependent variables. Multiple t-test analysis of variance, with one unpaired t-test per row and statistical significance (P < 0.05) between samples, was



compared with its respective control. The datasheets fed with the VOC concentration determined by GC-FID plus numerical data from Mezcal tasting were analyzed by principal component analysis (PCA) using the STATISTICA software (Data Analysis Software System 8.0. Stat Soft. Inc., Tulsa, OK).

RESULTS AND DISCUSSION Effect of ATF1 overexpression in the laboratory yeast S. cerevisiae BY4741 The recombinant S. cerevisiae BY4741 yeast with the complete ATF1 gene integrated in the 18S rDNA locus (BY4741:ATF1-18S-Zeo17) was used to evaluate growth and fermentative capabilities under fermentation conditions in YPD liquid medium containing 200 g/L of glucose. The results indicate that the genetic modifications carried out did not have a deleterious effect on the growth rate and glucose consumption, but affected the rate of ethanol yield, compared to the unmodified control strain (Fig. 3a-b). For BY4741 WT strain, the following parameters were obtained: µ=0.157 h-1, 3.04 g glucose/L per h, 1.49 g ethanol/L per h, and 91.06% ethanol yield; while for the recombinant clone ATF1-18S: µ=0.157 h-1, 2.91 g glucose/L per h, 1.52 g ethanol/L per h, and 86.58% ethanol yield (Table 1). Additionally, total ester production determined by colorimetric method clearly showed that the recombinant yeast significantly increased ester production (approximately 10-fold) after 48-72 h of fermentation in YPD medium (Fig. 3c). Ester production remained low in the first 24 h, increasing between 48-72 h, and then decreasing again by 96-120 h of fermentation. These results indicate that in the fermentation medium, the production of esters increased in correlation to ATF1 integration in the recombinant yeast.


Page 18 of 49

Page 19 of 49


The ester increment observed during 24-72 h of fermentation and their decrease after 72 h of fermentation could be explained by the activities of the enzymes alcohol acetyltransferase and esterase 18, 19, 25, 38. Thus, the obtained data indicate that the strategy utilized to increase ester production in the laboratory yeast S. cerevisiae BY4741 was successful. Therefore, we next aimed to construct the respective recombinant clone in the K. marxianus UMPe-1 industrial yeast.

Expression of heterologous ATF1 into the K. marxianus UMPe-1 yeast When the genetic characterization showed that the complete ATF1 gene was integrated in the 18S rDNA locus of the K. marxianus UMPe-1 yeast, and that the heterologous ATF1 integration did not provoke perceptible modifications in the growth of the engineered yeast, we determined ATF1 expression. A qPCR assay was carried out for determination of ATF1 copies in the recombinant UMPe-1::ATF1:18S-Zeo1 clone. Results indicate that the WT strain showed one copy of ATF1, normalized to the β-actin gene, while the UMPe1::ATF1:18S-Zeo1 clone showed three ATF1 DNA copies (Fig. 4a). To determine the transcriptional levels of ATF1, qRT-PCR was conducted. The results indicate that in the recombinant clone, the ATF1 transcript level increased significantly during the period of 12 h to 72 h, with approximately 10-fold increased expression at 72 h with respect to the β-actin control and approximately 20 times with respect to the WT yeast (Fig. 4b). These results indicate that in the constructed K. marxianus UMPe-1::ATF1:18SZeo1 clone, ATF1 gene was successfully overexpressed at the transcriptional level, suggesting that the alcohol-acetyl transferase enzyme activity could be increased in the engineered yeast; to test this, total ester production was determined. The results clearly



showed that the recombinant yeast significantly increased ester production comparing with the WT after 48-96 h of fermentation in YPD medium (Fig. 4c). Interestingly, ester production in the WT gradually increased between 12-96 h of fermentation. These results further indicate the esters increment was in correlation with increased ATF1 expression in the recombinant yeast.

Determination of fermentation parameters and VOC content in the ATF1 engineered yeast K. marxianus UMPe-1 To determine the effect of ATF1 recombination in K. marxianus UMPe-1 on its fermentative capabilities, its fermentation parameters were tested in YPD liquid medium containing 200 g/L of glucose (Table 1). These determinations showed that there were no significant differences between the K. marxianus UMPe-1 (WT) and its recombinant yeast, the UMPe-1::ATF1:18S-Zeo1 clone. For the WT K. marxianus yeast, values were: µ=0.103 h-1, 2.75 g glucose/L per h, 1.36 g ethanol/L per h, and 92.75% of ethanol yield; while for the UMPe-1::ATF1:18S clone, the parameters were: µ =0.111 h-1, 2.50 g glucose/L per h, 1.26 g ethanol/L per h, and 90.65% of ethanol yield. These results further confirmed that the ethanologenic properties in the engineered yeast were unaffected. The effect of ATF1 overexpression in the recombinant K. marxianus UMPe-1::ATF1:18SZeo1 yeast on VOC content in the fermented YPD medium was evaluated. Analysis of VOCs in fermented media showed a significant increment of 30% in ester content for the recombinant clone compared to that in the WT yeast (Table 2), but considerable difference was not found for total levels of higher alcohols and organic or fatty acids; however, concentration of some higher alcohols such as 2-methyl-2-butanol, 3-ethyl-1-butanol, 2,3


Page 20 of 49

Page 21 of 49


butanediol, and α-terpineol, decreased; moreover, concentrations of some organic and fatty acids were increased, such as acetic, propionic, isobutanoic, n-butanoic, 3-methyl-1butanoic, n-hexanoic, n-decanoic, and n-dodecanoic acids (Table 3). The main esters that increased in the YPD fermented medium were: ethyl-acetate, ethyl-hexanoate, ethyloctanoate, 2-phenylethyl-acetate, isoamyl-decanoate, ethyl-tetradecanoate, ethylhexadecanoate, and ethyl-linoleate (Table 3). These results confirmed that in the YPD media fermented by the ATF1-engineered yeast, ester production was increased.

Determination of VOC content in Mezcal obtained from fermentation of Agave must using the engineered K. marxianus UMPe-1::ATF1:18S-Zeo1 yeast To analyze the effect of ATF1 overexpression in the recombinant K. marxianus UMPe1::ATF1:18S-Zeo1 yeast on VOC content in Mezcal, VOCs were quantified. K. marxianus yeasts were utilized in the fermentation stage under industrial conditions, after fermented agave must was distilled using the routine procedure followed in the Mezcal factory. Extraction of VOCs from the produced Mezcal samples was carried out by liquid-liquid extraction using dichloromethane solvent. The Mezcal extracts obtained from the WT and the recombinant clones were analyzed by GC-FID-MS and a correlation analysis was conducted. Approximately 84 different peaks were observed in the Mezcal beverage produced from fermentation using either the K. marxianus UMPe-1 (WT) or the recombinant yeast K. marxianus UMPe-1::ATF1:18S-Zeo1; however, only 47 compounds were identified and their structures confirmed by mass fragmentation profiles by comparing with chemical standards (Table 3). The VOC distribution in the WT yeast corresponds to ~465 mg/100 mL higher alcohols (80.2%, excluding ethanol and methanol), ~100 mg/100



mL organic acids (17.6%), ~6.6 mg/100 mL furans/terpenes (1.16%), and ~6.1 mg/100 mL esters (1.07%) (Table 2 and 3). In contrast, Mezcal sample produced from the recombinant UMPe-1::ATF1:18S-Zeo1 yeast contained ~465 mg/100 mL higher alcohols (78.5%), ~110 mg/100 mL organic acids (18.5%), and ~8.3 mg/100 mL furans/terpenes (1.4%), and ~10.4 mg/100 mL esters 1.75%). Interestingly, compound determination showed that ester content significantly increased in the Mezcal produced from fermentation using the recombinant K. marxianus yeast compared to that using the WT yeast (Table 2). VOC analysis in the Mezcal samples produced from fermentation with the engineered yeast indicated that among the 47 compounds identified, the group of VOCs that showed an increment in the recombinant clone compared to the WT yeast, corresponded solely to esters (Table 2). Ester content significantly increased by ~60% in fermentation of agave must using the recombinant K. marxianus UMPe-1::ATF1:18S-Zeo1, increasing in correlation to ATF1 overexpression. No statistically significant differences were found for other groups of VOCs such as higher alcohols, organic and fatty acids, and furans/ketones. The ATF1-overexpression in a wine-yeast, affects higher alcohols concentration in the wine produced in correlation with an increase in acetate esters content (ethyl-acetate, isoamylacetate, hexyl-acetate, and 2-phenylethyl-acetate) 18. In agreement with our previous experiments, when the recombinant K. marxianus UMPe-1 ATF1:18S-Zeo1 clone was used for Mezcal production, a correlation between esters concentration increment and decrease of concentration of some higher alcohols was found; a statistical significance was not observed for total alcohols and organic acids groups (Table 2). The higher alcohols that showed a decreased concentration in the Mezcal produced were 1-butanol, 3-methyl-2butanol, 3-ethyl-1-butanol, 2,3 butanediol, furfuryl-alcohol, and phenylethyl alcohol (Table


Page 22 of 49

Page 23 of 49


3). While as for organic and fatty acids, an increment in concentration was observed for acetic, isobutanoic, 3-methyl-butanoic, n-octanoic, n-decanoic, n-dodecanoic, ntetradecanoic acids; contrary to, decrease in propanoic, n-butanoic, n-hexanoic, nhexadecanoic, and n-octadecanoic acids was observed (Table 3). A linear correlation analysis of VOCs content in Mezcal produced from the WT and the recombinant yeast clearly shows that the esters were located outside of the correlation line, but did not with higher alcohols (Fig. S2, Supporting Information). The ester group consisted mainly of acetate-esters and fatty acids ethyl-esters, which had significantly increased in concentration in the Mezcal produced with the recombinant UMPe1::ATF1:18S-Zeo1 yeast including: ethyl-acetate (1), ethyl-3-methylbutanoate (5), isoamylacetate (7), ethyl-hexanoate (12), ethyl-lactate (17), ethyl-octanoate (18), isoamyl-lactate (25), ethyl-decanoate (27), 2-phenylethyl-acetate (31), ethyl-dodecanoate (32), isoamyldodecanoate (34), geranyl-isovalerate (36), nerolidyl-acetate (38), ethyl-tetradecanoate (39), ethyl-hexadecanoate (41), and ethyl-linoleate (44) (Table 3; Fig. S2, Supporting Information). These results further indicate that in the Mezcal produced from the fermentation of agave must using the UMPe-1::ATF1:18S-Zeo1 yeast, ester content was increased in correlation to ATF1 overexpression, as designed.

Mezcal preference by a tasters panel In the traditional and craft Mezcal production process, inoculation with industrial yeast is rarely used; instead, natural fermentation is followed, resulting in large fermentation periods (5-8 days), low quality, and variation of the distilled products obtained between batches of production. Additionally, the distilled beverages obtained commonly possess low organoleptic characteristics, directly influencing their flavors and aromas, thereby the



economic cost of the distilled beverage produced. Ester content improvement in the Mezcal beverages could be achieved by the increase of alcohol acetyl-transferase activity with utilization of the engineered K. marxianus yeast containing the integration of ATF1 in the 18S rDNA. This in consequence may improve the organoleptic characteristics in the Mezcal beverage. To quantify this success, the Mezcal beverages obtained in this work were used in a sensorial test consisting of professional tasters. The results showed that utilization of the K. marxianus UMPe-1 yeast in the fermentation process increased the acceptability of the Mezcal beverage (78% preference of the panelist tasters); this value was distributed as 30% preference for the Mezcal produced using the K. marxianus UMPe1 WT, and 48% preference for the Mezcal produced using the recombinant K. marxianus UMPe-1::ATF1:18S-Zeo1 yeast, when compared to two types of Mezcals (“Joven and Ensamble”) produced by the same factory, for which the preferences of the tasters were 7% and 15%, respectively (Table 4). In general, the organoleptic characteristics provided through the recombinant yeast fermentation to make Mezcal were mentioned by the tasters panel as: aromas (strong aromas such as fruits, sweet, earth, citrus, agave plant, and wood) and flavors (strong fruity, sweetness, smoky, earthy, and herbal flavors). Some of these aromas and flavors have been associated directly with the content of acetate esters and fatty acids ethyl esters in the fermented beverages 14, 16, 31, 39, compounds that in our work were increased significantly in the Mezcal obtained by using the ATF1 genetic modification in the UMPe-1 yeast.

Correlation between ester content and sensorial analysis of the Mezcal The correlation between VOC content and sensorial characteristics from the Mezcal tasting was analyzed by PCA to visualize the relationship among the VOCs (47 compounds


Page 24 of 49

Page 25 of 49


identified) and seven complementary variables related to organoleptic descriptors identified and quantified by the tasters’ panel (Fig. 5). Results showed that the VOCs identified in the Mezcal beverages were distributed in two main groups, one group of 27 VOCs (points within black line circle of PCA plot) belonging to Mezcal produced using the K. marxianus UMPe-1 (WT) and the ATF1-recombinant yeast; a second group of VOCs (points within dashed yellow circle of PCA plot) associated with the Mezcal “Joven” produced through traditional and craft procedure (Fig. 5). Interestingly, results showed a strong correlation between a group of 12 VOCs (points within pink circle of PCA plot) that increased in concentration in the Mezcal produced using the ATF1-recombinant yeast and the fruitiness and sweetness, and to a lesser extent with wood and herbal sensorial descriptors (Fig. 5). Additionally, a group of 15 VOCs was located in the central plot, whose compounds were found in the three Mezcal beverages analyzed and that correlated with descriptions such as smoked, astringent, and earth like flavors. PCA plot shows that 11 of 12 VOCs grouped near to the fruitiness and sweetness descriptions belong to fatty acids-ethyl esters and -acetate esters such as ethyl-acetate (1), ethyl-3-methylbutanoate (5), isoamyl-acetate (7), ethyl-hexanoate (12), ethyl-octanoate (18), ethyl-decanoate (27), 2-phenylethyl-acetate (31), isoamyl-decanoate (34), ethyltetradecanoate (39), ethyl-hexadecanoate (41), and ethyl-linolenate (44). Thus, the PCA analysis of the Mezcal beverages showed that the relationship between chemical data and sensorial descriptors successfully correlated with the ATF1-engineered yeast, in which esters were enriched in Mezcal during the fermentation process. In accordance with our findings, there are two classes of esters that have been widely associated with wine fruitiness, acetate esters and medium-chain fatty acid ethyl esters 6. Examples of acetate esters are: ethyl-acetate (fruity, solvent-like aroma), isoamyl-acetate (banana-like, fruity



aroma), isobutyl-acetate (honey aroma), hexyl-acetate (roses-like, apple, cherry, floral and pear aroma), and 2-phenylethyl acetate (honey, flowers aroma); the most significant fatty acids-ethyl esters are ethyl-hexanoate (sour apple-like aroma) and ethyl-octanoate (applelike aroma) 5, 6, 14, 39. All these esters associated with fruitiness in other beverages were also found at an increased content in the Mezcal obtained with the K. marxianus engineered yeast, using both chemical and sensorial analyses. The present work indicates that an increase in ester levels improves the organoleptic properties and taster’s preference for Mezcal. This suggests that alcohol acetyl transferase I overexpression could be implemented in fermentation processes that require increased ester concentrations, thus improving the organoleptic characteristics in the beverage and ensuring economically viable industrial processes.

Acknowledgements This study was funded by the Consejo Nacional de Ciencia y Tecnología (CONACYT) of México (grant number 256119), Universidad Michoacana de San Nicolás de Hidalgo/C.I.C.2.14 grant. To José Luis Sánchez Y. from the Mezcal factory “La Flor del Mezcal SPR de RL” and to “Heineken-Cuauhtémoc Moctezuma, México” for the facilities afforded.

Supporting Information Table S1. Mass fragmentation profiles of compounds identified in the Mezcal beverage and reference compounds used for authentication of metabolites. Figure S1. Confirmation by


Page 26 of 49

Page 27 of 49


DNA sequencing of the ATF1 gene integration into the 18S locus from the recombinant yeasts. Figure S2. Linear correlation analysis of VOC profiles in the Mezcal obtained from the agave must fermentation using the K. marxianus UMPe-1 wild type and its ATF1engineered yeast. This material is available free of charge on the ACS Publications website (http://pubs.acs.org).

Conflict of interest The authors declare that they have no conflict of interest.

References 1. De León-Rodríguez, A.; González-Hernández, L.; Barba de la Rosa, A. P.; EscalanteMinakata, P.; López, M. G., Characterization of volatile compounds of mezcal, an ethnic alcoholic beverage obtained from Agave salmiana. Journal of Agricultural and Food Chemistry 2006, 54 (4), 1337-1341. 2. De León-Rodríguez, A.; Escalante-Minakata, P.; Jiménez-García, M. I.; OrdoñezAcevedo, L. G.; Flores Flores, J. L.; Barba de la Rosa, A. P., Characterization of volatile compounds from ethnic agave alcoholic beverages by gas chromatographymass spectrometry. Food Technology and Biotechnology 2008, 46 (4), 448-455. 3. Lachenmeier, D. W.; Sohnius, E.-M.; Attig, R.; López, M. G., Quantification of selected volatile constituents and anions in Mexican agave spirits (tequila, mezcal, sotol, bacanora). Journal of Agricultural and Food Chemistry 2006, 54 (11), 39113915. 4. Swiegers, J. H.; Pretorius, I. S., Yeast modulation of wine flavor. Advances in Applied Microbiology 2005, 57, 131-175.



5. Ugliano, M.; Henschke, P. A., Yeast and wine flavour. In Wine chemistry and biochemistry, Moreno-Arribas, M. V.; Carmen Polo, M., Eds. Springer Science: New York, USA, 2009; pp 313-392. 6. Cordente, A. G.; Curtin, C. D.; Varela, C.; Pretorius, I. S., Flavour-active wine yeasts. Applied Microbiology and Biotechnology 2012, 96 (3), 601-618. 7. Lopez-Alvarez, A.; Diaz-Perez, A. L.; Sosa-Aguirre, C.; Macias-Rodriguez, L.; Campos-Garcia, J., Ethanol yield and volatile compound content in fermentation of agave must by Kluyveromyces marxianus UMPe-1 comparing with Saccharomyces cerevisiae baker's yeast used in tequila production. Journal of Bioscience and Bioengineering 2012, 113 (5), 614-618. 8. Aguilar-Méndez, O.; López-Álvarez, J. A.; Díaz-Pérez, A. L.; Altamirano, J.; Reyes De la Cruz, H.; Rutiaga-Quiñones, J. G.; Campos-García, J., Volatile compound profile conferred to tequila beverage by maturation in recycled and regenerated white oak barrels from Quercus alba. European Food Research and Technology 2017. doi.org/10.1007/s00217-017-2901-7. 9. Campos García, J.; Sosa Agurre, C. R.; Reyes de la Cruz, H.; López Álvarez, J. A. Levadura fermentadora para la elaboración de bebidas alcoholicas destiladas. MEXICO Patent, MX/a/2007/014445; No. Pat. 271316. 10. Nykänen, L., Formation and occurrence of flavor compounds in wine and distilled alcoholic beverages. American Journal of Enology and Viticulture 1986, 37 (1), 84-96. 11. Benítez, T.; Codón, A. C., Genetic diversity of yeast in wine production. In Applied micology and biotechnology. Agriculture and food production, Khachatourians, G.; Arora, D. K., Eds. Elsevier Science: Amsterdam, The Netherlands, 2002; Vol. 2, pp 19-44.


Page 28 of 49

Page 29 of 49


12. Hohmann, S., Osmotic stress signaling and osmoadaptation in yeasts. Microbiology and Molecular Biology Reviews 2002, 66 (2), 300-372. 13. Heard, G. M.; Fleet, G. H., Growth of natural yeast flora during the fermentation of inoculated wines. Applied and Environmental Microbiology 1985, 50, 727-728. 14. Verstrepen, K. J.; Derdelinckx, G.; Dufour, J. P.; Winderickx, J.; Thevelein, J. M.; Pretorius, I. S.; Delvaux, F. R., Flavor-active esters: adding fruitiness to beer. Journal of Bioscience and Bioengineering 2003, 96 (2), 110-118. 15. Styger, G.; Prior, B.; Bauer, F. F., Wine flavor and aroma. Journal of Industrial Microbiology & Biotechnology 2011, 38 (9), 1145-1159. 16. Smyth, H.; Cozzolino, D.; Herderich, M. J.; Sefton, M. A.; Francis, I. L., Relating volatile composition to wine aroma: Identification of key aroma compounds in Australian white wines. In Proceedings of the Twelfth Australian Wine Industry Technical Conference, Blair, R. J.; Williams, P. J.; Pretorius, I. S., Eds. Australian Wine Industry Technical Conference Inc: Melbourne, Australia, 2005; pp 31-33. 17. Ribéreau-Gayon, P.; Glories, Y.; Maujean, A.; Dubourdieu, D., Handbook of enology. The chemistry of wine stabilization and treatments. Second ed.; John Wiley and Sons Ltd: West Sussex, England, 2006; Vol. 2, p 429. 18. Lilly, M.; Lambrechts, M. G.; Pretorius, I. S., Effect of increased yeast alcohol acetyltransferase activity on flavor profiles of wine and distillates. Applied and Environmental Microbiology 2000, 66 (2), 744-753. 19. Mason, A. B.; Dufour, J. P., Alcohol acetyltransferases and the significance of ester synthesis in yeast. Yeast 2000, 16 (14), 1287-1298. 20. Liu, S.-Q.; Holland, R.; Crow, V. L., Esters and their biosynthesis in fermented dairy products: A review. International Dairy Journal 2004, 14 (11), 923-945.



21. Yoshimoto, H.; Fujiwara, D.; Momma, T.; Ito, C.; Sone, H.; Kaneko, Y.; Tamai, Y., Characterization of the ATF1 and Lg-ATF1 genes encoding alcohol acetyltransferases in the bottom fermenting yeast Saccharomyces pastorianus. Journal of Fermentation and Bioengineering 1998, 86 (1), 15-20. 22. Lilly, M.; Bauer, F. F.; Lambrechts, M. G.; Swiegers, J. H.; Cozzolino, D.; Pretorius, I. S., The effect of increased yeast alcohol acetyltransferase and esterase activity on the flavour profiles of wine and distillates. Yeast 2006, 23 (9), 641-659. 23. Saerens, S. M.; Verstrepen, K. J.; Van Laere, S. D.; Voet, A. R.; Van Dijck, P.; Delvaux, F. R.; Thevelein, J. M., The Saccharomyces cerevisiae EHT1 and EEB1 genes encode novel enzymes with medium-chain fatty acid ethyl ester synthesis and hydrolysis capacity. The Journal of Biological Chemistry 2006, 281 (7), 4446-4456. 24. Saerens, S. M.; Delvaux, F.; Verstrepen, K. J.; Van Dijck, P.; Thevelein, J. M.; Delvaux, F. R., Parameters affecting ethyl ester production by Saccharomyces cerevisiae during fermentation. Applied and Environmental Microbiology 2008, 74 (2), 454-461. 25. Verstrepen, K. J.; Van Laere, S. D.; Vanderhaegen, B. M.; Derdelinckx, G.; Dufour, J. P.; Pretorius, I. S.; Winderickx, J.; Thevelein, J. M.; Delvaux, F. R., Expression levels of the yeast alcohol acetyltransferase genes ATF1, Lg-ATF1, and ATF2 control the formation of a broad range of volatile esters. Applied and Environmental Microbiology 2003, 69 (9), 5228-5237. 26. Fujii, T.; Kobayashi, O.; Yoshimoto, H.; Furukawa, S.; Tamai, A., Effect of aeration and unsaturated fatty acids on expression of the Saccharomyces cerevisiae alcohol acetyltransferase gene. Applied and Environmental Microbiology 1997, 63 (3), 910915.


Page 30 of 49

Page 31 of 49


27. Fujiwara, D.; Kobayashi, O.; Yoshimoto, H.; Harashima, S.; Tamai, A., Molecular mechanism of the multiple regulation of the Saccharomyces cerevisiae ATF1 gene encoding alcohol acetyltransferase. Yeast 1999, 15 (12), 1183-1197. 28. Vasconcelles, M. J.; Jiang, A.; McDaid, K.; Gilooly, L.; Wretzel, S.; Porter, D. L.; Martin, C. E.; Goldberg, M. A., Identification and characterization of a low oxygen response element involved in the hypoxic induction of a family of Saccharomyces cerevisiae genes. Implications for the conservation of oxygen sensing in eukaryotes. The Journal of Biological Chemistry 2001, 276 (17), 14374-14384. 29. Lopez, C. L. F.; Beaufort, S.; Brandam, C.; Taillandier, P., Interactions between Kluyveromyces marxianus and Saccharomyces cerevisiae in tequila must type medium fermentation. World Journal of Microbiology and Biotechnology 2014, 30 (8), 22232229. 30. Zitomer, R. S.; Carrico, P.; Deckert, J., Regulation of hypoxic gene expression in yeast. Kidney Int 1997, 51, 507-513. 31. Li, W.; Wang J.H.; Zhang C.Y.; Ma H.X.; Xiao D.G., Regulation of Saccharomyces cerevisiae genetic engineering on the production of acetate esters and higher alcohols during Chinese Baijiu fermentation. Journal of Industrial Microbiology & Biotechnology 2017, 44(6), 949-960. 32. Sambrook, J.; Fritsch, E. F.; Maniatis, T., Molecular cloning: A laboratory manual. 2 ed.; Cold Spring Harbor Laboratory Press: New York, 1989; pp 157-258. 33. Philippsen, P.; Stotz, A.; Scherf, C., DNA of Saccharomyces cerevisiae. In Guide to Yeast Genetics and Molecular and Cell Biology, Part A, Elsevier: San Diego, California, USA. , 2004; pp 169-182.



34. Valle-Maldonado, M. I.; Jácome-Galarza, I. E.; Díaz-Pérez, A. L.; Martínez-Cadena, G.; Campos-García, J.; Ramírez-Díaz, M. I.; Reyes-De la Cruz, H.; Riveros-Rosas, H.; Díaz-Pérez, C.; Meza-Carmen, V., Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides. Fungal Biology 2015, 119 (12), 1179-1193. 35. Molina-Ubeda, R., Teoría de la clarificación de mostos y vinos y sus aplicaciones prácticas. 1 ed.; Mundi-Prensa Libros: Madrid, España, 2000; p 307. 36. Thompson, A. R., A colorimetric method for the determination of esters. Australian Journal of Scientific Research 1950, 3 (1), 128-135. 37. Pavia, D. L.; Lampman, G. M.; Kriz, G. S.; Engel, R. G., A microscale approach to organic laboratory techniques. 5 ed.; Cengage Learning: Belmont, California, USA, 2012; p 1015. 38. Matthews, A.; Grbin, P. R.; Jiranek, V., Biochemical characterisation of the esterase activities of wine lactic acid bacteria. Applied Microbiology and Biotechnology 2007, 77 (2), 329-337. 39. Deep, R.C.; Fedrizzi, B.; Gardner, R.C., Influence of fermentation temperature, yeast strain, and grape juice on the aroma chemistry and sensory profiles of Sauvignon blanc wines. Journal of Agricultural and Food Chemistry 2017, 65 (40), 8902-8912.


Page 32 of 49

Page 33 of 49


Figure legends Figure 1. Genetic manipulation procedure and PCR characterization of recombinant yeasts. Schematic representation of the methodological procedure followed for ATF1 integration into S. cerevisiae and K. marxianus yeasts. ATF1: alcohol acetyltransferase I gene, 18S: 18S rDNA gene, ATF1p: ATF1 transcriptional promoter, ATF1TT: ATF1 transcriptional terminator. LORE: low oxygen response element. Oligonucleotides used: O1F, O2R, O3F, and O3R.

Figure 2. Genetic characterization of the recombinant clone of S. cerevisiae BY474 and K. marxianus UMPe-1 yeasts. A) PCR analysis in agarose gels of ATF1 amplification in the recombinant S. cerevisiae BY474::ATF1:18S-Zeo clones. Lines: (1 and 6) phage λ digested with EcoRI and HindIII endonucleases, (2) PCR amplification using as template, the total DNA of S. cerevisiae BY474 strain with the O1F and O3F oligonucleotides, (3-5) PCR amplification using as template, the total DNA of three S. cerevisiae BY474::ATF1:18S-Zeo clones with the O1F and O3F oligos, (7) PCR amplification using as template, the total DNA of S. cerevisiae BY474::ATF1:18S-Zeo17 clone with the O1F and O2R oligos, and (8) PCR with the O1F, O2R, and O3F oligos mix. The migration of different DNA size fragments in bp is shown. B−C) PCR analysis in agarose gels of gene amplification in the K. marxianus UMPe-1 yeasts. B) Lines: (1) phage λ digested with EcoRI and HindIII endonucleases, (2) PCR amplification using total DNA of the K. marxianus UMPe-1 strain with the O3F and O3R oligonucleotides, (3) PCR amplification using as template, the total DNA of the recombinant clone of K. marxianus UMPe1::ATF1:18S-Zeo1 with the O3F, O3R, and O1F oligonucleotides mix. C) (1) DNA ladder



1 kb (New England Biolabs, Ipswich, MA), (2−4) PCR amplification using total DNA of the recombinant clone K. marxianus UMPe-1::ATF1:18S-Zeo1 with the oligonucleotides: (2) O3F and ATF1F, (3) O3R and ATF1R, (4) O1F and O3F. The migration of different DNA size fragments in bp is shown.

Figure 3. Determination of kinetic parameters and ester production in the recombinant clone of S. cerevisiae BY474. Yeast cultures were grown in liquid YPD medium with 20% glucose (w/v), and incubated at 30 °C with light shaking. A) Yeast growth (biomass) was determined by measuring OD at 600 nm. B) Kinetics of glucose consumption (filled symbols) and ethanol production (open symbols). C) Total ester content was quantified in fermented medium by colorimetric method at 525 nm as described in Materials and Methods. Each value represents the arithmetic mean and standard error (SEM), indicated as bars (n = 3). One-way ANOVA with Bonferroni post hoc test was used to compare recombinant clone to the WT using GraphPad Prism 6.0 software (La Jolla, CA). Significant differences (P < 0.05) are indicated with (*).

Figure 4. Determination of ATF1 copies, gene expression and ester production in the K. marxianus UMPe-1 yeasts. DNA and RNA were isolated as described in Materials and Methods. A) Determination of ATF1 copies in the K. marxianus yeasts by qPCR. B) Determination of ATF1 gene expression in the K. marxianus yeasts by RT-qPCR. C) Total ester content was quantified in fermented YPD medium by colorimetric method at 525 nm as described in Materials and Methods. B-C) Each value represents the mean and SEM values, indicated as bars (n = 3). One-way ANOVA with Tukey’s post hoc test was used to


Page 34 of 49

Page 35 of 49


compare recombinant clone to WT using GraphPad Prism 6.0 software. Significant differences (P < 0.05) are indicated as lowercase letters.

Figure 5. Principal component analysis plot of VOC profiles and sensorial characteristics in the Mezcal produced from the agave must fermentation using the K. marxianus UMPe-1 yeasts. Correlation analysis of VOCs identified in each Mezcal sample and sensorial descriptors was conducted through a statistical analysis of PCA. Mezcal samples produced from fermentation procedure using the respective yeast are indicated as: K. marx (WT), K. marxianus UMPe-1 wild type yeast; K. marx (ATF1), K. marxianus UMPe-1::ATF1:18S-Zeo1 yeast; Joven, Mezcal produced without yeast inoculation following the routine procedure of the factory. Sensorial descriptions are indicated as fruitiness, sweetness, wood, agave plant, herbal, smoked, astringent, earth, citrus, and bitter. VOCs contained in the Mezcal which can be associated with the traditional production process (points within dashed yellow circle), VOCs that correlated with the agave must fermentation using the K. marxianus yeasts (points within black empty circle), VOCs that correlated with fruitiness, sweetness, and wood descriptions (points within pink circle), and with agave plant and herbal descriptions (points within green circle). VOCs that correlated with fruitiness increased significantly in the Mezcal produced using the recombinant yeast correspond to esters: ethyl-acetate (1), ethyl-3-methylbutanoate (5), isoamyl-acetate (7), ethyl-hexanoate (12), ethyl-octanoate (18), ethyl-decanoate (27), 2phenylethyl-acetate (31), isoamyl-decanoate (34), ethyl-tetradecanoate (39), ethylhexadecanoate (41), and ethyl-linolenate (44). Data were analyzed by Multivariable exploratory techniques with 2-D PCA correspondence analysis of frequencies w/out grouping variables using the STATISTICA Software System 8.0 Stat Soft. Inc.



Page 36 of 49

Table 1. Fermentation parameters of the recombinant ATF1 yeasts.

Strain

S. cerevisiae BY4741 S. cerevisiae BY4741::ATF1:18SZeo17 K. marxianus UMPe-1 (WT) K. marxianus UMPe1::ATF1:18S-Zeo1

Theoretical

Maximum rate of

Maximum rate

Specific

efficiency of

glucose

of ethanol

growth rate µ

ethanol production

consumption

production

(%)

(g/L•h)

(g/L•h)

(h-1)

91.06±0.61

3.04±0.15

1.49±0.05

0.157±0.005

86.58±1.10*

2.91±0.21

1.52±0.04

0.157±0.008

92.75±1.13

2.75±0.22

1.36±0.09

0.103±0.007

90.65±1.30

2.50±0.20

1.26±0.08

0.111±0.005

Fermentation was carried out using YPD medium (100 mL) with glucose at 200 g/L in glass containers at 30 °C without agitation. Glucose and ethanol were determined by HPLC (n ≥ 3). Comparisons of the parameters of the wild type with its respective recombinant clone were carried out using the multiple t-test by the Sidak-Bonferroni method using GraphPad Prism 6 software. Significant differences of P < 0.05 are indicated as (*).


Page 37 of 49


Table 2. Compounds content in the fermentation media from the recombinant K. marxianus UMPe-1::ATF1:18S-Zeo1 yeast. Medium/ Strain

K. marxianus UMPe-1 (WT)

beverage YPDa

K. marxianus UMPe-1::ATF1:18S- YPD

K. marxianus UMPe1::ATF1:18S-Zeo1

a

Organic

alcohols

acids

(%)

(%)

1.18±0.04

66.2±0.5

29.3±0.6

2.7±0.05

1.53±0.04* (30%)

66.3±0.4

29.5±0.4

2.6±0.03

1.07±0.03

80.2±0.5

17.6±0.2

1.16±0.05

1.75±0.02*(60%)

78.5±0.2

18.5±0.2

1.40±0.02

(%)

Furans/ketones (%)

a

Zeo1 K. marxianus UMPe-1 (WT)

Higher

Esters

Mezcalb b

Mezcal

Fermentation was carried out using YPD medium (100 mL) with glucose at 200 g/L in

glass containers at 30 °C without agitation by 72 h, (n ≥ 3).

b

Mezcal beverage diluted to

46° alc. vol., obtained from double distillation of the fermented agave must by 72 h at ambient temperature (22-28 °C) following the routine procedures of the Mezcal factory. VOCs determination was conduced by GC-FID as described in Materials and Methods. Comparisons of the percentage of the wild type with its respective recombinant clone were carried out using the multiple t-test by the Sidak-Bonferroni method using GraphPad Prism 6 software. Significant differences of P < 0.05 are indicated as (*). In parenthesis are indicated the percentage of ester increment in the recombinant yeast with respect to the WT.



Page 38 of 49

Table 3. Analysis of the volatile compounds identified on fermented YPD media and Mezcal beverages produced from agave must fermentation using the engineered Kluyveromyces marxianus UMPe-1::ATF1:18S-Zeo1 yeast. ________________________________________________________________________________________________________________________________

Compound

Compound

No.

name

Origin R. Index

Concentration (mg/100 mL) ____________________________________________________________________________ YPD (200 g/L)

Mezcal beverage

______________________________

_______________________________

WT

WT

UMPe-1::ATF1:18S-Zeo1

(mean) %CV

(mean) %CV

P

Increase in fatty acid ethyl ester content through ... - ACS Publications

Recommend Documents