10450
Biochemistry 1994, 33, 10450-10456
Inhibition of Receptor Binding by High-Affinity RNA Ligands to Vascular Endothelial Growth Factor Derek Jellinek, Louis
S.Green, Carol Bell, and Nebojza JanjiC'
NeXagen. Inc., 2860 Wilderness Place, Boulder, Colorado 80301 Received March 4, 1994; Revised Manuscript Received May 17, 1994"
ABSTRACT: The proliferation of new blood vessels (angiogenesis) is a process that accompanies many
pathological conditions including rheumatoid arthritis and solid tumor growth. Among angiogenic cytokines that have been identified to date, vascular endothelial growth factor (VEGF) is one of the most potent. We used SELEX [systematic evolution of ligands by exponential enrichment; Tuerk, C., & Gold, L. (1990) Science 249, 505-5101 to identify R N A ligands that bind to VEGF in a specific manner with affinities in the low nanomolar range. Ligands were selected from a starting pool of about 1014R N A molecules containing 30 randomized positions. Isolates from the affinity-enriched pool were grouped into six distinct families on the basis of primary and secondary structure similarities. Minimal sequence information required for high-afinity binding to VEGF is contained in 29-36-nucleotide motifs. Binding of truncated (minimal) high-affinity ligands to VEGF is competitive with that of other truncated ligands and heparin. Furthermore, truncated ligands from the six ligand families inhibit binding of [ 1251]VEGF to its cell-surface receptors. Oligonucleotide ligands described here represent an initial set of lead compounds in our ongoing effort toward the development of potent and specific VEGF antagonists.
Neovascularization, or angiogenesis, is the process in which new blood vessels are formed from the existing endothelium in response to stimuli that signal inadequate blood supply. Although it is rare under normal physiological conditions, angiogenesis frequently accompanies certain pathological conditions such as psoriasis, rheumatoid arthritis, hemangioma, diabetic retinopathy, and solid tumor growth and metastasis (Folkman & Klagsbrun, 1987; Folkman, 1990). A number of growth factors that are capable of inducing angiogenesis in vivo have been identified to date including basic and acidic fibroblast growth factors, transforming growth factors cy and p, platelet-derived growth factor, angiogenin, platelet-derived endothelial cell growth factor, interleukin-8, and vascular endothelial growth factor (VEGF,' also known as vascular permeability factor) (Klagsbrun & Soker, 1993). Several recent observations have indicated that VEGF, as a secreted and specific mitogen for endothelial cells, may be one of the major angiogenesis inducers in vivo. For example, the expression of VEGF and its receptors accompanies angiogenesis associated with embryonic development (Breier et al., 1992) and hormonally regulated reproductive cycles (Shweiki et al., 1993). Further, in addition to promoting the growth of vascular endothelial cells and increasing vascular leakage, VEGF also induces several proteolytic enzymes including interstitial collagenase, urokinase-type plasminogen activator, and tissue-type plasminogen activator (Pepper et al., 1991). These observations are highly relevant in deliberating the angiogenic potency of VEGF, in view of the prominent role of these proteases and their regulators in angiogenesis-related extracellular matrix degradation. One of the most serious disorders associated with pathological angiogenesis is tumor growth and metastasis (Folkman, 1990). Nutrient supply and removal of metabolic end products
is often a limiting factor in the growth of aggressive solid tumors, and several recent reports have provided compelling evidence that VEGF may be one of the crucial tumor angiogenesis factors. The expression of VEGF and its receptor is dramatically upregulated in tumor cells adjacent to necrotic areas in vivo, suggesting that VEGF is involved in hypoxiainduced angiogenesis (Shweiki et al., 1992; Plate et al., 1992). It has been shown more recently that interference with the VEGF-VEGF receptor signaling, either with neutralizing antibodies to VEGF (Kim et al., 1993) or through expression of a dominant-negative VEGF receptor mutant (Millauer et al., 1994), inhibits the growth of human tumors in nude mice. These experiments suggest that antagonists of VEGF may be useful for controlling pathological angiogenesis. Specific inhibitors of VEGF are limited at present to monoclonal antibodies (Kim et al., 1993) and the soluble VEGF receptor (Kendall & Thomas, 1993). Random oligonucleotide libraries represent assemblies of diverse molecular features from which rare sequences with unique functional properties can be isolated by selectionamplification (SELEX). It is becoming increasingly clear that SELEX is a powerful and highly versatile tool for discovering high-affinity oligonucleotide ligands to a wide range of molecular targets (Tuerk & Gold, 1990; Tuerk et al., 1992; Ellington & Szostak, 1990, 1992; Bock et al., 1992; Connell et al., 1993; Gold et al., 1993, Jellinek et al., 1993; Jenison et al., 1994). Starting with an initial pool of about 1014RNA molecules randomized at 30 contiguous positions, we used SELEX to identify ligands that bind to VEGF with high affinity and specificity. We demonstrate that these ligands inhibit the initiating step of VEGF signa1ing:binding of the growth factor to specific cell-surface receptors. EXPERIMENTAL PROCEDURES
@Abstractpublished in Aduance ACS Abstracts, July 1, 1994. Abbreviations: HSA, human serum albumin; HUVEC, human umbilical vein endothelial cells; PBS, phosphate-buffered saline; SELEX, systematicevolutionof ligands by exponential enrichment; VEGF, vascular endothelial growth factor.
Materials. Recombinant human VEGF (165 amino acid form; M , = 46 000) was a generous gift from Dr. Napoleone Ferrara (Genentech, S . San Francisco, CA). Low molecular weight heparin ( M , = 5 100) was purchased from Calbiochem
0006-2960/94/0433- 10450%04.50/0 0 1994 American Chemical Society
RNA Ligands to Vascular Endothelial Growth Factor
Biochemistry, Vol. 33, No. 34, I994
10451
Starting RNA: 5'-GGGAGCUCAGAAUAAACGCUCAA[-30N-]UUCGACACCGGC-3'
PCR Primer 1: H i n d 111
------
5'-CCGAAGCT3'AATACG ACTCACTATAGGGAGCTCAGAATAAACGCTCAA-3' T7 Promoter PCR Primer 2: Bam H 1
------
5'-GCCGGATCCGGGCCTCATGTCGAA-3' FIGURE1: Starting RNA and PCR primers used in SELEX. (La Jolla, CA). All other reagents and chemicals were of the highest purity available and were purchased from commercial sources. SELEX. Essential features of the SELEX protocol have been described in detail (Tuerk & Gold, 1990; Schneider et al., 1992). Briefly, DNA templates for in vitro transcription (that contain a region of 30 randomized positions flanked by constant-sequence regions) and the corresponding PCR primers were prepared chemically using established solidphase oligonucleotide synthesis protocols. The random region was generated by utilizing an equimolar mixture of the four nucleotides during oligonucleotidesynthesis. The two constant regions were designed to contain PCR primer annealing sites, a primer annealing site for cDNA synthesis, a T7 RNA polymerase promoter region, and restriction enzyme sites that allow cloning intovectors (Figure 1). The initial pool of RNA molecules was prepared by in vitro transcription of approximately 600 pmol (4 X lOI4 molecules) of the doublestranded DNA template utilizing T7 RNA polymerase (Milligan et al., 1987). Prior to selections, RNA was denatured at 90 OC for 2 min and cooled on ice. Affinity selections were done by incubating VEGF and RNA for 1020 min at 37 "C in phosphate-buffered saline (PBS = 10.1 mM Na2HP04, 1.8 mM KH2P04, 137 mM NaC1, and 2.7 mM KCl, pH 7.4) and then separating the protein-RNA complexes from the unbound species by nitrocellulose filter partitioning (Tuerk & Gold,, 1990). The selected RNA (which typically amounted to 5-10% of the total input RNA) was then extracted from the filters and reverse transcribed into cDNA by avian myeloblastosis virus reverse transcriptase (Life Sciences, St. Petersburg, FL). Reverse transcriptions were done at 48 "C (1 h) in 50 mM Tris buffer (pH 8.3) containing 60 mM NaCl, 6 mM Mg(OAc)2, 10 mM DTT, 0.8 mM deoxynucleoside triphosphates, and 1 unit/pL reverse transcriptase. We amplified the cDNA by PCR as described (Tuerk & Gold, 1990) to produce double-stranded DNA template for the next round of in vitro transcription. Nitrocellulose Filter Binding Assays. Oligonucleotides bound to proteins can be effectively separated from the unbound species by filtration through nitrocellulose membrane filters (Yarus & Berg, 1970; Lowary & Uhlenbeck, 1987; Tuerk & Gold, 1990). Nitrocellulose filters (0.2-pm pore size; Schleicher and Schuell, Keene, NH) were secured on a filter manifold and washed with 4-10 mL of buffer. Following incubation of internally radiolabeled RNA ( [LU-~~PIATP) with serial dilutions of the protein for 10 min at 37 O C in buffer (PBS) containing 0.01% human serum albumin (HSA), the solutions were applied to the filters under gentle vacuum and washed with 5 mL of PBS. The filters were then dried under
an infrared lamp, and the amount of radioactivity was determined by liquid scintillation counting. Equilibrium Dissociation Constants. In the simplest case, equilibrium binding of RNA (R) to VEGF (P) can be described by eq 1, Kd
R-P + R
+P
(1)
where Kd (=[R] [P]/[R.P]) is the equilibrium dissociation constant. From the mass-balance equations, the fraction of bound RNA at equilibrium ( q ) can be expressed in terms of measurable quantities (eq 2),
q = (f/2Rt){Pt
+ Rt + Kd - [(Pt + Rt &I2 - 4PtRt]'/'] (2)
where Pt and Rt are total protein and total RNA concentrations and f reflects the efficiency of retention of the protein-RNA complexes on nitrocellulose filters (Irvine et al., 1991; Jellinek et al., 1993). The average value off for VEGF in our assays was 0.8. Most RNA ligands exhibited biphasic binding to VEGF. For those ligands, binding of RNA to VEGF is described by a model in which the RNA is assumed to be partitioned between two noninterconverting components (RI and R2) that bind to VEGF with different affinities (Jellinek et al., 1993): Kd I
R,-P + R, Kdz
R2.P + R2
+P
(3)
+P
(4)
In this case, the fraction of total bound RNA ( q ) is given by eq 5.
-
4 = Cf/2Rt){2Pt + Rt + Kdl + Kd2 - [(Pt + XIR, + 4PtX1Rt11/2
-
+ X2Rt + Kd2)2- 4PtX2Rtl
1'2)
(5)
where x1 and x2 (=1 - X I )are the mole fractions of R1 and R2, and Kdl and Kd2 are the corresponding dissociation constants. Internally-labeled RNA ligands used for binding studies were prepared by in vitro transcription with T7 RNA polymerase (Milligan et al., 1987) and were purified on denaturing polyacrylamide gels to ensure size homogeneity. All RNA ligands were diluted to about 1 nM in PBS, denatured at 90 OC for 2 min, and then cooled on ice prior to further dilution and incubation with the protein. This denaturation/
10452 Biochemistry, Vol. 33, No. 34, 1994 renaturation cycle, performed at high dilution, is necessary to ensure that the RNA is essentially free from dimers and other higher order aggregates. Concentrations of the stock solutions of VEGF, from which other dilutions were made, were determined from the absorbance readings at 280 nm and the calculated value for €280 of 46 600 M-I cm-I for the VEGF dimer (Gill & von Hippel, 1989). RNA concentrations were calculated from the absorbace readings at 260 nm (Sambrook et al., 1989) and were typically C50 pM in binding reactions. Data sets that define the binding curves were fit to either eq 2 or eq 5 by the nonlinear least squares method with the software package Kaleidagraph (Synergy Software, Reading, PA). Minimal Sequence Determinations. High-affinity VEGF ligands were radiolabeled at the 5'-end with [-p3*P]ATP and T4 polynucleotide kinase or at the 3'-end with 32pCpand T4 RNA ligase for the 3'- and 5'-boundary determinations, respectively. Radiolabeled RNA ligands were subjected to partial alkaline hydrolysis and then selectively bound in solution to VEGF at 5 , 0.5, and 0.125 nM protein before being passed through nitrocellulose filters, and retained oligonucleotides were resolved on 8% denaturing polyacrylamide gels. Partial digests of the 5'- or 3'-labeled RNA ligands with RNAse T I (Boehringer Mannheim Biochemicals, Indianapolis, IN) were used to mark the positions of labeled oligonucleotides ending with a guanosine. Cloning and Sequencing. Individual members of the enriched pool were cloned and sequenced as described (Schneider et al., 1992). Receptor Binding. VEGF was radioiodinated by the Iodogen method (Jakeman et al., 1992) to a specific activity of 2.4 X 104cpm/ng. Human umbilical vein endothelial cells (HUVECs) were plated in 24-well plates at a density of 1-2 X lo5cells/well and grown to confluence in EGM (Clonetics, San Diego, CA) for 24-48 h. At confluence, the cells were washed three times with PBS and incubated for 2 h at 4 'C in serum-free aMEM medium containing '251-labeledVEGF (20 ng/mL) in the presence or absence of unlabeled competitor (VEGF, epidermal growth factor, or RNA). For experiments done with RNA, we included 0.2 unit of placental ribonuclease inhibitor (Promega, Madison, WI) in the medium to ensure that the RNA ligands were not degraded during the course of the experiment. At the end of the 2-h incubation period, the supernatant was removed and the wells were washed two times with PBS. HUVECs were then lysed with 1% Triton X-100/1 M NaOH, and the amount of cell-associated [1251]VEGF was determined by y counting.
Jellinek et al. FAMILY 1 1
ucaaGAG~AUGCU-CAUCCGCACUUGGUGAC~UGACGUU
5 7 9
ucaaGGAGaAUGCCCUAUC~CACCUUGGCCCA
(5)
ucaaGCUUGACGGCCCAUCCGAGCUUGAUCACGC aaacqcucaaUCCUUGAUGCG-GAUCCGAGGAUGGGACGUUu ACACCGSACCUAUJAUGCG-CAUC~CACUU~C aaCCGGUAGUCGCAUGGCCCAUC~GCCCGGuucgac ascucaaGUCAG_CAUGGCCCACCGCGCUUGACGUCUG
46 50
100 107 112
CACGGUUlAUCUJACGUU-CAUC~ACuu&a
119
wucaaGGAGCAG&ACGCA-CAUC~ACUCCAGCGuu
I.../....l....l....I....I..../....I....1 1
5
10
15
20
25
30
35
40
FAMILY 2 24 ( 4 ) 34 102 128
UUCGAAUGCCGAGGCUC--GUGCCUUGACGGGUCGCGAAUGCCGACCACU---CAG=GAUGGGuucq ucaaUGCCGGCCUGA---UCGBGAUGGGmACCG @gGCCGAGC_CCUAAGAGGCUUGAUGUGGu&
27 'UGCGUGCCGAGGuu-
5 ' -aaCCUUGAUGUGGCGCGAACJ 3
5'-aaGCUUGAUGGG=CACACJ GUCAUGCCGAGCuu-3'
44
5'-GUCGUCCUJAUGGGmGUAU'
55 C-GCGCG-3'
I. 1
. . /....I....I....I....I....I....I....I 5
10
15
20
25
30
35
40
FAMILY 3 12 (8) 28 75 ( 2 )
GCAGACGAAGGG-AACCUJGUCUCGGCACCUUCq
--
AAG-G-ANCCUGCGUCUCGGCACUCCGCA
U C ~ ~ G GAACCU~GUUUCGGCACCUUGUUCCGU G-
aaAUGUGGGUUACCUsGUUUCGGCACCACGUuu
137
I.../....I....I....I....I....I....I....I 1
5
10
15
20
25
30
35
40
FAMILY 4 6
CGWUA&AGUCUG~CCCGUCAUCCCCCA
35 40 56 90 106 138
AAA@&CCWUU&AGUCUGUUCCUu
GAC_CCAJCGU_CAACGpUG_AGUCUGU_CC_CGuucqpa+agg gcu_caaccUU&AGUCUGy~UC~UAUCUGAUC uC&ACAGUUG~UUG-AGUCUGLCCCAACUUyu GACCAUGUGACUGGUUG_AGCCUGLCCCAGuu AA.&GUUG-AGUCUGU~C~UAAGAGAGCGC
I...I..../..../....I....I....I....l....I 1
5
10
15
20
25
30
35
40
FAMILY 5 U - C G G ~ U G ~ A G U U G ~ G U A U C C U- -UCC-aa ~ cau aGGGUG_UAGUUGGGACCUA--=CGCCG_UACCuu GGCAUAGUUGG&CCUC--G&CGCCGC ~aaJAGUUG~CCUGU~CGCC~UA~CG
15 20 21 84
RESULTS SELEX. Random RNA used in the initial selection bound to VEGF with an affinity of approximately 0.2 pM. After 13 rounds of SELEX, the observed improvement in affinity of the evolved RNA pool was about 2 orders of magnitude (data not shown). We cloned and sequenced 64 isolates from this evolved pool and found 37 unique sequences (sequences that differed at only one or two positions were not considered unique). Most of the unique sequences (34 out of 37) could be classified into six families on the basis of sequence similarity in the evolved region (Figure 2). Consensus Structures. In addition to allowing determination of the consensus primary structures, groups of similar sequences consisting of members that share a defined functional property often contain useful information for secondary structure analysis. Indeed, comparative analysis has proved to be one of the most powerful tools in elucidating
CaaUACCGGCAUGSAUGUC-CAUC&CUAGCGGUAuucg asGCGUGUUGUG_ACGCA-CAUC~ACGCGCAuu
3 (10)
I...I..../....I..../....l....l....l..../ 1
5
10
15
20
25
30
35
40
FAMILY 6 25
12 6
aGGGGUJCCA -GlGG-AASAC'g.JGCCGCGGCCCuu (2)
aACGGU_v~UASLiG~Gu_cGACU-A-G~~~CG_GCCu
l...l..../....l....l....I..../... 1
5
10
15
20
25
30
FIGURE2: Six families of VEGF ligands showing aligned sequences and predicted secondary structures. Underline arrows indicate regions that are expected to be base paired. Lowercase and uppercase letters distinguish nucleotides in the constant and the evolved sequence regions, respectively. A number in parentheses following the clone number indicates the frequency (when greater than 1 ) with which that sequence was observed in the affinity-enriched pool. Nucleotide positions are numbered consecutively starting with the first uppercase (evolved region) nucleotide from the left in each aligned sequence set.
RNA Ligands to Vascular Endothelial Growth Factor Family 1
Family 5
Family 4
G-c f-’-D 5’
3’
+-p 5’
3’
81 7-Y
P5 ’- 3v
FIGURE3: Consensus sequences and predicted secondary structures for the six families of VEGF ligand. Plain text designates positions that occur at >60% but 80%) are outlined (family 6 consistsof only two sequences).A residue in parentheses occurs at that position at the same frequency as a gap. Nucleotide positions are numbered as they appear in Figure 2. In cases where numbering in the consensus structures is not consecutive (due to consensus gaps), the numbering of the flanking nucleotides is shown. R = A or G; Y = C or U; K = G or U; M = A or C; S = G or C; D = A, G, or U; H = A, U, or C; V = G, A, or C; N = any base; a prime (’) indicates a complementary base.
secondary structural elements of RNA (Fox & Woese, 1976; James et al., 1988; Gutell et al., 1992; Woese & Pace, 1993). The underlying assumption is that ligands with similar sequences are capable of adopting similar secondary structures in which the conserved residues are organized in unique, welldefined motifs. In this context, ligands with strong, unambiguous secondary structures can provide good structural leads for other sequences within a similar sequence set where consensus folding may be less obvious. Conserved elements of secondary structure, such as base pairing, may be detected through covariation analysis of aligned sequence sets (James et al., 1988; Gutell et al., 1992; Woese & Pace, 1993). The predicted consensus secondary structures for the six sequence families are shown in Figure 3. The most highly conserved residues in the family 1 sequence set (A17, G19, and the CAUC sequence at positions 23-26) are accommodated in the 9-1 0-nucleotide loop. Base-pairing covariation between positions 16 and 27 (G-C occurs with a frequency of 8/11, or 8 out of 11 times, and C-G, with a frequency of 3/1 l), positions 15 and 28 (U-G, 7/11; G-C, 3/11; U-A, 1/1 l), and positions 14 and 29 (G-C, 5/11; U-A, 2/ 1 1; C-G, 1/ 1 1) supports the predicted secondary structure (Figure 2). It is worth noting that many ligands in this family have stable, extended stems that contain up to 15 base pairs.
Biochemistry, Vol. 33, No. 34, 1994
10453
In the family 2 sequence set, the strongly conserved UGCCG and UUGAUG(G/U)G sequences (positions 8-12 and 2633) are circularly permuted (Figure 2), a feature observed previously in other SELEX experiments (Jenison et al., 1994; Tuerk et al., 1994). In the consensus secondary structure, the conserved nucleotides are found in an identical arrangement within or adjacent to the asymmetrical internal loop (Figure 3). This result strongly suggests that nucleotides outside of the consensus motif shown in Figure 3 are not important for binding (vide infra). Base-pairingcovariation is noted between positions 5 and 36 (C-G, 2/7; G-C, 2/7; U-A, 1/7; G-U, 1/7), 6 and 35 (A-U, 4/7; C-G, 1/7; G-C, 1/7), 7 and 34 (A-U, 4/7; G/C, 1/7), 11 and 28 (C-G, 6/7; G-C, 1/7), 12 and 27 (G-U, 6/7; C-G, 1/7), 13 and 26 (A-U, 5/7; G-C, 1/7; G-U, 1/7), 14 and 25 (G-C, 4/7; C-G, 2/7), and 15 and 24 (C-G, 4/7; G-C, 2/7). Family 3 and family 4 sequence sets are characterized by contiguous stretches of 21 (GGGAACCUGCGU(C/U)UCGGCACC, positions 11-3 1) and 15 (GGUUGAGUCUGUCCC, positions 15-29) highly conserved nucleotides arranged in bulged hairpin motifs (Figure 3). Base-pairing covariation is detected in family 3 between positions 8 and 33 (A-U, 2/4; G-C, 2/4), 9 and 32 (A-U, 2/4; U-A, 1/4; G-C, 1/4), and 10 and 31 (A-U, 1/4; G-C, 3/4) and in family 4 between positions 13 and 3 1 (A-U, 4/7; C-G, 2/7; U-A, 1/7) and 14 and 30 (C-G, 3/7; U-A, 3/7; A-U, 1/7). The family 5 consensus secondary structure is an asymmetrical internal loop where the conserved UAGUUGG (positions 9-15) and CCG (positions 29-3 1) sequences are interrupted by less conserved nucleotides (Figure 3). Modest base-pairing covariation is found between positions 8 and 32 (A-U, 2/4; U-G, 1/4), 16 and 26 (G-C, 2/4; A-U, 1/4), 17 and 25 (A-U, 2/4; G-C, 1/4), and 18 and 24 (C-G, 2/4; G-C, 1/4)* Family 6 has only two sequences, and therefore the concept of consensus sequence or consensus secondary structure is less meaningful. Nevertheless, the two sequences are very similar (90% identity) and can be folded into a common bulged hairpin motif (Figure 3). Base-pairing covariation is found between positions 1 and 32 (A-U, 1/2; G-U, 1/2), 2 and 31 (C-G, 1/2; G-C, 1/2), 14 and 20 (U-A, 1/2; G-C, 1/2), and 15 and 19 (A-U, 1/2; G-U, 1/2). Affinities. The affinity of all unique ligands for VEGF was first examined in a screening manner by determining the amount of RNA bound to VEGF at two protein concentrations (1 and 10 nM). Binding of the best ligands from each of the six sequence families was then analyzed over a rangeof protein concentrations (Figure 4). Dissociation constants were calculated by fitting thedata points to either eq 2 (monophasic binding) or eq 5 (biphasic binding), and their values are shown in Table 1. Minimal Ligands. In order to determine the minimal sequences necessary for high-affinity binding to VEGF, we performed deletion analyses with representative ligands from each of the six families. In these experiments, ligands are radiolabeled at either the 3’-end or the 5’-end (for the 5’- or 3’-boundary determinations, respectively), followed by limited alkaline hydrolysis, partitioning of the free and the proteinbound RNA, and analysis of the hydrolytic fragments that retained high affinity for VEGF on denaturing polyacrylamide gels (Tuerk et al., 1990). In each experiment, the smallest radiolabeled oligonucleotide bound by VEGF at the lowest protein concentration represents the information boundary. The combined results from the 3’- and 5’-boundary experiments define the minimal ligand (Figure 5). It is important to
Jellinek et al.
10454 Biochemistry, Vol. 33, No. 34, 1994
B
A
1 2 3 4 5
1 2 3 4 5 5'
3'
fi
A c C
a
9 ' =U
+c G
U
A A G G G A A
c c A
c G G
c U -2
-1
0
1
2
3 -2
-1
0
1
2
3
G A
c
c c U
logl ,[vEGFl?n M FIGURE4: Binding curves for a representative set of high-affinity ligands to VEGF. Full-length (0)and truncated (A)ligands tested were 100 and lOOt (family 1, panel A), 44 and 44t (family 2, panel B), 12 and 12t (family 3, panel C), 40 and 40t (family 4, panel D), 84 and 84t (family 5, panel E), and 126 and 126t (family 6, panel F). The fraction of 32P-labeled RNA bound to nitrocellulose filters is plotted as a function of total protein concentration, and the lines represent the fit of the data points to eq 2 (ligand 40t) or to eq 5 (all other ligands). Each data point is an average of two independent determinations. RNA concentrations were determined from their absorbance reading at 260 nm (typically
