This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes.
Article Cite This: ACS Omega 2019, 4, 6720−6725
http://pubs.acs.org/journal/acsodf
Inhibition of Enterovirus A71 by Selenium Nanoparticles Interferes with JNK Signaling Pathways Yinghua Li, Tiantian Xu, Zhengfang Lin, Changbing Wang, Yu Xia, Min Guo, Mingqi Zhao, Yi Chen, and Bing Zhu* Center Laboratory, Guangzhou Women and Children’s Medical Center, Guangzhou Medical University, No. 318 Renminzhong Road, Yuexiu District, Guangzhou, 510120 Guangdong, China
ACS Omega 2019.4:6720-6725. Downloaded from pubs.acs.org by 5.189.202.31 on 04/12/19. For personal use only.
S Supporting Information *
ABSTRACT: Enterovirus A71 (EV-A71) is the major causative agent of hand, foot, and mouth disease. Currently, there are no effective drugs for EV-A71 infection. Selenium (Se) is a vital nutritional trace element in human body and plays a certain protective role in viral infectious diseases. As a novel Se species, selenium nanoparticles (SeNPs) with their small size and low side effects are attracting increasing attention because of their excellent bioavailability. In this study, SeNPs were synthesized, and their antiviral property was demonstrated in Vero cells. In brief, SeNPs have been demonstrated to inhibit the infection of EV-A71 by thiazolyl blue tetrazolium bromide and cytopathic effect. The reduction of the nucleic acid levels of the virus suggested that SeNPs resisted the proliferation of the EV-A71 virus in Vero cells. In addition, SeNPs effectively reduced the activation of both caspase-8 and caspase-9 induced by the EV-A71 virus. Furthermore, SeNPs downregulated the phosphorylation of Jun amino terminal kinase and inhibited the apoptosis of Vero cells induced by EV-A71. In summary, SeNPs remarkably resisted EVA71 virus-induced apoptosis of Vero cells. Taken together, this study demonstrates that SeNPs are a novel promising therapeutic approach for the treatment of EV-A71 virus infection.
■
INTRODUCTION Enterovirus 71 (EV-A71) is a major causative agent of hand, foot, and mouth disease (HFMD), which frequently infected infants and young children.1−3 Although the clinical manifestations are generally mild and self-limited, HFMD associated with EV-A71 infection can cause serious complications, such as myocarditis, pulmonary edema, acute flaccid paralysis, brainstem encephalitis, and even death.4−8 Since its first isolation in California in 1969,9 outbreaks of HFMD associated with EV-A71 have been frequently reported worldwide in the past decades.10−12 Recently, several major outbreaks of HFMD have been reported in southeastern Asian countries and regions, for example, China,13−16 Malaysia,10 Singapore,17,18 and Korea.19 To date, there are no effective therapeutic drugs against EV-A71. Enterovirus 71 (EV-A71) is a single-stranded positive-sense RNA virus, which belongs to the Enterovirus genus of the family Picornaviridae.20,21 The genome of EV-A71 is about 7400 nucleotides and contains 5′ and 3′ nontranslated regions that are essential for viral RNA replication.22,23 The genome encodes a large precursor protein that is subsequently processed into four structural (VP1, VP2, VP3, and VP4) and seven nonstructural (2A, 2B, 2C, 3A, 3B, 3C, and 3D) proteins.24 Being a close relative of poliovirus, EV-A71 infection may lead to severe neurological diseases and even fatalities.25 As a pathogenic mechanism of EV-A71, the apoptotic pathway may play vital roles in EV-A71 infection.26 Jun amino terminal kinase (JNK) is potently activated by a © 2019 American Chemical Society
variety of environmental stresses including virus infection, and phosphorylation of JNK is a sign of apoptosis.27 Our previous research has demonstrated that JNK signaling pathways participated in the inhibition of cell apoptosis with Se@ ZNV.28 Caspases are a family of cysteine proteases that exhibit important roles in the regulation process of activation of many intracellular proteins involved in apoptosis.29 According to the reports, the EV-A71 virus induces apoptosis of cells, and caspase family is involved in this process.30,31 Selenium (Se) is an important nutritional trace element and plays a crucial role in human health.32 Se takes the form of selenoproteins as a biological function and participates in various physiological functions, such as reactive oxygen species (ROS) elimination32 and specific enzyme modulation,33 and enhances human resistance to disease. The previous reported literature indicated that Se as an antiproliferative agent reduces the incidence of various types of cancers.34−37 Appropriate Se helps to maintain the activity of natural killer cells and facilitates the propagation of T cells, which is important for antiviral immunity.38 Research has shown that deficient in selenium could cause the genome mutation of some RNA virus, influenza virus A, and hepatitis B virus, which lead to multiple changes in the genetic structure related to viral virulence.32,39 In the present study, we investigate whether Received: December 13, 2018 Accepted: April 4, 2019 Published: April 12, 2019 6720
DOI: 10.1021/acsomega.8b03502 ACS Omega 2019, 4, 6720−6725
ACS Omega
Article
Figure 1. Characterization of SeNPs. (A) Tyndall effect in SeNPs. (B) TEM image of SeNPs. (C) EDX of SeNPs. (D) Size distribution of SeNPs in aqueous solutions in 30 days. (E) Stability of SeNPs in aqueous solutions.
selenium nanoparticles (SeNPs) can decrease the apoptosis of Vero cells induced by the EV-A71 virus. The results of this experiment will provide a basis for further study on the mechanism of the SeNP inhibition of EV-A71 infection in vitro.
■
RESULTS AND DISCUSSION Preparation and Characterization of SeNPs. In the present study, a simple method was used to synthesize functionalized SeNPs; several methods were used to characterize the product. The Tyndall effect in SeNPs is shown in Figure 1A, and the results indicated that SeNPs were synthesized. As shown in Figure 1B, the average size of SeNPs was about 100 nm. The morphology of SeNPs in the transmission electron microscopy (TEM) image presented uniform spherical particles. As shown in Figure 1C, energydispersive X-ray (EDX) indicated the presence of the signal of Se and Cu that forms SeNPs and copper grids. To examine the effects of stability and surface properties of SeNPs, we detected the size distribution of SeNPs. As shown in Figure 1D, the average particle size of SeNPs was about 100 nm. Furthermore, Figure 1E shows that the size of SeNPs was stable for at least 16 days. Taken together, the small size of SeNPs contributed to the highly stable nanostructures and made it easy to enter into cells. Cell Viability with SeNPs. The cytotoxic effect of SeNPs on Vero cells was evaluated by the thiazolyl blue tetrazolium bromide (MTT) assay. As shown in Figure 2A, Vero cells infected with the EV-A71 virus showed cell morphological changes, including cytoplasmic shrinkage, loss of cell-to-cell contact, and reduction in cell numbers. These virus-induced cytopathic effects (CPEs) were attenuated by treating with SeNPs. As shown in Figure 2B, the SeNPs slightly inhibited the growth of Vero cells in a dose-dependent manner. The cytotoxic effects of the EV-A71 virus on Vero cells and the protective effects of SeNPs were also examined by the MTT assay. Vero cells treated with the EV-A71 virus showed a cell viability of 59%, as shown in Figure 2C. However, the cell viability was increased to 71% by SeNPs. The result suggests that SeNPs have an effective antivirus activity. The cell viability and images suggested that SeNPs effectively suppressed the EV-A71 virus proliferation. Inhibition of EV-A71 Virus Infection of Vero Cells by SeNPs. The propagation of EV-A71 in SeNP-treated Vero
Figure 2. Effect of SeNPs in Vero cells infected by EV-A71. (A) Cytotoxic effect of Vero cells (Magnification: 40×). (B) Cell viability by the MTT assay. (C) Antiviral activity of SeNPs was measured by the MTT assay; the concentration of SeNPs was 15.625 μM. Bars with different characters are statistically different at the *P < 0.05 or **P < 0.01 level.
cells was also measured by quantitative polymerase chain reaction (Q-PCR). As shown in Figure 3, the level of VP1 mRNA expression was reduced to 19% in the cells exposed to SeNPs. This result was proved that SeNPs exhibit the ability to suppress EV-A71VP1 at the mRNA levels, which may control the fate of Vero cells by the regulation of downstream effectors.
Figure 3. Suppression of VP1 mRNA levels was quantified by Q-PCR. Bars with different characters are statistically different at the **P < 0.01 level. 6721
DOI: 10.1021/acsomega.8b03502 ACS Omega 2019, 4, 6720−6725
ACS Omega
Article
Figure 4. p-JNK, JNK, and EV71 VP1 expression levels of Vero cells treated with SeNPs were evaluated by western blotting; β-actin was used as the loading control. (A) Protein expression of p-JNK, JNK, and EV71 VP1. (B,C) Relative quantitation of p-JNK and JNK.
Figure 5. Inhibition of caspase-8, caspase-9, and caspase-3 activities by SeNPs in EV-A71 infection of cells. Caspase-8 (A), caspase-9 (B), and caspase-3 (C) activities were measured with whole cell extracts by a synthetic fluorogenic substrate. The concentration of SeNPs was 15.625 μM. Bars with different characters are statistically different at the *P < 0.05 or **P < 0.01 level.
Q-PCR data showed that SeNPs had the ability to suppress EV-A71 replication in Vero cells by SeNPs. Activation of JNK-Mediated Signaling Pathways by SeNPs. In this study, the expression of proteins in the JNK signaling pathway was detected by western blotting. As shown in Figure 4A,B, EV-A71 infection upregulates the expression of JNK and p-JNK. On the contrary, they were partly restrained when Vero cells were treated with SeNPs. The EV-A71 VP1 expression was also detected by western blotting. SeNPs decrease the level of EV-A71 VP1. The results indicated that SeNPs can suppress EV-A71-induced JNK upregulations. Inhibition of Caspase-8 and Caspase-9 by SeNPs. In order to confirm the apoptosis pathways, we also tested the activity of caspase-8 and caspase-9 which were central initiators and executioners of the apoptotic process. Briefly, Vero cells were treated with SeNPs after EV-A71 virus infection. Then the activity of caspase-8 and caspase-9 was determined using a detection kit. As shown in Figure 5A, the caspase-8 activity was as follows: control (100%), SeNPs (112%), EV-A71 (192%), and EV-A71 + SeNPs (130%). The caspase-8 activity of Vero cells infected by the EV-A71 virus reached to 192%. The caspase activity of SeNPs was 130% and is significantly lower
than that of EV-A71. As revealed in Figure 5B, the caspase-9 activity was as follows: control (100%), SeNPs (108%), EVA71 (151%), and EV-A71 + SeNPs (120%). The caspase-9 activity of Vero cells infected by the EV-A71 virus reached 151%, while the SeNP group decreased to 120%. As revealed in Figure 5C, the caspase-3 activity was as follows: control (100%), SeNPs (101%), EV-A71 (140%), and EV-A71 + SeNPs (119%). These results indicated that SeNPs inhibited the activity of the EV-A71 virus via inhibition of cell apoptosis mediated by caspase-8, caspase-9, and caspase-3. Taken together, these results support that SeNPs suppressed the apoptosis of EV-A71-induced Vero cells by regulation of caspase and JNK signaling pathway (Figure 6).
■
CONCLUSIONS In conclusion, a simple chemical method for the preparation of SeNPs has been described in this study. SeNPs with lower toxicity exhibit greater ability to prevent the infection of EVA71. SeNPs inhibited the generation of ROS by EV-A71, and then the JNK signaling pathways are inhibited. The molecular mechanisms of the research indicated that SeNPs inhibit 6722
DOI: 10.1021/acsomega.8b03502 ACS Omega 2019, 4, 6720−6725
ACS Omega
Article
transmission electron microscope. The average size distribution of SeNPs was tested via a Malvern Zetasizer Nano ZS particle analyzer (Malvern Instruments Ltd., Malvern, UK). Cell Culture and Virus Infection. Vero cells were cultured in DMEM supplemented with 10% FBS, 100 units/ mL penicillin, and 50 units/mL streptomycin in a humidified incubator with 5% CO2 atmosphere at 37 °C. The 50% tissue culture infective dose (TCID50) of the EV-A71 virus was calculated as previously described.41 Briefly, the Vero cells were seeded into 96-well plates at the density of 4 × 104 cells per well for 24 h. Thereafter, the cells were washed thrice with PBS and infected with EV-A71 for 2 h. After that, the supernatants were removed, and the cells were incubated with DMEM containing 2% FBS. The CPE of the Vero cells was observed via a microscope, and TCID50 was determined using the Reed−Muench method. EV-A71 used in the study was at a final titer of 100 TCID50/mL. Cell Viability with SeNPs. The cytotoxicity of SeNPs was evaluated using the MTT assay as previously reported.42 Briefly, Vero cells were seeded in a 96-well plate and incubated with the EV-A71 virus as mentioned above. Thereafter, the cells were incubated with SeNPs at a final concentration of 15.625 μM at 37 °C for 48 h. After treatment, 20 μL/well of MTT solution was added and incubated for 5 h at 37 °C. Then the culture medium was carefully removed, and 150 μL/well of dimethyl sulfoxide was added to dissolve the formazan dye. The optical density value was detected at 570 nm, and the cytotoxicity of SeNPs against Vero cells was measured. Viral Proliferation with SeNPs. To investigate the inhibition of SeNPs on viral replication in Vero cells, the expression of VP1 was quantitatively determined by the realtime Q-PCR. The primers used in the Q-PCR experiment were as follows: forward primer, 5′ CAAATGCGTAGAAAGGTGGAG 3′; reverse primer, 5′ GGAGCAACTGTGGGACAACT 3′ for VP1; forward primer, 5′ GACTTCGAGCAGGAGATGGG 3′; reverse primer, 5′ CGAGGAAGGAAGGCTGGAAG 3′ for β-actin. Western Blot Analysis. The effects of SeNPs on the expression levels of apoptotic proteins were detected by western blotting as previously reported.43 Briefly, Vero cells were treated with SeNPs for 24 h after EV-A71 infection. Then cells were collected and lysed with RIPA buffer. After that, the total proteins were obtained, and the concentrations were quantified by a BCA protein assay kit. Afterward, equal amount of protein was separated on sodium dodecyl sulfate− polyacrylamide gel electrophoresis, followed by transfer to polyvinylidene difluoride membranes. After being blocked with 5% nonfat milk, the membranes were combined with specific primary antibodies at 4 °C overnight and then incubated with horseradish peroxidase-linked secondary antibody at 37 °C for 1 h. Protein bands were detected using an enhanced chemiluminescence kit. Caspase Activity Assay. Caspase-8, caspase-9, and caspase-3 activities were measured as previously described.29 Briefly, Vero cells infected with the EV-A71 virus were incubated with SeNPs, and the proteins of the cells were extracted as previously mentioned. Equal quality of proteins was mixed with specific caspase substrates in a 96-well plate at 37 °C for 2 h. Caspase activities were detected by fluorescence intensity with the excitation wavelength at 405 nm using a spectrophotometer.
Figure 6. Sketch of JNK and caspase signaling pathways. The concentration of SeNPs was 15.625 μM. The green ribbon represents direct stimulatory modification. The orange ribbon represents direct inhibitory modification.
caspase-8- and caspase-9-mediated apoptosis in EV-A71infected cells. In addition, we found that SeNPs inhibited the apoptosis of Vero cells induced by the EV-A71 virus through the JNK-mediated signaling pathway. Taken together, our findings suggest that SeNPs can effectively protect Vero cells from apoptosis caused by the infection of the EV-A71 virus and it is a prospect selenium species with antiviral properties.
■
MATERIALS AND METHODS Materials. African green monkey kidney epithelial (Vero) cells were obtained from American Type Culture Collection (ATCC, CRL-1586). EV-A71 virus (GenBank accession number FJ439769.1) is a C4 genotype Guangdong strain stored at the Center Laboratory of Guangzhou Women and Children’s Medical Center, Guangzhou Medical University. Fetal bovine serum (FBS), Dulbecco’s modified Eagle medium (DMEM), and phosphate buffered saline (PBS) were obtained from Thermo Fisher Scientific. JNK, p-JNK, and β-actin monoclonal antibody were provided by CST. EV7-A71 VP1 antibody was purchased from Abnova. Na2SeO3, vitamin C (VC), and MTT were purchased from Sigma-Aldrich. Primers of EV-A71 and β-actin were synthetized by Invitrogen, China. One-step RT-PCR kit was acquired from Takara, Japan. The bicinchoninic acid (BCA) protein assay kit, caspase-8 activity assay kit, and caspase-9 activity assay kit were provided by Beyotime, China (caspase substrates including Ac-DEVD-pNA for caspase-3, Ac-IETD-pNA for caspase-8, and Ac-LEHDpNA for caspase-9). Preparation and Characterization of SeNPs. SeNPs were synthesized as previously described.40 Briefly, 0.25 mL of Na2SeO3 (0.1 M) solution was added into 2 mL of freshly prepared VC (50 mM) solution. Then, the mixed solutions were stirred for 30 min at room temperature to prepare the SeNPs. Then, the excess vitamin and Na2SeO3 were eliminated by dialysis overnight. The SeNPs were sonicated and then filtered through a 0.22 μm pore. The SeNP samples were stored at 4 °C. The SeNPs were characterized by a 6723
DOI: 10.1021/acsomega.8b03502 ACS Omega 2019, 4, 6720−6725
ACS Omega
■
Article
(4) Solomon, T.; Lewthwaite, P.; Perera, D.; Cardosa, M. J.; McMinn, P.; Ooi, M. H. Virology, epidemiology, pathogenesis, and control of enterovirus 71. Lancet Infect. Dis. 2010, 10, 778−790. (5) Lee, T.-C.; Guo, H.-R.; Su, H.-J. J.; Yang, Y.-C.; Chang, H.-L.; Chen, K.-T. Diseases caused by enterovirus 71 infection. Pediatr. Infect. Dis. J. 2009, 28, 904−910. (6) McMinn, P.; Stratov, I.; Nagarajan, L.; Davis, S. Neurological manifestations of enterovirus 71 infection in children during an outbreak of hand, foot, and mouth disease in Western Australia. Clin. Infect. Dis. 2001, 32, 236−242. (7) He, S. J.; Chen, D.; Zheng, X. Q.; Wang, C. X.; Huang, A. R.; Jin, Y. M.; Yang, H. M.; Xia, C.; Zhou, A. H.; Wang, X. Three cases of enterovirus 71 infection with pulmonary edema or pulmonary hemorrhage as the early clinical manifestation. Zhonghua Erbi Yanhouke Zazhi 2008, 46, 513−516. (8) Ooi, M. H.; Wong, S. C.; Lewthwaite, P.; Cardosa, M. J.; Solomon, T. Clinical features, diagnosis, and management of enterovirus 71. Lancet Neurol. 2010, 9, 1097−1105. (9) Schmidt, N. J.; Lennette, E. H.; Ho, H. H. An apparently new enterovirus isolated from patients with disease of the central nervous system. J. Infect. Dis. 1974, 129, 304−309. (10) Chan, L. G.; Parashar, U. D.; Lye, M. S.; Ong, F. G. L.; Zaki, S. R.; Alexander, J. P.; Ho, K. K.; Han, L. L.; Pallansch, M. A.; Suleiman, A. B.; Jegathesan, M.; Anderson, L. J. Deaths of Children during an Outbreak of Hand, Foot, and Mouth Disease in Sarawak, Malaysia: Clinical and Pathological Characteristics of the Disease. Clin. Infect. Dis. 2000, 31, 678−683. (11) Wang, J.; Teng, Z.; Cui, X.; Li, C.; Pan, H.; Zheng, Y.; Mao, S.; Yang, Y.; Wu, L.; Guo, X.; Zhang, X.; Zhu, Y. Epidemiological and serological surveillance of hand-foot-and-mouth disease in Shanghai, China, 2012-2016. Emerging Microbes Infect. 2018, 7, 1. (12) Lee, K. Y. Enterovirus 71 infection and neurological complications. Korean J. Pediatr. 2016, 59, 395−401. (13) Zhang, Y.; Tan, X.-J.; Wang, H.-Y.; Yan, D.-M.; Zhu, S.-L.; Wang, D.-Y.; Ji, F.; Wang, X.-J.; Gao, Y.-J.; Chen, L.; An, H.-Q.; Li, D.-X.; Wang, S.-W.; Xu, A.-Q.; Wang, Z.-J.; Xu, W.-B. An outbreak of hand, foot, and mouth disease associated with subgenotype C4 of human enterovirus 71 in Shandong, China. J. Clin. Virol. 2009, 44, 262−267. (14) Fu, Y.; Sun, Q.; Liu, B.; Xu, H.; Wang, Y.; Zhu, W.; Pan, L.; Zhu, L. Epidemiological characteristics and pathogens attributable to hand, foot, and mouth disease in Shanghai, 2008-2013. J. Infect. Dev. Countries 2016, 10, 612−618. (15) Wang, Y.; Feng, Z.; Yang, Y.; Self, S.; Gao, Y.; Longini, I. M.; Wakefield, J.; Zhang, J.; Wang, L.; Chen, X.; Yao, L.; Stanaway, J. D.; Wang, Z.; Yang, W. Hand, Foot, and Mouth Disease in China. Epidemiology 2011, 22, 781−792. (16) Zhang, Y.; Zhu, Z.; Yang, W.; Ren, J.; Tan, X.; Wang, Y.; Mao, N.; Xu, S.; Zhu, S.; Cui, A.; Zhang, Y.; Yan, D.; Li, Q.; Dong, X.; Zhang, J.; Zhao, Y.; Wan, J.; Feng, Z.; Sun, J.; Wang, S.; Li, D.; Xu, W. An emerging recombinant human enterovirus 71 responsible for the 2008 outbreak of hand foot and mouth disease in Fuyang city of China. Virol. J. 2010, 7, 94. (17) Ahmad, K. Hand, foot, and mouth disease outbreak reported in Singapore. Lancet 2000, 356, 1338. (18) Ang, L. W.; Koh, B. K.; Chan, K. P.; Chua, L. T.; James, L.; Goh, K. T. Epidemiology and control of hand, foot and mouth disease in Singapore, 2001-2007. Ann. Acad. Med. Singapore 2009, 38, 106− 112. (19) Koh, W. M.; Bogich, T.; Siegel, K.; Jin, J.; Chong, E. Y.; Tan, C. Y.; Chen, M. I.; Horby, P.; Cook, A. R. The Epidemiology of Hand, Foot and Mouth Disease in Asia. Pediatr. Infect. Dis. J. 2016, 35, e285−e300. (20) Too, I. H. K.; Bonne, I.; Tan, E. L.; Chu, J. J. H.; Alonso, S. Prohibitin plays a critical role in Enterovirus 71 neuropathogenesis. PLoS Pathog. 2018, 14, No. e1006778. (21) Zhu, B.; Xu, T.; Lin, Z.; Wang, C.; Li, Y.; Zhao, M.; Hua, L.; Xiao, M.; Deng, N. Recombinant heat shock protein 78 enhances
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsomega.8b03502.
■
Determination of ROS generation (PDF)
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. Phone: +86 2081330740. Fax: +86 20 81885978. ORCID
Bing Zhu: 0000-0001-7695-6082 Author Contributions
Y.L. and T.X. contributed equally to the work. Y.L. designed the study, analyzed the experimental data, and drafted the manuscript. T.X. carried out the experiments. Z.L. and C.W. participated in its design. Y.X. and M.G. analyzed the data and drafted the manuscript. B.Z. refined the manuscript and coordination. All authors read and approved the final manuscript. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This work was supported by the Guangzhou Medical Health Science and Technology Project (2018A010022), the Technology Planning Project of Guangzhou (201804010183), the Medical Scientific Research Foundation of Guangdong Province (A2018289), the Medical Scientific Research Foundation of Guangdong Province (A2018306), Pediatrics Institute Foundation of Guangzhou Women and Children’s Medical Centre (IP-2018-004), Pediatrics Institute Foundation of Guangzhou Women and Children’s Medical Centre (YIP2018-036), the Science and Technology Planning Project of Guangdong Province (2014A020212024), the Science and Technology Planning Project of Guangdong Province (2015A020211002), and the Medical Science and Technology Project of Guangzhou Municipal Health Bureau (0005559A11105033).
■
ABBREVIATIONS DMEM, Dulbecco’s modified Eagle’s medium; EV-A71, Enterovirus 71; FBS, fetal bovine serum; HFMD, hand, foot, and mouth disease; JNK, Jun amino terminal kinase; MTT, thiazolyl blue tetrazolium bromide; NPs, nanoparticles; PBS, phosphate-buffered saline; Se, selenium; TEM, transmission electron microscopy; VC, vitamin C
■
REFERENCES
(1) A Guide to Clinical Management and Public Health Response for Hand, Foot and Mouth Disease (HFMD); World Health Organization, 2011; pp 1−71. (2) Wang, Q.; Zhang, W.; Zhang, Y.; Yan, L.; Wang, S.; Zhang, J.; Sun, J.; Chang, Z.; Wan, Z. Clinical features of severe cases of hand, foot and mouth disease with EV71 virus infection in China. Arch. Med. Sci. 2014, 3, 510−516. (3) Shah, V. A.; Chong, C. Y.; Chan, K. P.; Ng, W.; Ling, A. E. Clinical characteristics of an outbreak of hand, foot and mouth disease in Singapore. Ann. Acad. Med. Singapore 2003, 32, 381−387. 6724
DOI: 10.1021/acsomega.8b03502 ACS Omega 2019, 4, 6720−6725
ACS Omega
Article
siRNA to induce apoptosis of HepG2 cells. Int. J. Nanomed. 2016, 11, 3065−76. (41) Przybylski, M.; Borysowski, J.; Jakubowska-Zahorska, R.; Weber-Dąbrowska, B.; Górski, A. T4 bacteriophage-mediated inhibition of adsorption and replication of human adenovirus in vitro. Future Microbiol. 2015, 10, 453−460. (42) Yang, F.; Tang, Q.; Zhong, X.; Bai, Y.; Chen, T.; Zhang, Y.; Li, Y.; Zheng, W. Surface decoration by Spirulina polysaccharide enhances the cellular uptake and anticancer efficacy of selenium nanoparticles. Int. J. Nanomed. 2012, 7, 835−844. (43) Zhou, L.; Men, K.; Zeng, S.; Duan, X.; Zhang, X.; Yang, L.; Li, X. Codelivery of SH-aspirin and curcumin by mPEG-PLGA nanoparticles enhanced antitumor activity by inducing mitochondrial apoptosis. Int. J. Nanomed. 2015, 10, 5205−5218.
enterovirus 71 propagation in Vero cells and is induced in SK-N-SH cells during the infection. Arch. Virol. 2017, 162, 1649−1660. (22) Reed, Z.; Cardosa, M. J. Status of research and development of vaccines for enterovirus 71. Vaccine 2016, 34, 2967−2970. (23) Qing, J.; Wang, Y.; Sun, Y.; Huang, J.; Yan, W.; Wang, J.; Su, D.; Ni, C.; Li, J.; Rao, Z.; Liu, L.; Lou, Z. Cyclophilin A associates with enterovirus-71 virus capsid and plays an essential role in viral infection as an uncoating regulator. PLoS Pathog. 2014, 10, No. e1004422. (24) McMinn, P. An overview of the evolution of enterovirus 71 and its clinical and public health significance. FEMS Microbiol. Rev. 2002, 26, 91−107. (25) Huang, H.-I.; Shih, S.-R. Neurotropic Enterovirus Infections in the Central Nervous System. Viruses 2015, 7, 6051−6066. (26) Song, F.; Yu, X.; Zhong, T.; Wang, Z.; Meng, X.; Li, Z.; Zhang, S.; Huo, W.; Liu, X.; Zhang, Y.; Zhang, W.; Yu, J. Caspase-3 Inhibition Attenuates the Cytopathic Effects of EV71 Infection. Front. Microbiol. 2018, 9, 817. (27) Sui, X.; Kong, N.; Ye, L.; Han, W.; Zhou, J.; Zhang, Q.; He, C.; Pan, H. p38 and JNK MAPK pathways control the balance of apoptosis and autophagy in response to chemotherapeutic agents. Cancer Lett. 2014, 344, 174−179. (28) Lin, Z.; Li, Y.; Guo, M.; Xiao, M.; Wang, C.; Zhao, M.; Xu, T.; Xia, Y.; Zhu, B. Inhibition of H1N1 influenza virus by selenium nanoparticles loaded with zanamivir through p38 and JNK signaling pathways. RSC Adv. 2017, 7, 35290−35296. (29) Zhang, Y.; Li, X.; Huang, Z.; Zheng, W.; Fan, C.; Chen, T. Enhancement of cell permeabilization apoptosis-inducing activity of selenium nanoparticles by ATP surface decoration. Nanomedicine 2013, 9, 74−84. (30) Chang, S.-C.; Lin, J.-Y.; Lo, L. Y.-C.; Li, M.-L.; Shih, S.-R. Diverse apoptotic pathways in enterovirus 71-infected cells. J. NeuroVirol. 2004, 10, 338−349. (31) Li, Y.; Lin, Z.; Xu, T.; Wang, C.; Zhao, M.; Xiao, M.; Wang, H.; Deng, N.; Zhu, B. Delivery of VP1 siRNA to inhibit the EV71 virus using functionalized silver nanoparticles through ROS-mediated signaling pathways. RSC Adv. 2017, 7, 1453−1463. (32) Li, Y.; Lin, Z.; Guo, M.; Xia, Y.; Zhao, M.; Wang, C.; Xu, T.; Chen, T.; Zhu, B. Inhibitory activity of selenium nanoparticles functionalized with oseltamivir on H1N1 influenza virus. Int. J. Nanomed. 2017, 12, 5733−5743. (33) Xia, Y.; Xu, T.; Wang, C.; Li, Y.; Lin, Z.; Zhao, M.; Zhu, B. Novel functionalized nanoparticles for tumor-targeting co-delivery of doxorubicin and siRNA to enhance cancer therapy. Int. J. Nanomed. 2017, 13, 143−159. (34) Xia, Y.; You, P.; Xu, F.; Liu, J.; Xing, F. Novel Functionalized Selenium Nanoparticles for Enhanced Anti-Hepatocarcinoma Activity In vitro. Nanoscale Res. Lett. 2015, 10, 1051. (35) Xia, Y.; Guo, M.; Xu, T.; Li, Y.; Wang, C.; Lin, Z.; Zhao, M.; Zhu, B. siRNA-loaded selenium nanoparticle modified with hyaluronic acid for enhanced hepatocellular carcinoma therapy. Int. J. Nanomed. 2018, 13, 1539−1552. (36) Masoumi, K. C.; Massoumi, R. CYLD and SUMO in neuroblastoma therapy. Oncoscience 2016, 3, 3−4. (37) Kumari, M.; Ray, L.; Purohit, M. P.; Patnaik, S.; Pant, A. B.; Shukla, Y.; Kumar, P.; Gupta, K. C. Curcumin loading potentiates the chemotherapeutic efficacy of selenium nanoparticles in HCT116 cells and Ehrlich’s ascites carcinoma bearing mice. Eur. J. Pharm. Biopharm. 2017, 117, 346−362. (38) Ivory, K.; Prieto, E.; Spinks, C.; Armah, C. N.; Goldson, A. J.; Dainty, J. R.; Nicoletti, C. Selenium supplementation has beneficial and detrimental effects on immunity to influenza vaccine in older adults. Clin. Nutr. 2017, 36, 407−415. (39) Cheng, Z.; Zhi, X.; Sun, G.; Guo, W.; Huang, Y.; Sun, W.; Tian, X.; Zhao, F.; Hu, K. Sodium selenite suppresses hepatitis B virus transcription and replication in human hepatoma cell lines. J. Med. Virol. 2016, 88, 653−663. (40) Li, Y.; Lin, Z.; Zhao, M.; Xu, T.; Wang, C.; Xia, H.; Wang, H.; Zhu, B. Multifunctional selenium nanoparticles as carriers of HSP70 6725
DOI: 10.1021/acsomega.8b03502 ACS Omega 2019, 4, 6720−6725
