Letter Cite This: Nano Lett. 2018, 18, 5652−5659
pubs.acs.org/NanoLett
Inhibiting Methicillin-Resistant Staphylococcus aureus by Tetrahedral DNA Nanostructure-Enabled Antisense Peptide Nucleic Acid Delivery Yuxin Zhang,† Wenjuan Ma,† Ying Zhu,‡ Sirong Shi,† Qianshun Li,† Chenchen Mao,† Dan Zhao,† Yuxi Zhan,† Jiye Shi,‡ Wei Li,‡ Lihua Wang,‡ Chunhai Fan,‡ and Yunfeng Lin*,†
Downloaded via UNIV OF SUNDERLAND on October 27, 2018 at 20:27:34 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.
†
State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041, P. R. China ‡ Division of Physical Biology & Bioimaging Center, Shanghai Synchrotron Radiation Facility, CAS Key Laboratory of Interfacial Physics and Technology, Shanghai Institute of Applied Physics, Chinese Academy of Sciences, Shanghai 201800, P. R. China ABSTRACT: One of the biggest obstacles for the use of antisense oligonucleotides as antibacterial therapeutics is their limited uptake by bacterial cells without a suitable carrier, especially in multi-drug-resistant bacteria with a drug efflux mechanism. Existing vectors, such as cellpenetrating peptides, are inefficient and nontargeting, and accordingly are not ideal carriers. A noncytotoxic tetrahedral DNA nanostructure (TDN) with a controllable conformation has been developed as a delivery vehicle for antisense oligonucleotides. In this study, antisense peptide nucleic acids (asPNAs) targeting a specific gene (f tsZ) were efficiently transported into methicillin-resistant Staphylococcus aureus cells by TDNs, and the expression of f tsZ was successfully inhibited in an asPNA-concentrationdependent manner. The delivery system specifically targeted the intended gene. This novel delivery system provides a better platform for future applications of antisense antibacterial therapeutics and provides a basis for the development of a new type of antibacterial drug for multi-drug-resistant bacterial infections. KEYWORDS: Tetrahedral DNA nanostructure, multi-drug-resistant bacteria, antisense peptide nucleic acid, f tsZ, drug delivery system
T
inhibit the expression of bacterial genes; thus, it represents a potential antibacterial therapeutic drug.3,11 Specific asPNAs have been shown to target specific genes and inhibit transcription. However, without an effective vector, few asPNA molecules enter bacterial cells;2,12 the low cellular uptake rate is a major obstacle to their widespread use. A commonly used delivery method is the conjugation of singlestranded asPNA to a cell-penetrating peptide.10 However, these cell-penetrating peptides are limited by their inherent toxicity and immunogenicity to animal cells, lack of cell specificity, difficult biological modifications, and protease sensitivity.13 In addition, some bacteria that acquire resistance via mutations in genes encoding translocation proteins also prevent the uptake of cell-penetrating peptides.5 Hence, there is a need to identify alternative vectors that can deliver asPNA without detrimental effects to normal mammalian cells.3,5,11,14 Advances in nanotechnology have led to the wide use of DNA nanostructures in biomedical fields.15−18 In particular, the self-assembling three-dimensional (3D) DNA tetrahedral
he abuse of antibiotics has led to the continual emergence of clinically resistant strains, especially superbugs, such as multi-drug-resistant bacteria.1 This is a major challenge for the clinical treatment of bacterial infections. Among multi-drugresistant bacteria, methicillin-resistant Staphylococcus aureus (MRSA) represents the most serious threat, as it is resistant to almost all commonly used antibiotics. At present, the most effective antibiotic for the treatment of MRSA is vancomycin, but many clinical isolates of vancomycin-resistant MRSA have been found worldwide.2 Since the mechanism of drug resistance in S. aureus is complicated, there is an urgent need to find new types of antibacterial drugs with different mechanisms of actions from those of traditional antibiotics.3,4 Antisense peptide nucleic acids (asPNAs) are synthetic DNA analogs belonging to the third generation of antisense nucleic acids.5−7 They can specifically inhibit the expression of bacterial genes based on the principle of complementary base pairing. asPNA is not negatively charged, and there is no electrostatic repulsion between DNA and PNA or RNA and PNA, so the stability and specificity of PNA binding are high.8,9 The asPNA sequence requires the pairing of only 10− 18 bases for strong affinity.10 In addition, asPNA is resistant to enzyme degradation. This antisense molecule is widely used to © 2018 American Chemical Society
Received: May 29, 2018 Revised: July 23, 2018 Published: August 8, 2018 5652
DOI: 10.1021/acs.nanolett.8b02166 Nano Lett. 2018, 18, 5652−5659
Letter
Nano Letters Table 1. Base Sequence of Each ssDNA ssDNA
base sequence
Cy5-S1 S1 S2 S3 S4
Cy5-ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA CACGATTCAGACTTAGGAATGTTCGACATGCGAGGGTCCAATACCGACGAT ACTACTATGGCGGGTGATAAAACGTGACTATGTTTGAAATCGACGGGAAGAGCATGCCCATCC ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG
direction 5′ 5′ 5′ 5′ 5′
→ → → → →
3′ 3′ 3′ 3′ 3′
cDNA synthesis kits, and polyvinylidene fluoride membranes were purchased from TaKaRa. Methods. Assembly of the DNA Tetrahedral asPNA Delivery System. TDNs were synthesized as previously reported. The DNA tetrahedral asPNA delivery vehicles were prepared under previously described conditions using four ssDNA and asPNA strands; equimolar concentrations of ssDNA structural oligonucleotides and asPNA strands were mixed in TM buffer (10 mM Tris-HCl, 50 mM MgCl2·6H2O, pH 8.0). The mixture was heated to 95 °C for 10 min and cooled rapidly to 4 °C for 20 min.20,23,25,27−31,37 Characterization of the DNA Tetrahedral asPNA Delivery System. For verification of the successful assembly of P-TDNs, 8% PAGE was used to determine the molecular weights of ssDNA and combinations of two, three, or four strands of ssDNA.27−29 Atomic force microscopy (AFM; SPM-9700 instrument; Shimadzu, Kyoto, Japan) and transmission electron microscopy (TEM; HITACHI HT7700, Tokyo, Japan) were used to confirm the morphology of P-TDNs.38 A 10 μL portion of the synthesized P-TDNs was dripped onto freshly cleaved mica flakes, dried for 15 min, and observed by AFM.39 A 2 μL portion of P-TDNs was dropped on a copper grid, and the samples were dried under infrared radiation for 15 min for examination by TEM. For further verification that asPNA was successfully carried by TDNs, the particle sizes of asPNA and TDNs and ζ potential of asPNA, ssDNA, and PTDNs were determined.39 Bacterial Uptake of Various Concentrations of P-TDNs. For a demonstration that P-TDNs were successfully taken up by bacteria, MRSA was treated with cyanine-5-modified S1 (Cy5-S1), instead of S1 synthetic P-TDNs (Cy5-P-TDNs), and three P-TDN concentrations were evaluated: 250, 500, and 750 nM. Different concentrations of Cy5-P-TDNs were incubated with 1 × 106 CFU/mL MRSA in Luria−Bertani (LB) liquid medium at 37 °C for 12 h with shaking at 50 rpm. Then, SYTO 9 dye was added at a ratio of 100:1 for 15 min, after which the strain was centrifuged and collected, rewashed with PBS three times (12 000 rpm, 5 min), and resuspended in PBS.40 Finally, 10 μL of the sample was added to a slide and covered with a coverslip. After drying, the sample was observed by confocal laser scanning microscopy (A1R MP+; Nikon, Tokyo, Japan). Quantification of P-TDN Uptake into MRSA. MRSA (1 × 106 CFU/mL) was treated with different concentrations of Cy5-P-TDNs (250, 500, 750 nM) and 500 nM Cy5-S1 in a biochemical incubator (37 °C, 12 h, 50 rpm). Then, the samples were collected and rewashed thrice with PBS with centrifugation (12 000 rpm, 5 min). The samples were resuspended in PBS in a flow tube, and the flow tubes were read using a flow cytometer (FC500; Beckman, Urbana, IL).41 Determination of Antibacterial Activity. The asPNA carried by the TDNs was targeted to inhibit the transcription of the bacterial f tsZ gene. The MRSA clinical cultures were grown overnight from a single colony in LB medium at 37 °C.
structure (TDN) has great potential;19−21 it exhibits sequence specificity, excellent biocompatibility, inherent nontoxicity to bacterial and mammalian cells, high biostability, and the potential to precisely control its size and structure, making it a promising therapeutic delivery vehicle.15,16,20,22−29 Moreover, TDNs have excellent potential for biological modification to target specific cells; a wide variety of small functional compounds can be site-specifically attached to TDNs, allowing their cell-specific delivery.16,19,24−28 Previous studies have clearly established the successful use of TDNs to deliver antitumor drugs, aptamers, and other compounds. TDNs are also able to regulate the biological behavior of mammalian cells.20,23,25,27−33 To extend the application of TDNs, in this study, we constructed a vector system for the delivery of asPNA (P-TDNs). Using Watson− Crick base pairing, asPNA targeting a specific gene (f tsZ) was incorporated into TDNs without altering the original structure, size, or excellent vector properties.4 The f tsZ gene encodes FtsZ, a highly conserved protein involved in bacterial cell division.34 It has obvious similarity to the catheter elements of eukaryotic cells in structure and function and has GTPase activity, despite low homology.35 The specific inhibition of bacterial f tsZ using our delivery system does not interfere with the formation of catheter element in animal cells. Many studies have validated FtsZ as a target for antibacterial intervention and have indicated that inhibitors of this protein are suitable for the optimization of new antistaphylococcal therapies.34−36 Compared to our previously reported method for using TDNs to carry functional sequences, our newly developed approach is simpler and less costly. Using this system, asPNA was successfully delivered into methicillin-resistant S. aureus cells, effectively reducing f tsZ expression and thereby inhibiting their growth in a concentration-dependent manner. TDNs were successfully validated as a new type of asPNA delivery vector that can pass through the cell walls of multiple-drugresistant bacteria to reach a specific location. The system has practical applications as a potential new type of antibacterial agent. Materials and Methods. Materials. A methicillin-resistant S. aureus strain (MRSA clinical isolate) was obtained from Beijing Chaoyang Hospital (number 18908). Polyacrylamidegel-electrophoresis-purified single-stranded DNAs (PAGEpurified ssDNAs) (Table 1) with specific sequences designed by our laboratory were obtained from TaKaRa (Dalian, China). The 12-mer f tsZ-asPNA was synthesized by PANAGENE (Daejeon, South Korea). Yeast extract and casein tryptone were obtained from Oxoid (Basingstoke, England). Phosphate-buffered saline (PBS) was purchased from Gibco (Grand Island, NY). Tris-HCl, NaCl, and MgCl2 were obtained from Bio-Rad (Hercules, CA). Paraformaldehyde solution (4% w/v) and absolute ethyl alcohol were purchased from Boster (Wuhan, China). SYTO 9 green fluorescent nucleic acid stain was purchased from Thermo Fisher Scientific (Shanghai, China). PrimeScript RT-PCR kits, 5653
DOI: 10.1021/acs.nanolett.8b02166 Nano Lett. 2018, 18, 5652−5659
Letter
Nano Letters
Figure 1. Characterization of P-TDNs. (A) Diagrammatic sketch of synthesis of DNA tetrahedral asPNA delivery vehicle (P-TDNs). (B) Analysis of relative size of single-stranded DNA, partial assembly, and P-TDNs. Lanes 1 and 2, P-TDNs; lanes 3, 9, and 10, S2 + S3 + S4 + asPNA; lane 4, S3 + asPNA; lane 5, S2; lane 6, marker; lane 7, S3; lane 8, S2 + S3 + asPNA. (C) Atomic force microscope images of P-TDNs (green dotted line). (D) Images of TDNs by transmission electron microscope (yellow dotted line) (n = 3). (E) Dynamic light scattering measurement statistics of the differences of asPNA, P-TDNs. (F) ζ potential analysis of asPNA, ssDNA, and P-TDNs potential difference.
The strains were seeded at an initial density of 3 × 106 CFU/ mL and treated with various concentrations of P-TDNs in a 96-well plate, ensuring that each well had the same volume of culture and the same volume of LB medium. Then, the 96-well plate was placed in a biochemical incubator (37 °C, 24 h). LB medium without P-TDNs was used as a positive control, and nonbacterial culture medium with P-TDNs was used as a negative control.2,41,42 The optical density at 600 nm was measured, and the antibacterial rate was calculated using the following equation:
were obtained over 24 h.13 The OD600 value was measured once every hour, and the plate was shaken once every 15 min. P-TDNs Inhibit the MRSA Mechanism. The strains were grown in LB media and treated with various concentrations of P-TDNs for 12 h. Total RNA from the strains was extracted using an RNeasy Plus Mini kit with a genomic DNA eliminator. The extracted RNA samples were dissolved in RNase-free water, and a cDNA synthesis kit was used for cDNA preparation. Amplification of each target mRNA was performed by qPCR according to the following procedure: an initial activation step at 94 °C for 3 min and 40 cycles of 94 °C for 5 s and 60 °C for 34 s.43−49 A melting curve was generated to test for primer dimer formation and incorrect priming. The amplification of 16s cDNA and that of FMN-binding glutamate synthase cDNA were used as controls to analyze the efficiency of the qPCR experiments. Pure asPNA was used in the control group for comparison with P-TDNs. Statistical Analysis. All experiments were performed in triplicate and reproduced at least three times. Statistical analyses were implemented in Prism 6 (GraphPad, La Jolla, CA). One-way ANOVA was used, and a two-tailed p-value of
