Infrared-Mediated Thermocycling for Ultrafast Polymerase Chain

We describe a noncontact method for rapid and effective thermocycling of PCR mixtures in electrophoretic chip-like glass chambers. The thermocycling i...
0 downloads 0 Views 141KB Size
Download PDF
Anal. Chem. 1998, 70, 4361-4368

Infrared-Mediated Thermocycling for Ultrafast Polymerase Chain Reaction Amplification of DNA R. P. Oda,† M. A. Strausbauch,‡ A. F. R. Huhmer,X N. Borson,‡ S. R. Jurrens,§ J. Craighead,§ P. J. Wettstein,‡ B. Eckloff,| B. Kline,| and J. P. Landers*,X

Protein Core Facility, Department of Immunology, Section of Engineering, and Molecular Technology Core Facility, Mayo Clinic/Foundation, Rochester, Minnesota 55905, and Department of Chemistry and the University of Pittsburgh Cancer Institute, University of Pittsburgh, Pittsburgh, Pennsylvania 15260

Interest in improving the speed of DNA analysis via capillary electrophoresis has led to efforts to integrate DNA amplification into microfabricated devices. This has been difficult to achieve since the thermocycling required for effective polymerase chain reaction (PCR) is dependent on an effective contact between the heating source and the PCR mixture vessel. We describe a noncontact method for rapid and effective thermocycling of PCR mixtures in electrophoretic chip-like glass chambers. The thermocycling is mediated through the use of a tungsten lamp as an inexpensive infrared radiation source, with cooling effected with a solenoid-gated compressed air source. With temperature ramping between 94 and 55 °C executed in glass microchambers as rapidly as 10 °C/s (heating) and 20 °C/s (cooling), cycle times as fast as 17 s could be achieved. Successful genomic DNA amplification was carried out with primers specific for the β-chain of the T-cell receptor, and detectable product could be generated in a fraction of the time required with commercial PCR instrumentation. The noncontact-mediated thermocycling format was not found to be restricted to single DNA fragment amplification. Application of the thermocycling approach to both quantitative competitive PCR (simultaneous amplification of target and competitor DNA) and cycle sequencing reactions (simultaneous amplification of dideoxy terminated fragments) was successful. This sets the stage for implementing DNA thermocycling into a variety of microfabricated formats for rapid PCR fragment identification and DNA sequencing. The interest in electrophoretic separations on microfabricated “chip” devices has grown dramatically over the past few years. Several groups have pioneered the development of glass electrophoretic chip devices as a result of their potential for enhancing the speed of electrophoretic separations in a miniaturized format.1-3 In parallel, there has been intense interest in the rapid electro* Address correspondence to Dr. James P. Landers, Department of Chemistry, University of Pittsburgh, Pittsburgh, PA 15260. Phone: (412) 624-1955 (office), (412) 624-8363 (lab 1), (412) 624-9699 (lab 2). E-mail: [email protected]. † Protein Core Facility, Mayo Clinic/Foundation. ‡ Department of Immunology, Mayo Clinic/Foundation. § Section of Engineering, Mayo Clinic/Foundation. | Molecular Technology Core Facility, Mayo Clinic/Foundation. X University of Pittsburgh. (1) Manz, A.; Graber, N.; Widmer, H. M. J. Chromatogr. 1990, 1, 244-252. S0003-2700(98)00452-1 CCC: $15.00 Published on Web 09/12/1998

© 1998 American Chemical Society

phoretic separation of DNA fragments in capillary-based systems, either for DNA sequencing4,5 or for fragment sizing.6,7 The ability to have these two areas converge so that electrophoretic separations of DNA fragments on glass chips can be carried out on the order of 200-400 s8 houses tremendous potential for impacting high-throughput analysis of DNA for genotyping and genomic research. However, prior to the analysis of DNA fragments, the employment of the polymerase chain reaction (PCR),9 an enzymatic process that amplifies a specific DNA target sequence in response to temperature cycling between roughly 55 and 94 °C, is often required. The PCR thermocycling allows for (1) DNA to be denatured at the high temperature (94 °C), (2) DNA to anneal with specific primer sequences at a lower temperature (e.g., 55 °C), and (3) the heat-stable Taq polymerase enzyme to replicate the annealed DNA at an intermediate temperature (e.g., 72 °C). Provided that attention is paid to conditions that promote specific amplification of the DNA sequences of interest, this is a robust and extremely powerful technique that has been exploited for a variety of molecular biological, diagnostic, and forensic applications. Combining the PCR process with the electrophoretic characterization of the PCR product in a single device would have obvious advantages over conventional approaches and provide new possibilities for its use. A PCR-CE combination reduces the contamination problem, decreases the risk of infection, and allows for faster execution of the analysis through reduced manual manipulation. In fact, Swerdlow et al.10 have recently demonstrated that a capillary electrophoresis system including a reaction purification step interfaced with a thermocycling apparatus allowed for amplification and separation of DNA in small volumes in very short times without additional manual manipulation. (2) Harrison, D. J.; Fluri, K.; Seiler, K.; Fan, Z.; Effenhauser, C. S.; Manz., A. Science 1993, 261, 895-897. (3) Ramsey, J. M.; Jacobson, S. C.; Knapp, M. R. Nat. Med. 1995, 1 (10), 10931096. (4) Mathies, R. A.; Huang, X. C. Nature 1992, 359, 167-169. (5) Huang, X. C.; Quesada, M. A.; Mathies, R. A. Anal. Chem. 1992, 64, 967972. (6) Wang, Y.; Ju, J.; Carpenter, B. A.; Atherton, J. M.; Sensabaugh, G. F.; Mathies, R. A. Anal. Chem. 1995, 67, 1197-1203. (7) Ueno, K.; Yeung, E. S. Anal. Chem. 1994, 66, 1424-1431. (8) Woolley, A. T.; Mathies, R. A. Proc. Natl. Acad. Sci. U.S.A. 1994, 91 (24), 11348-11352. (9) Mullis, K.; Faloona, F.; Scharf, S.; Saiki, R.; Horn, G.; Erlich, H. Cold Spring Harbor Symp. Quant. Biol. 1986, 51, 263-273. (10) Swerdlow, H.; Jones, B. J.; Wittwer, C. T. Anal. Chem. 1997, 69, 848-855.

Analytical Chemistry, Vol. 70, No. 20, October 15, 1998 4361

The obvious advantages of such a PCR-CE combination have motivated a number of researchers to investigate the microminiaturization of the PCR process for potential integration in the microfabricated chip format.11-13 By contacting enclosed 12-µL reaction chambers microfabricated in glass to a block heater which cycled between 55 and 94 °C with 135-s cycles, Wilding and coworkers11 were able to obtain effective and reproducible PCR amplification, as judged by removing the PCR product and evaluating it using capillary electrophoresis. Woolley et al.13 accomplished PCR amplification of DNA in a novel microfabricated PCR device that could be directly interfaced with an electrophoretic chip for PCR product analysis. The device contained disposable polypropylene liners to retain the PCR mixture which could be cycled between 55 and 94 °C with 30-s cycles using a polysilicon heater and forced air convection for cooling. The device was interfaced with the electrophoretic chip by forcing it into the holes drilled in the cover plate of the electrophoretic chip. Using this system, they demonstrated the successful amplification of a 286-base pair (bp) fragment from the β-globin gene. Recently, Northrup and co-workers14 designed a portable system containing a miniature analytical thermal cycling instrument in which a silicon-micromachined reaction chamber with integrated heaters and optical windows was used to conduct PCR. However, this particular device was not interfaced with an electrophoretic separation channel, but instead characterization of the amplification product was accomplished by real-time fluorescence monitoring. The challenges associated with integrating PCR into an electrophoretic chip format are not insignificant. To harvest the advantages of the fast separation capabilities of the electrophoretic microchip, the thermocycling procedure and the separation times should be of the same order of magnitude. Additionally, the thermocycling procedure should also be amenable to incorporation into high-throughput electrophoretic chip instrumentation for integrated PCR fragment amplification and analysis. In addition to the significant mismatch of the amplification times in a conventional heating/cooling block instrument (PCR processing times are mostly larger than 1 h) and the rapid electrophoretic analysis achievable on chips, amplification of DNA fragments for detection by this highly sensitive method does not require DNA products in large quantities. These issues led us to search for methods for carrying out PCR in a manner that is not only more rapid and more amenable to small, submicroliter volumes, but also easy to interface with glass electrophoretic chip technology. Reducing the PCR “cycle time” is not a trivial matter. The primary restriction associated with approaches that use a heating/ cooling block in contact with the PCR reaction chamber is the large thermal mass of the heating/cooling block itself, which ultimately limits the rate at which the sample can be heated and cooled. The “noncontact” approach currently utilized in the second generation PCR instruments addresses this issue and has (11) Cheng, J.; Shoffner, M. A.; Hvichia, G. E.; Kricka, L. J.; Wilding, P. Nucleic Acids Res. 1996, 24, 380-385. (12) Northrup, M. A.; Ching, M. T.; White, R. M.; Watson, R. T. Transducers ‘93, 7th International Conference on Solid State Sensors and Actuators, Stockholm, Sweden, 1995; pp 924-927. (13) Woolley, A. T.; Hadley, D.; Landre, P.; deMello, A. J.; Mathies, R. A.; Northrup, M. A. Anal. Chem. 1996, 68, 4081-4086. (14) Northrup, M. A.; Benett, B.; Hadley, D.; Landre, P.; Lehew, S.; Richards, J.; Stratton, P. Anal. Chem. 1998, 70, 918-22.

4362 Analytical Chemistry, Vol. 70, No. 20, October 15, 1998

allowed for a dramatic reduction in amplification times. As a direct result of the rapid cycling procedure, the specificity of the reaction is improved and more PCR product is obtained, as was suggested earlier by Wittwer and co-workers.15 In this report, we describe a noncontact thermocycling approach that should be easily extrapolated to the chip format. We show that thermocycling can be accomplished using an inexpensive infrared (IR) radiation source which allows for rapid temperature ramping and accurate dwelling at elevated (30-96 °C) temperatures. Using glass microchambers, the IR radiation for heating combined with a compressed air source for cooling yielded cycles as short as 17 s and allowed for the PCR amplification of genomic DNA in microliter volume samples. EXPERIMENTAL SECTION Materials. Acrylamide was obtained from Bio-Rad (Hercules, CA). A 5× stock solution of Tris-borate-EDTA (TBE; Sigma Chemicals, St. Louis, MO) was appropriately diluted and titrated to a pH of 8.4 with sodium hydroxide. Dissolution of hydroxyethyl cellulose was accomplished by heating the TBE solution to 56 °C and adding the cellulose powder slowly to the rapidly stirring solution. The turbid solution was mixed on a stirring hot plate until it cleared (about 15 min at a setting of 2 out of 10); the heat was removed, and the mixture was stirred for 1 h. The solution was filtered through an 800-µm filter (Nalgene) and stored at +4 °C. Before use, the HEC solution was brought to room temperature, and 1-(4-[3-methyl-2,3-dihydro(benzo-1,3-oxazole)-2-methylidene]quinolinium)-3-trimethylammonium propane diodide [YOPRO-1] was added (1:1000 dilution of the 1 mM stock solution obtained from the manufacturer) to a final concentration of 1 µM. PCR Amplification. i. T-Cell Receptor β-Chain. For the testing of the IR-mediated thermocycling and comparison with standard thermocyclers [both PCR and quantitative competitive (QC) PCR], the amplification of a fragment of the T-cell receptor β-chain was conducted as described by Johnston et al.16 Each 15-µL reaction consisted of final concentrations of 10 mM TrisHCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, and 20 µM each dNTP (dATP, dCTP, dGTP, and dTTP; Promega, Madison, WI). Included in each reaction were 15 ng each of upstream primer Vb8.2 (CATTATTCATATGGTGCTGGC) and downstream primer CbSeq (GTCACATTTCTCAGATCCTC), 2.4 µL of diluted TaqStart antibody (Clontech, Palo Alto, CA)/Taq DNA polymerase (Promega) mix prepared according to the antibody manufacturer’s recommendations, and 1 µL (approximately 5 ng) of PCR product generated from a TCR-β chain found in a H-Y incompatible graft undergoing rejection. The templates were generated as described in ref 16. Reaction mixtures were stored at 4 °C and warmed to room temperature prior to cycling. ii. PCR Microchambers for Infrared-Mediated PCR. The microchambers for IR-mediated PCR were made from rectangular borosilicate glass stock, 500 µm × 5.0 mm o.d. (Wale Apparatus Co., Hellertown, PA, part no. 4905-100) cut into 13-mm lengths, with one end sealed (total volume about 28 µL). The microchambers were cleaned with sodium ethoxide, rinsed with methanol twice, and air-dried before being coated with bis(trimethylsilyl)trifluoroacetamide (BTMSTFA; Sigma Chemical Co.). After being (15) Wittwer, C. T.; Garling, D. J. Biotechniques 1991, 10, 76-83. (16) Johnston, S. L.; Strausbauch, M.; Sarkar, G.; Wettstein, P. J. Nucleic Acids Res. 1995, 23, 3074-3075.

coated for 30 min, the chambers were emptied, flushed twice with methanol, and air-dried. iii. IR-Mediated Thermocycling. The PCR temperature parameters were controlled through a Labview (National Instruments, Austin, TX) program. The hardware for performing the thermocycling experiments was constructed in-house. Briefly, a thermocouple with an outer diameter of 0.005 in. (Omega, Stamford, CT) was inserted into one of a pair of reaction chambers placed side-by-side in the heating device. The thermocouple regulated the temperature at the limits set through the Labview program, and heating/cooling was switched through a relay. The heater was powered through a dc voltage supply, and the rate of heating was 10 °C/s. Cooling was effected by use of compressed air at room temperature, controlled through a computer-operated solenoid valve. Proportional control was used to maintain the desired temperature. This method of control will vary the magnitude of heat applied to the sample in proportion to the size of the error. If the sample temperature was greater than 4 °C from the programmed temperature, a heat pulse of larger duration was used. If the difference was only 0.2 °C, a heat pulse of shorter duration was used. A Labview application was used to control the temperature limits and the duration of the dwell times of the thermocycling process. In addition, the user had the capability to select a factor that reduces temperature overshoot. A Dell Pentium PC was outfitted with an A/D converter. The A/D board was set up to produce a digital signal of 0-4096, corresponding to a 0-5-V input. The copper/constantan thermocouple was fed to a thermocouple amplifier (model TAC-386-TC, Omega) with an output of 1 mV/ °C. This signal was further amplified by an op amp to produce a signal of 20 mV/°C. The air for cooling was controlled by a digital output from the A/D board in the computer. This TTL level output was fed to a Potter-Brumfield ODCM-5 solid-state relay which controls a 24-V Peter Paul 53HH8DGB pneumatic valve. The air pressure was controlled by a Whitey B-ORF2 panel mount regulating valve. The infrared heat was produced by a General Electric CXR tungsten lamp powered by a 5-V AC transformer. The lamp was modulated by a TTL output from the A/D board via a Potter-Brumfield OACM-5 solid-state relay. Data acquisition was at a rate of 10 Hz. For the experiments with dual thermocouples, temperature readings from a second thermocouple were obtained using the same hardware configuration, and the data were monitored in a separate Labview application. iv. PCR Amplifications in a Commercial Thermocycling Instrument. For TCR-β amplifications, including the QC-PCR, 30 cycles of 30 s of denaturation at 94 °C, 30 s of annealing at 55 °C, and 60 s of extension at 72 °C were carried out. A first cycle included 5 min of denaturation time at 94 °C, and a final cycle included 5 min of extension time at 72 °C. For the cycle sequencing reaction, the reaction mixture was heated at 96 °C for 10 s, 50 °C for 5 s, and 60 °C for 240 s for 25 cycles in a model 9600 GeneAmp PCR system (Perkin-Elmer). v. Cycle Sequencing Reaction. The fluorescent cycle sequencing reactions were carried out using the ABI Prism dRhodamine Terminator Cycle Sequencing Kit according to the manufacturer’s (Perkin-Elmer, Norwalk, CT) instructions. To do this, 500 ng of template DNA was combined with 3.2 pmol of the sequencing primer and 8 µL of Terminator Ready Reaction Mix

in a final volume of 20 µL with sterile, distilled H2O. Reaction mixtures were heated at 96 °C for 10 s, 50 °C for 5 s, and 60 °C for 240 s for 25 cycles on a model 9600 GeneAmp PCR system (Perkin-Elmer). vi. Quantitative Competitive (QC) PCR of Perforin. The amplification of a perforin fragment and a competitor DNA fragment was conducted as described for the T-cell receptor β-chain. Each 15-µL reaction consisted of final concentrations of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, and 20 µM each dNTP (dATP, dCTP, dGTP, and dTTP; Promega). Included in each reaction mixture were 20 pmol each of primer AGCTGAGAAGACCTATCAGG and primer GATAAAGTGCGTGCCATAGG, 2.4 µL of diluted TaqStart antibody (Clontech)/Taq DNA polymerase (Promega) mix prepared according to the antibody manufacturer’s recommendations, and approximately 5 ng of PCR product from a reverse-transcribed and amplified (RTPCR) reaction for mouse perforin and its competitor. Characterization of the QC-PCR product was performed by capillary electrophoresis using conditions described below. Electrophoresis. i. Slab Gel. With the exception of the QC-PCR experiments, all amplification products generated by PCR in a commercial thermocycler and the IR-mediated thermocycling were characterized by slab gel electrophoresis. PCR amplification products and DNA standards were separated on a 3% agarose gel, NuSieve 3:1 agarose (FMC Bioproducts, Rockland, ME), which is a blend of 3 parts NuSieve and 1 part SeaKem LE agarose. Electrophoresis was carried out using a Hoefer HE 33 (Hoefer Pharmacia Biotech, San Francisco, CA) horizontal apparatus at 5.0 V/cm for approximately 40 min in 1× TAE buffer. DNA was visualized by ethidium bromide staining in TAE buffer after electrophoresis and observing the DNA fragments over a shortwavelength UV transilluminator (Fisher Biotech, Pittsburgh, PA). ii. Capillary Electrophoresis. The CE conditions used for analysis of the QC-PCR DNA product involved slight modification of conditions described previously,17 with the exception that the injection method and polarity were modified. Briefly, a 50-µmi.d. × 20-cm-length to detector (27-cm total length) DB-17-coated µ-Sil capillary (J&W Scientific, Folsom, CA) was fitted in a PACE cartridge for use with a Beckman PACE model 2100 CE instrument equipped with a laser-induced fluorescence (LIF) detector with detection at 510 nm. Excitation of the fluorescent intercalator (YO-PRO-1) was induced with a 488-nm argon laser (Beckman Instruments, Fullerton, CA). Sample was diluted 1:50 with water and then injected electrokinetically for 2 s at 3 kV. The sample injection was flanked by 1-s (1 kV) electrokinetic injections of water. The separation was carried out at 7.5 kV (277 V/cm; 9 µA), with the sample injected at the outlet end of the capillary and electrophoresed toward the detector (7-cm effective capillary length) and inlet. RESULTS AND DISCUSSION Efficient PCR amplification of DNA requires the rapid cycling of the PCR mixture between different temperatures. Two physical reaction steps, the denaturation of the template DNA at high temperature (90-94 °C), followed by the annealing of the primer pair to the template at low temperature (35-70 °C), and an enzymatic DNA elongation reaction (70-75 °C) occur very quickly (17) Pancholi, P.; Oda, R. P.; Mitchell, P. S.; Persing, D. A.; Landers, J. P. Mol. Diagns. 1997, 2 (1), 27-38.

Analytical Chemistry, Vol. 70, No. 20, October 15, 1998

4363

but impose a very high demand on the speed and homogeneity of the thermocycling apparatus. The mismatch between the requirements of the kinetics of the PCR reaction and the abilities of some thermocycling instruments have been investigated intensively.15 Using an air thermocycler that allowed for efficient heat transfer to the sample during the cycling process, Wittwer et al.18 demonstrated that fast heat transfer and short cycling times increased the specificity of the PCR amplification reaction. Specificity and yield of the PCR reaction can be improved in three ways. First, since the inherently fast kinetics of the physical reaction steps require only extremely short dwell times, the optimal denaturation and annealing times are less than 1 s. Increased exposure of the PCR components to longer denaturation and annealing times do not yield an increased amplification product but affect the yield adversely.15 Second, the rapid temperature transitions decrease the amount of nonspecific product. Rapid cooling after denaturation of the DNA template and primer pairs favors the kinetics of specific primer annealing over the thermodynamically favored reassociation/dimerization of product or template. Reduced nonspecific amplification, in turn, yields a higher final concentration of product. Finally, the decreased time spent at the high temperature substantially reduces polymerase inactivation, which leads to higher overall enzymatic activity and, consequently, a higher yield.18 The ability to thermocycle rapidly with sharp, accurate temperature transitions is generally limited by the heat transfer rate between the heating/cooling medium. Typical benchtop block heaters/coolers and large sample volumes (>10 µL) in polypropylene centrifuge tubes do not allow a rapid transition from one temperature to another due to their high heat capacity. In contrast, miniaturized heaters and the small sample volumes (nanoliters) cycled on microchips have small heat capacities and more efficient heat transfer rates; therefore, shorter cycle times should be attainable. Accordingly, most reports in the literature describe the thermocycling of PCR mixtures via contact of the vessel/chamber with a miniaturized heating source. These approaches have been exploited in previous attempts to integrate PCR into the chip format.11-13 We initially explored the effectiveness of a contact-mediated approach for thermocycling using a commercially available subminiature proportionally controlled (SPC) heater (Dawn Electronics, Carson City, NV). The SPC heater was chosen on the basis of its features, which include a temperature-sensing bridge, an amplifier, and a power stage, all mounted on a Beryllia substrate and which collectively allow for rapid heating to 120 °C in response to a supply voltage of only +5 V. Initial experiments carried out with the SPC heater (cooling via forced air convection) demonstrated that rapid temperature transitioning could be accomplished (heating at 20 °C/s and cooling at 10 °C/s), resulting in reasonably fast cycle times for transitioning between 96, 58, and 72 °C (dwell at 30 s cycles; (data not shown). However, despite the fact that PCR amplification of DNA could be accomplished, the restrictions dictated by the use of a contact heater on a microchip versus the advantages offered by a noncontact approach (see discussion below) led us to explore other possibilities. Contact versus Noncontact Thermocycling. Contact-mediated thermocycling for PCR has a number of inherent problems (18) Wittwer, C. T.; Fillmore, G. C.; Hillyard, D. R. Nucleic Acids Res. 1989, 17, 4353-4357.

4364 Analytical Chemistry, Vol. 70, No. 20, October 15, 1998

when considering integration of the PCR process into electrophoretic chips. The most obvious of these is thermal mass. Contacting a vessel containing a microliter-scale volume of PCR mixture with a heat source, whether it be a block heater or a SPC heater, adds thermal mass to the assembly which must be heated and cooled during the thermocycling. While Wooley et al.13 illustrate that innovative contact-based heating devices can provide reasonable thermocycling, it is difficult to envision how this embodiment could be integrated into chips in a practical and cost-effective manner. Furthermore, miniaturization of this heating device to accommodate several PCR reactors on a single device for high-throughput applications is challenging. Alternatively, one could consider an approach that would embody the contact heat source as part of the chip instrument and not as part of the electrophoretic chip itself. However, this is fraught with problems, including the dependence of effective heating on efficient contact between the heat source and the electrophoretic chip, and problems associated with moving glass electrophoretic chips to the heat source (or vice versa) in an automated fashion. These considerations combined, we explored other approaches that would allow for effective thermocycling on electrophoretic chips. Early on in the development of thermocyclers, the restrictions inherent to the physical contact between the heat source and the sample vessel were recognized. Consequently, a hot air cycler was developed, in which temperature cycling was effected with small-volume samples without a physical contact between the heat source and the sample.18 This method, which we refer to as “noncontact” thermocycling, utilizes rapidly switching air streams of the desired temperature and transfer of the heat onto either polypropylene tubes or glass capillaries.19 This noncontact method was further improved, and the heating coil in the instrument was replaced by a powerful halogen light bulb.20,21 The bulb irradiates a chamber, the inner surface of which is lined with a lightabsorbing, heat-stable foam, which assists in the heating of the circulating air and, subsequently, the sample tubes. The construction and successful operation of an integrated PCR-CE instrument using an air thermocycler coupled to a DNA purification column and a separation capillary, as reported by Swerdlow et al.,10 demonstrates that noncontact thermocycling is an effective method. This group proposed their system as a large-scale model for future microfabricated integrated systems. However, the control and application of hot air streams on an electrophoretic glass chip may not be easily accomplished without an impact on other structures and possibly other reactions (e.g., enzymatic) to be executed on the chip. Infrared-Mediated Thermocycling and DNA Amplification. After considering a number of noncontact heat delivery systems that would be amenable to chip-based DNA analysis, we converged on the use of an IR radiation heat source possessing the appropriate spectral characteristics to specifically heat the PCR mixture. The concept of using an IR radiation source that would specifically heat the sample without having to heat the medium (19) Wittwer, C. T.; Fillmore, G. C.; Garling, D. J. Anal. Biochem. 1990, 186, 328-331. (20) Wittwer, C. T.; Ririe, K. M.; Andrew, R. V.; Gundry, D. R. A.; Balis, U. J. BioTechniques 1997, 22, 176-181. (21) Wittwer, C. T.; Reed, G. B.; Ririe, K. M. In The polymerase chain reaction; Mullis, K. B., Ferre, F., Gibbs, R. A., Eds.; Birkhauser Publishers: Boston, MA, 1994.

Figure 1. Instrumentation for infrared-mediated thermocycling. (A) Single-microchamber configuration. (B) Dual-microchamber configuration where one chamber acts solely for temperature sensing while the other is used for PCR amplification.

surrounding the vessel or the vessel itself distinguishes this approach from previously described approaches.20,21 A tungsten lamp is an ideal noncontact heat source because it is simple in design, inexpensive, and almost instantaneously reaches very high temperatures (internal lamp temperature of ∼3500 K reached in milliseconds).22 Since the power consumption (heat output) of the lamp is easily regulated, both finely tuned, accurate temperature control and rapid temperature ramping should be possible. Heat transfer problems associated with solid block heaters are basically eliminated with this noncontact approach. This highly efficient heat source can easily be manipulated, e.g., through lenses and a filter system mounted between the tungsten lamp and the PCR apparatus, not only to focus the radiation but also to eliminate wavelengths that could interfere with the PCR reaction. Using glass microchambers fashioned from 500-µm × 5.0-mm rectangular borosilicate glass and tapered on the sealed end to accommodate as little as 5 µL of PCR mixture, a tungsten lamp was used for heating the microchamber from a distance of 2 cm, with cooling facilitated by compressed air at room temperature (Figure 1). Initially, a constantan-copper thermocouple was placed inside the microchamber to monitor the solution temperature and control the thermocycling. Figure 2A shows the thermocycling profiles obtained with 94 °C/54 °C/72 °C dwell times of 30 s /30 s /60 s, resulting in roughly 135-s cycles. Rapid temperature ramping was possible with IR radiation as evidenced by a rate of 10 °C/s and coupled with compressed air cooling of 20 °C/s. With a 300-s precycle heat activation and postcycle extend times, the total thermocycling time under these conditions should be 85 min, comparable to the time for amplification of the T-cell receptor β-chain system in the commercial instrument. The use of the IR radiation and compressed air cooling was remarkably good for temperature maintenance. For the 300-s precycle heat activation time, the temperature variation with the controller set at 94 °C was 93.4 ( 0.5 °C. For the first five cycles in Figure 2A, the temperature variation with the controller set at 94 °C was 93.6 ( 0.3 °C; at 72 °C, the temperature variation was 71.7 ( 0.3 °C; and at 54 °C, the temperature variation was 53.7 ( 0.4 °C. (22) GE operating manual for standard lamps.

Figure 2. Noncontact thermocycling using an IR radiation source as a heat delivery system. (A) 135-s cycles: six exemplary cycles consisting of 30 s at 94 °C, 30 s at 55 °C, and 60 s at 72 °C. (B) 17 s cycles: 30 cycles consisting of 2 s at 94 °C, 2 s at 55 °C, and 4 s at 72 °C. (C) Expanded scale representation of cycles 1-3 and 2830 of (B).

Exploiting the apparent capability for rapid thermocycling, we attempted to decrease the cycle time from the 135 s shown in Figure 2A. With 94 °C/54 °C/72 °C dwell times of 2 s /2 s /4 s, the profile given in Figure 2B shows that 17-s cycles could be attained (Figure 2B). Excellent reproducibility was associated with this ultrafast thermocycling, as evidenced by the average cycle time of 17.0 ( 0.4 s over the course of the 30 cycles. Some exemplary cycles from Figure 2B are shown in Figure 2C with an expanded time scale. The total PCR amplification time associated with 17-s cycles, including precycle activation/ denaturation and postcycle extend times, was roughly 12-14 min. Temperature homogeneity is obviously important in the PCR amplification of DNA since inhomogeneities in the solution temperature can have significant ramifications on the overall efficiency of the PCR.23 To detect any temperature inhomogeneity in the PCR solution during IR-mediated thermocycling, a dualthermocouple configuration was set up. Using a modified Labview program, two thermocouples simultaneously reported the temperature at two different locations in the microchamber [e.g., at the bottom of the microchamber and close to the top of the PCR mixture (data not shown)]. Substantial deviations in local temperatures could be observed when the distance between the PCR mixture and IR source was not optimal. Placing the microchambers at the appropriate focal distance resolved this problem. (23) Burns, M. A.; Mastranglo, C. H.; Sammarco, T. S.; Man, F. P.; Webster, J.; Foerster, B. N.; Jones, D.; Fields, Y.; Kaiser, A. R.; Burke, D. T. Proc. Natl. Acad. Sci. U.S.A. 1996, 93, 5556-5561.

Analytical Chemistry, Vol. 70, No. 20, October 15, 1998

4365

Figure 3. Agarose gel electrophoretic analysis of the PCR amplification of a T-cell receptor β-chain fragment in glass and plastic vessels and in the presence/absence of the thermocouple. The inability to observe the amplification of DNA in the glass microchamber using a commercial thermocycler is not related to the glass microchamber itself (lane 3 vs lane 5) but is due to contact of the thermocouple with the PCR solution (lanes 5 and 6).

Initial evaluation of the IR-mediated thermocycling system for PCR-based amplification of DNA was carried out with genomic DNA model system. Using primers from the upstream region of the T-cell receptor β-chain (TCR-β), initial attempts at executing the PCR process with IR-mediated thermocycling using dwell times of 30 s/30 s/6 s for 94 °C/54 °C/72 °C (300 s each for precycle activation and postcycle extension) resulted in negligible product formation. Since the temperature limits were maintained with good accuracy and there was little apparent cycle-to-cycle variation, this observation was symptomatic of a problem with either (1) the contact of the thermocouple with the PCR solution or (2) the inadequacy of the BTMSTFA-coating for preventing adsorption of the PCR mixture components to the microchamber wall, or (3) both. This problem was interrogated by conducting a series of PCR amplifications in a commercial instrument using the TCR-β system. Amplifications were carried out in our custommade BTMSTFA-coated microchambers as well in standard plastic tubes, each in the presence and in the absence of a thermocouple, the PCR product was evaluated using agarose gel electrophoresis with ethidium bromide staining for visualization of the DNA (Figure 3). Comparison of the electrophoretic results in lanes 2 and 3 (amplification in plastic tubes) with those in lanes 4 and 5 (BTMSTFA-coated microchambers) indicate that PCR amplification of the 216-bp DNA product in the commercial thermocycler is not negatively affected by the use of coated glass vessels. This result ascertained that coating the glass microchambers with BTMSTFA provided adequate surface inactivation for PCR to be carried out. However, comparing amplification in a coated microchamber in the absence (lane 5) and presence (lane 6) of the thermocouple clearly indicates that the PCR failed in the presence of a thermocouple. This result confirmed that the presence of the thermocouple alone, and not the combination of the thermocouple and the inadequate deactivation of the microchambers, caused the inhibition of the PCR reaction. One possible explanation is that the presence of the metal wires inactivated the Taq polymerase enzyme through irreversible adsorption. Frequently, bovine serum albumin (BSA) is added to enzymatic reactions to stabilize enzymes and to reduce undesired adsorption 4366 Analytical Chemistry, Vol. 70, No. 20, October 15, 1998

of proteins on reaction tube walls. A similar approach was suggested by Wittwer and Garling15 for PCR in small volumes to eliminate excessive Taq enzyme denaturation. However, results from other laboratories14 and experimental results described here show that, while the addition of BSA occasionally improves reaction fidelity, it is not necessary if the surface of the reaction chamber is adequately inactivated. Based on the detrimental effect of the thermocouple on the amplification, the configuration shown in Figure 1A was modified to that in Figure 1B, where two microchambers were placed sideby-side in the IR pathwaysone functioned as a temperaturesensing vessel while the other was used for the PCR amplification (Figure 1B). This configuration allowed for monitoring the solution temperature through the “dummy” microchamber without inhibiting the PCR reaction in the sample microchamber. The dual-thermocouple setup described earlier was used to position the microchambers so that both were irradiated equally. Optimal positioning was achieved as reflected by accurate and equivalent temperature cycling in both chambers. Dual-chamber IR-mediated thermocycling was tested by carrying out PCR amplification of the TCR-β primer system. Figure 4A shows the results of thermocycling for 30 cycles, with each cycle roughly 40 s in duration as a result of dwell times of 8 s/8 s/15 s at 94 °C/54 °C/72 °C. The expanded scale (Figure 4B) illustrates that, in addition to good cycle-to-cycle reproducibility, the temperature was maintained with good accuracy at the set temperatures (94.2 ( 0.6 °C; 71.7 ( 0.6 °C; 54.6 ( 0.4 °C). Figure 4C shows the agarose gel electrophoretic analysis of PCRamplified products resulting from the thermocycling shown in Figure 4A and B. The positive control (lane 2), which involved PCR amplification in a glass microchamber using a commercial thermocycler, shows the abundant amplification of a 216-bp DNA product specific to TCR-β. Using the IR-mediated approach to reach 94 °C/54 °C/72 °C with dwell times of 30 s /30 s /60 s (with 300-s precycle activation/denaturation and postcycle extend times), product of a comparable molecular size was observed (lane 4), although at a level approximately 30% of that obtained with the commercial thermocycler (lane 2). It is interesting that the apparent efficiency of amplification does not appear to be altered significantly by reducing the cycle time. Using 94 °C/54 °C/72 °C dwell times of 15 s /15 s /30 s with 300-s precycle activation/ denaturation and postcycle extend times (lane 5), or 8 s /8 s /15 s with 150-s precycle activation/denaturation and postcycle extend times (lane 6), comparable amounts of product are observed, although there is evidence of an increase in the amount of nonspecific product formed with shorter cycle times. Cycle Sequencing Reaction by IR-Mediated PCR. The capabilities of the IR-mediated thermocycling were further explored, and the ability of the novel approach to amplify DNA was tested using other PCR methods. In many laboratories, DNA sequence is determined using a technique known as cycle sequencing. This technique is analogous to asymmetric PCR, in which a single primer, target DNA, thermostable DNA polymerase, and nucleotide substrates are repeatedly heated and cooled to amplify a single strand of the target DNA. In cycle sequencing, the standard four dNTPs are mixed with a small proportion of polynucleotide chain-terminating, dye-labeled dideoxyribonucleotides (ddNTPs) that occasionally substitute for the

Figure 4. IR-mediated noncontact thermocycling using a dual-microchamber configuration. (A) Thermocycling with dwell times of 8 s /8 s /15 s at 94 °C/54 °C/72 °C, resulting in roughly 38 s cycles. (B) Expanded scale representation of the first five cycles in (A). (C) The agarose gel electrophoretic analysis of PCR-amplified TCR-β product as per conditions defined in the figure. Lane 1, DNA fragment standard; lane 2, amplification in a commercial thermocycler; lane 3, negative control; lanes 4-6, IR-mediated thermocycling with different cycle times.

standard dNTPs. Repetitive cycling allows for excess primer to produce increased signal by annealing, extending, and terminating with a constant amount of template in subsequent cycles. The net effect is enhanced sensitivity and longer sequence determinations compared to the same process run isothermally. The major steps in cycle sequencing are, thus, the thermocycling reactions and the electrophoretic separation of the dye-labeled polynucleotide chains terminated by a ddNTP. The sequence is read as a series of fluorescing colored bands (polynucleotide-ddNMP) moving past a detector in the electrophoresis instrument, each base represented by a different color. The control standard used with the ABI DNA sequencing kit (pGEM3ZF+ sequenced with the -21M13 primer) was divided into two aliquots: one aliquot was amplified using a commercial thermocycler and the other by IR-mediated thermocycling (both processes in glass microchambers). The thermocycling parameters used on the commercial instrument (96 °C/50 °C/60 °C with dwell times of 10 s/5 s/240 s and 25 cycles) were also used for the IR-mediated thermocycling. Side-by-side sequencing gel analysis of the amplified products from both reactions showed that comparable results were obtained (data not shown). The dideoxyterminated products obtained with the IR-mediated thermocycling had a high signal-to-noise ratio and normal spacing and provided sequence out to 430 base pairs. The results from the glass microchamber were indistinguishable from those routinely obtained with a standard contact-mediated thermocycler. IR-Mediated Temperature Cycling for Quantitative Competitive PCR. IR-mediated PCR was also applied to quantitative competitive PCR (QC-PCR)24 [the templates for the amplification coming from a QC reverse transcription (RT) PCR experiment], (24) Piatak, M., Jr.; Saag, M. S.; Yang, L. C.; Clark, S. J.; Kappes, J. C.; Luk, K. C.; Hahn, B. H.; Shaw, G. M.; Lifson, J. D. Science 1993, 259 (5102), 17491754.

Figure 5. Rapid capillary electrophoretic analysis of a QC-PCR amplified perforin fragment and competitor DNA fragment using IRmediated thermocycling. Total effective capillary length for CE-LIF analysis was 7 cm. The target perforin DNA is 198 bp, while the competitor is 158 bp in length.

and the PCR products were analyzed by a CE-based method. Briefly, QC-PCR amplification involves an array of PCR reactions where a known amount of a “control” competitor RNA transcript is mixed with an aliquot of an “unknown” target RNA. The competitor and target DNAs are amplified by PCR under identical conditions, and the products are quantitated. The concentration of competitor DNA that would result in an equal molar amount of both competitor and target products is used to deduce the original concentration of the target DNA transcript. Figure 5 shows the results of amplifying such a competitive PCR amplification of a fragment of the mouse perforin gene (198 bp) and its competitor (158-bp fragment) and then separating the products of that reaction on a short (7-cm effective length) capillary with Analytical Chemistry, Vol. 70, No. 20, October 15, 1998

4367

laser-induced fluorescence (CE-LIF) detection. This experiment illustrates that rapid IR-mediated PCR can be easily combined with PCR fragment sizing and identification based on a short (less than 3 min) CE analysis time. The separation of QC-PCR products from the capillary outlet to the inlet provided a rapid analysis of the two amplification products, 135 s for the competitor fragment (158 bp) and 145 s for the target fragment (198 bp). Not only was the utility of the IR-mediated thermocycler demonstrated for another common PCR procedure, competitive PCR reactions, but the analysis of the DNA products on the short capillary approximates the migration distance and analysis times that would be observed for an “on-chip” CE separation. By integration of “on-chip” PCR with “on-chip” CE analysis, very favorable total analysis times could be attained which would greatly facilitate tedious experiments such as competitive PCR reactions which involve several PCR reactions over a wide range of starting competitor and target concentrations. The analysis times for a complete QC-PCR experiment may take days using conventional isotope-labeling, amplification, and detection methodologies. The automation offered by integration of the PCR and DNA detection methods in a chip format would be a great advance for the quantification of the competitor/target DNA combinations required to plot useful data. Integrating IR-Mediated Thermocycling into Other Microscalar Formats. As efforts are focused on integrating PCR into electrophoretic chips,11-13 it becomes clear that the potential to miniaturize the PCR reaction to even smaller scales and to increase the efficiency of the amplification in small volumes is not yet exhausted. The results described in this report, together with the results from laboratories where PCR amplifications are carried out daily, show that PCR in microliter volumes produces more amplification product than absolutely necessary for the analysis by electrophoretic characterization. The very fact that effective PCR amplification with a true exponential increase in product concentration can produce adequate amounts of DNA with as few as 15 cycles from several hundred copies of starting template indicates that extensive cycling is unnecessary. Optimization of the PCR process in submicroliter volumes with a few efficient thermocyles will produce adequate DNA product and, therefore, be amenable to direct interfacing with fast electrophoretic separations on a single chip device. The ability to execute PCR amplification in microliter volume samples using an IR-mediated thermocycling approach that does not require direct heating of the vessel or surrounding medium is an important finding and provides the first step toward realizing PCR on electrophoretic chips in submicroliter volumes. For our experiments in the glass microchambers, the PCR solution was covered by a thin layer of mineral oil to avoid evaporation of liquid. It is obvious that a similar approach for PCR in a microchamber connected to the separation channel in the chip is not a particularly attractive concept. However, our proposed noncontact approach to rapid heating combined with effective cooling by compressed air lends itself to miniaturization, since light can be easily manipulated to focus on structures of different shape and size. Consequently, it will be possible to execute the PCR process in structures that are integral to the architecture of the chip, such as broadened channels and even the electrophoretic separation channel itself. Of course, temperature sensing becomes more 4368 Analytical Chemistry, Vol. 70, No. 20, October 15, 1998

complicated with this scenario and will require some innovative developments. There are a number of other pitfalls that must be circumvented, including the rapid thermocycling-induced expansion and contraction of the fluid in the confined space, bubble formation, diffusion problems, and especially the accurate control of solution temperature. However, preliminary results with IRmediated thermocycling in capillaries25 indicate that PCR in nanoliter volumes is challenging but not impossible. CONCLUSIONS In summary, we have exploited an infrared radiation source in a novel manner to effect the noncontact thermocycling of smallvolume samples in glass microchambers for PCR amplification of target DNA. We have demonstrated the feasibility of shortening the thermocycling time to enable more rapid reaction without severely compromising detectability. Optimization of the reaction should allow for reducing the cycle time to