Injectable Polypeptide Thermogel as a Tissue Engineering System for

52 Ewhayeodae-gil, Seodaemun-gu, Seoul 03760, Korea. ACS Appl. Mater. Interfaces , 2017, 9 (13), pp 11568–11576. DOI: 10.1021/acsami.7b02488. Pu...
3 downloads 11 Views 4MB Size
Download PDF
Research Article www.acsami.org

Injectable Polypeptide Thermogel as a Tissue Engineering System for Hepatogenic Differentiation of Tonsil-Derived Mesenchymal Stem Cells Ja Hye Hong, Hyun Jung Lee, and Byeongmoon Jeong* Department of Chemistry and Nanoscience, Ewha Womans University, 52 Ewhayeodae-gil, Seodaemun-gu, Seoul 03760, Korea ABSTRACT: A poly(ethylene glycol)-b-poly(L-alanine) (PEG-L-PA) hydrogel incorporating tonsil-derived mesenchymal stem cells (TMSCs), tauroursodeoxycholic acid (TUDCA), hepatocyte growth factor (HGF), and fibroblast growth factor 4 (FGF4) was prepared through thermal gelation of an aqueous polymer solution for an injectable tissue engineering application. The thermal gelation accompanied conformational changes of both PA and PEG blocks. The gel modulus at 37 °C was controlled to be 1000 Pa by using a 14.0 wt % aqueous polymer solution. The gel preserved its physical integrity during the 3D culture of the cells. TUDCA, HGF, and FGF4 were released from the PEG-L-PA hydrogel over 21 days of the 3D cell culture period. TMSCs initially exhibited a spherical shape, whereas some fibers protruded from the cells on days 14−21 of 3D culture. The injectable system exhibited pronounced expressions of the hepatic biomarkers at both mRNA and protein levels, which are significantly better than the commercially available hyaluronic acid gel. In particular, the hepatogenically differentiated cells from the TMSCs in the injectable system demonstrated hepatic biofunctions comparable to HepG2 cells for the uptakes of low density lipoproteins (52%) and indocyanine green (76%), and the production of albumin (40%) and urea (52%), which are also significantly better than the 3Dcultured cells in the commercially available hyaluronic acid gel. Our studies suggest that the PEG-L-PA thermogel incorporating TMSCs, TUDCA, and growth factors is highly promising as an in situ forming tissue engineering system. KEYWORDS: thermogel, hepatogenic differentiation, TMSC, 3D culture, injectable tissue engineering

1. INTRODUCTION Various biochemical processes occur in the liver in which hepatocytes are the cells of major parenchymal tissue of the liver, consisting of more than 70% of the liver mass.1 Hepatocytes are involved in important biofunctions such as syntheses of proteins, cholesterol, and bile salts, regulation of glycogen storage, detoxification of exogenous substances, and metabolisms of carbohydrates, fats, and proteins.2 Therefore, liver can be considered to be a very important organ. However, liver transplantation is a main option for irreversible liver failure.3 Stem cells have been drawing attention as a promising therapeutic agent for liver failure due to the potential for hepatic differentiation, immunological tolerance, hematopoiesis, and secretion of pro-regenerative factors.4−6 However, stem cell therapy should also overcome several problems including (1) limited numbers of stem cells and stem cell resources, (2) a low survival rate of exogenously injected stem cells, (3) disappearance of the stem cells at the injection site or target site, and (4) limited differentiation into hepatocytes.7,8 To overcome these issues, we are reporting an injectable thermogelling system incorporating tonsil-derived mesenchymal stem cells (TMSCs) as well as various soluble factors. TMSCs are recovered from tonsil tissues after tonsillectomy. Tonsil tissues have been wasted. However, it was found that the tonsil tissues have 10−100 times higher in stem cell density than bone marrow.9,10 TMSCs exhibit multilineage differ© 2017 American Chemical Society

entiation characteristics and immunosuppressive properties, similar to other MSCs.9−16 Thermogels are aqueous polymer solutions that undergo heat-induced gelation, which provides an implant in situ in a minimally invasive manner. Therefore, thermogels have been widely researched for drug delivery, tissue engineering, wound dressing, and postsurgical adhesion prevention.17−28 Stem cells and soluble factors can be incorporated into the gel by the heatinduced gelation of the aqueous polymer solution containing the cells and soluble factors. Then, the gel acts as a 3D scaffold for the stem cells where the incorporated factors are continuously supplied for the cells.29,30 In particular, a combined use of HGF and FGF4 can synergistically act to promote hepatogenic differentiation of stem cells.29 TUDCA is also an effective compound for hepatogenic differentiation of stem cells.31 We used thermogelling polypeptide of poly(ethylene glycol)-poly(L-alanine) (PEG-L-PA). Physicochemical properties of the thermogel were characterized, and hepatogenic differentiation of TMSCs was studied by following 4 protocols to see the combined effect of the above hepatogenic soluble factors. PEG-L-PA thermogel incorporating TMSCs (Protocol P), PEG-L-PA thermogel incorporating TMSCs and TUDCA (Protocol PT), PEG-L-PA thermogel incorporating Received: February 20, 2017 Accepted: March 14, 2017 Published: March 14, 2017 11568

DOI: 10.1021/acsami.7b02488 ACS Appl. Mater. Interfaces 2017, 9, 11568−11576

Research Article

ACS Applied Materials & Interfaces

temperature increased to 37 °C, the aqueous polymer solution containing the drugs turned into a gel. After 5 min of equilibration time at 37 °C, PBS (3.0 mL) at 37 °C was added to the gel. Triplicate experiments were carried out. All the medium (3.0 mL) was replaced at the sampling interval. The released amount of growth factors of HGF and FGF4 was quantified by HGF and FGF4 ELISA Kits (Abcam, U.S.A.). The released amount of TUDCA was assayed by high performance liquid chromatography system (HPLC; Waters 1525B, U.S.A.) with photodiode detector (Waters 2998, U.S.A.). The ammonium phosphate monobasic (10 mM) aqueous solution containing 0.3% (v/v) acetic acid/acetonitrile (19/8, v/v) (mobile phase) and Jupiter 5 μm C18 300A LC column (5 μm, 4.6 × 250 mm2) were used for the HPLC. 2.11. 3D Cell Culture. TMSCs recovered from an 11-year-old female donor were kindly donated from the Ewha Womans University Mokdong Hospital (Seoul, Korea).9 Five protocols including HTG were investigated in this study. Protocol P: Passage-six TMSCs were suspended in an aqueous polymer solution (14.0 wt %, 0.2 mL) of serum-free Iscove’s modified Dulbecco’s Medium (IMDM, Hyclone, U.S.A.) with a final cell density of 2.2 × 106 cells/mL. The 3D matrix incorporating stem cells was prepared by increasing the temperature to 37 °C. The medium was replaced every third day for the 3D culture. Protocol PT: TUDCA (1 mg/mL, 2 μL) was added to the protocol P. Protocol PG: HGF (10 μg/mL, 8 μL) and FGF4 (25 μg/mL, 4 μL) were added to the protocol P. Protocol PTG: TUDCA (1 mg/mL, 2 μL), HGF (10 μg/mL, 8 μL) and FGF4 (25 μg/mL, 4 μL) were added to the protocol P. Protocol HTG: Passage-six TMSCs were mixed with Hystem cell culture scaffold (Sigma, U.S.A.) (0.2 mL) containing TUDCA (1 mg/ mL, 2 μL), HGF (10 μg/mL, 8 μL), and FGF4 (25 μg/mL, 4 μL) with a density of 2.2 × 106 cells/mL according to the protocol. In brief, a thiol-modified hyaluronan and carboxymethyl hyaluronic acidthiopropanoyl hydrazide was dissolved in degassed water and then TMSCs, TUDCA, HGF, and FGF4 were added, then polyethylene glycol diacrylate (PEGDA, Mw 3400g/mol) was added. 0.2 mL of the Hystem scaffold mixture was injected into the well. Gelation was achieved within 20 min at room temperature. Then, the serum-free IMDM was replaced every third day. For all five protocols of P, PT, PG, PTG, and HTG, the encapsulated cells were 3D-cultured under 5% CO2 conditions at 37 °C. 2.12. Cell Proliferation. Viability and morphology of TMSCs were assayed by the Live/Dead kit (Molecular Probes, Life Technologies, U.S.A.) using ethidium homodimer-1 (EthD-1; 4.0 μM) and calcein AM (2.0 μM) in PBS. 2.13. RNA Extraction and Real-Time Reverse Transcription Polymerase Chain Reaction. mRNA was extracted from the cellencapsulated hydrogel by using a TRIZOL reagent (Invitrogen, U.S.A.).15 The mRNA concentration was assayed by a Nano Drop 2000 spectrophotometer (Thermo Scientific, U.S.A.). Relative expression levels of target genes assayed by RT-PCR and were normalized by glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) (housekeeping gene) and the data at the 0th day.14,15 The primers are listed in the table (Table 1). 2.14. Immunofluorescence Study. After 21 days of 3D culture of the TMSCs under hepatogenic conditions in each protocol, bovine serum albumin (ALB) and HNF4a were assayed by an immunofluorescence spectroscopy according to the manufacturer’s protocol.14,15 The nucleus and actin were also stained with 4′,6-diamidino-2phenylindole (DAPI) (Molecular probes, U.S.A.) and phalloidin (Molecular Probes, U.S.A.), respectively. 2.15. Metabolic Function. Biofunctions of the hepatogenically differentiated cells from TMSCs in PTG and HTG systems for 21 days were compared with HepG2 cells for the uptakes of indocyanine green (ICG) and low-density lipoproteins (LDL), and production of ALB and urea.15 In this case, HepG2 cells were 2D-cultured with a density of 0.44 × 106 cells/well using the DMEM supplemented with 10%

TMSCs and growth factors (HGF and FGF4) (Protocol PG), and PEG-L-PA thermogel incorporating TMSCs, TUDCA, and growth factors (HGF and FGF4) (Protocol PTG). In addition, a commercially available Hystem cell culture scaffold incorporating TMSCs, TUDCA, and growth factors (HGF and FGF4) (Protocol HTG) was also studied for comparison. For all five protocols of P, PT, PG, PTG, and HTG, the encapsulated cells in the hydrogel were 3D-cultured for 21 days and hepatic biomarker expressions were compared. In particular, hepatic biofunctions of the differentiated cells from the TMSCs in PTG and HTG were compared with HepG2 cells.

2. EXPERIMENTAL SECTION 2.1. Chemicals. N-carboxy anhydrides of L-alanine (Onsolution, Korea), α-amino-ω-methoxy-poly(ethylene glycol)s (PEG) (Mn = 2000 Da) (Pharmicell, Korea), anhydrous N,N-dimethylformamide (Sigma-Aldrich, U.S.A.), and diethyl ether (Daejung, Korea) were used as received. Recombinant human HGF and recombinant human FGF4 were used as received from Peprotech, Korea. Tauroursodeoxycholic acid (TUDCA, TCI, Japan) was used as received. Fetal bovine serum, penicillin, streptomycin were used as received from Hyclone, U.S.A. Chloroform and toluene purchased from Daejung, Korea were dehydrated by magnesium sulfate and sodium, respectively. 2.2. Synthesis of PEG-L-PA. PEG-L-PA was synthesized by the published method.32 The final yield was about 67%. 2.3. NMR Spectroscopy. NMR spectrophotometer (500 MHz NMR spectrometer; Varian, U.S.A.) was used to calculate the composition and molecular weight (Mn) of the polymers by 1H NMR spectra of the polymer in CF3COOD. 1H NMR spectra of the PEG-L-PA (14.0 wt % in D2O) were also studied at various temperatures to understand thermal gelation behavior at the molecular level. 2.4. Gel Permeation Chromatography. The molecular weight and molecular weight distribution of the polymers against PEGs (Polysciences, U.S.A.) standards were obtained by using a gel permeation chromatography (GPC) system (SP930D, Younglin, Korea). 2.5. UV−vis Spectroscopy. UV−vis spectra of the 1,6-diphenyl1,3,5-hexatriene (4.0 μM) dissolved in aqueous polymer solutions of 0.005, 0.01. 0.03, 0.05, 0.07, 0.1, 0.3, 0.5, and 0.7 wt % were recorded by using a UV−vis spectrophotometer instrument (S-3100, SCINCO, Korea) at room temperature (15 °C). 2.6. Circular Dichroism Spectroscopy. Ellipticity of the PEG-LPA aqueous solution was recorded by the circular dichroism (CD) spectrophotometer (J-810, JASCO, Japan) at 0.005, 0.01. 0.03, 0.05, 0.07, 0.1, 0.3, 0.5, and 0.7 wt % at 15 °C, and the ellipticity of the aqueous polymer solution (0.1 wt %) was recorded in a temperature range of 5−65 °C. 2.7. Phase Diagram. The sol−gel transition phase diagram was constructed by the test tube inverting method as the temperature was increased by 1 °C per step.14,15,19,26,32 N = 3. 2.8. Dynamic Mechanical Analysis. Storage (G′) and loss (G″) modulus of a PEG-L-PA aqueous solution (14.0 wt %) were studied by a rheometer (Rheometer RS 1; Thermo Haake, U.S.A.) as a function of temperature under conditions of 4.0 dyn/cm2 (stress) and 1.0 rad/s (frequency). 2.9. FTIR Spectroscopy. The FTIR spectrum of a PEG-L-PA aqueous solution (14.0 wt % in D2O) was studied as a function of temperature by the FTIR spectrophotometer FTS-800; Varian, U.S.A. 2.10. Drug Release. Aqueous solutions of TUDCA (10 mg/mL), HGF (10 μg/mL), and FGF4 (25 μg/mL) in phosphate buffered saline (PBS: 150 mM, pH 7.4) were prepared. The solutions of TUDCA (300 μL), 20 μL (HGF), and 10 μL (FGF4), respectively, were added to the PEG-L-PA aqueous solution (0.5 mL) to prepare the aqueous polymer solution (14.0 wt %) incorporating drugs. Therefore, the doses for the drug release system were 3.0 mg, 200 ng, and 250 ng for TUDCA, HGF, and FGF4, respectively. As the 11569

DOI: 10.1021/acsami.7b02488 ACS Appl. Mater. Interfaces 2017, 9, 11568−11576

Research Article

ACS Applied Materials & Interfaces Table 1. Primer Sequences and PCR Conditions for Real Time RT-PCR genes ALB CK-18 HNF 4a G6P CYP7A1 HNF 3b GAPDH

primer sequences

annealing temp. (°C)

F: 5-GTGAGGTTGCTCATCGGTTT-3′ R:5′-GAGCAAAGGCAATCAACACC-3′ F: 5′-GACATCCGGGCCCAATATGA-3′ R: 5′-CACTGTGGTGCTCTCCTCAA-3′ F: 5′-AGCAACGGACAGATGTGTGA-3′ R: 5′-TCAGACCCTGAGCCACCT-3′ F: 5′-AGTTGTTGCTGGAGTCCTGTC-3′ R: 5′-GGCTGGCATTATAGATGCTGT-3′ F: 5′-CGGACAGCTAAGGAGGATTTC-3′ R: 5′-GTCAAAGGGTCTGGGTAGATTT-3′ F: 5′-ACAGAGGGCCACACAGATA-3′ R: 5′- GCTTGAAGAAGCAGGAGTCTAC −3′ F: 5′- CTCCTCACAGTTGCCATGTA −3′ R: 5′-GTTGAGCACAGGGTACTTTATTG-3′

55.5 54.8 57.1 57.0 56.6 58.2 57.2 55.1 52.4 45.5 52.6 50.0 54.5 53.9

a

ALB, CK-18, HNF 4a, G6P, CYP7A1, HNF 3b, and GAPDH indicate albumin, cytokeratin-18, hepatocyte nuclear factor 4 alpha, glucose 6phosphatase, cytochrome P450 family 7 subfamily A member 1, hepatocyte nuclear factor 3 beta, and glyceraldehyde 3-phosphate dehydrogenase, respectively. F and R indicate forward and reverse primers, respectively.

Figure 2. (a) Phase diagram of PEG-L-PA aqueous solutions. The transition temperatures were determined by the test tube inverting method. N = 3. (b) Modulus of PEG-L-PA aqueous solution (14.0 wt %) as a function of temperature.

glycol (CH2CH2O) peak of PEG at 3.8−4.1 ppm in the 1 H NMR spectra (Figure 1a). The Mn of each block was calculated to be 2000−1150 Da. The retention time of PEG at 14.7 min moved to 14.1 min by forming the PEG-L-PA block copolymer in the GPC chromatogram (data not shown). The molecular weight distribution defined by the ratio of weightaverage molecular weight to number-average molecular weight of the polymer (Mw/Mn) was 1.2 and Mn was 1320 Da by the GPC analysis. PEG-L-PA block copolymers assembled into micelles in water. The critical micelle concentration of the PEG-L-PA block copolymers was determined by studying changes in UV−vis spectra of a hydrophobic dye and ellipicity of the polymers in their aqueous solutions. The 1,6-diphenyl-

fetal bovine serum (10%) and penicillin/streptomycin (1%) under the same conditions described below for appropriate time. 2.16. Statistical Analysis. Statistical significance in the difference among the mean values were evaluated by the one-way ANOVA with Tukey tests. * and ** indicate p < 0.05 and p < 0.01, respectively.

3. RESULTS PEG-L-PA diblock copolymers were prepared by the ringopening polymerization of N-carboxy anhydrides of L-alanine, where α-amino-ω-methoxy-PEG (2000 Da) was used as an initiator. Molecular weight (Mn) of the PEG-L-PA was calculated by comparing the internal methyl (NHCH(CH3)CO) peak of poly(L-alanine) at 1.4−1.7 ppm and ethylene

Figure 1. (a) 1H NMR spectra of PEG-L-PA (2000−1150) (CF3COOD). Methyl peaks of alanine end-group (c′) and internal alanine (c) appear at 1.7−1.9 ppm and 1.4−1.7 ppm, respectively. (b) UV spectra of 1,6-diphenyl-1,3,5-hexatriene in PEG-L-PA aqueous solutions as a function of polymer concentration at 15 °C. (c) CD spectra of PEG-L-PA aqueous solutions as a function of polymer concentration at 15 °C. (d) Critical micelle concentration (CMC) determined by the UV and CD spectra at 15 °C. 11570

DOI: 10.1021/acsami.7b02488 ACS Appl. Mater. Interfaces 2017, 9, 11568−11576

Research Article

ACS Applied Materials & Interfaces

Figure 5. Cell images in each protocol developed by the Live/Dead kit. Live (green) and dead (red) images of cells are shown. The scale bars are (a) 200 μm, and (b) 20 μm. 0 day indicates 1 h after the 3D culture started.

Figure 3. (a) CD spectra of PEG-L-PA aqueous solution (0.1 wt %) as a function of temperature. The legends are the temperatures in °C. (b) FTIR spectra of PEG-L-PA aqueous solution (14.0 wt % in D2O) as a function of temperature. (c) 1H NMR spectra of PEG-L-PA aqueous solution (14.0 wt % in D2O) as a function of temperature. Inset is the enlarged alanine peak at 1.0−2.2 ppm.

diagram of the PEG-L-PA aqueous solutions indicates a sol phase at low temperature and a gel phase at high temperature (Figure 2a). The sol-to-gel transition temperature decreased from 35 (±1.2) °C at 8.0 wt % to 15 (±1.5) °C at 18.0 wt %. At concentrations below 8.0 wt %, the system flew (sol state) even though viscosity increased when the vial was inverted, whereas it remained as a gel at concentrations greater than 18.0 wt % in the studied temperature range of 5−80 °C. The storage modulus (G′) an aqueous polymer solution (14.0 wt %) was less than 0.5 Pa at 5 °C, and it increased to about 1000 Pa at 37 °C (Figure 2b). In addition, G′ crossed over loss modulus (G″) during the thermal gelation. G′ and G″ are the elastic and viscous components of complex modulus, respectively, and G′ > G″ indicates a gel state.37,38 The hydrogel with G′ of about 1000 Pa at 37 °C was robust enough as a stem cell culture system as discussed in the following section. Circular dichroism (CD) spectra and FTIR spectra provide conformational information on the polypeptide. Both CD spectra (minimum at 223 nm) and FTIR spectra (maxima at 1652 and 1624 cm−1) suggest that PA basically maintains its βsheet structure in a temperature range of 5−65 °C, and the βsheet component slightly decreases and the α-helix component slightly increases, as the temperature increases (Figure 3a,b).39,40 In the 1H NMR spectra of the polymer (in D2O), both PEG and L-PA peaks were collapsed and downfieldshifted as the temperature increased (Figure 3c). This finding suggests that partial dehydration of PEG as well as partial conformational changes in the polypeptide secondary structure

Figure 4. Release profile of TUDCA, FGF4, and HGF at 37 °C from the in situ formed PEG-L-PA gel prepared form the aqueous polymer solution (14.0 wt %). N = 3.

1,3,5-hexatriene shows characteristic absorption triad in UV− vis spectra at 337, 356, and 375 nm in a hydrophobic environment, therefore, the appearance of the triad in its UV− vis spectra can be considered to be the micelle formation in water (Figure 1b).33,34 In addition, the minimum of the CD spectra exhibits a red-shift as the polymer assembled (Figure 1c).35,36 The crossing points between two extrapolated lines provide critical micelle concentration of the polymer, which was at 0.05−0.10 wt % by both methods (Figure 1d). PEG-L-PA aqueous solutions (8.0−18.0 wt %) underwent thermal gelation with increasing temperature. The phase 11571

DOI: 10.1021/acsami.7b02488 ACS Appl. Mater. Interfaces 2017, 9, 11568−11576

Research Article

ACS Applied Materials & Interfaces

Figure 6. mRNA expressions for hepatic biomarkers of ALB (a), CK-18 (b), HNF4a (c), G6P (d), CYP7A1 (e), and HNF3b (f) from 3D-cultured cells in each protocol. The samples were analyzed by real time-PCR. The data were normalized by the GAPDH and the data of the zeroth day. The data are presented as the mean ± SEM of triplicate experiments. * and ** indicate p < 0.05 and p < 0.01, respectively. * and ** on the bar graph indicate p < 0.05 and p < 0.01, respectively, in comparison with P.

then exhibited some protruded fibers on days 14−21 of 3D culture in PT, PG, and PTG systems (Figure 5b). Hepatic mRNA expressions were assayed by RT-PCR and normalized by GAPDH and the data of the 0th day. The significant high expressions of hepatic biomarkers including ALB, CK18, HNF4a, G6P, HNF3b, and CYP7A1 were confirmed at the mRNA level from the PTG, compared with P, PT, and PG systems (Figure 6a−f). Even though HyStem scaffold (HTG) and PTG system are excellent as a cell carrier, the hepatic mRNA expressions were significantly different. The hepatic mRNA expressions of the PTG system were significantly higher than the HTG system, indicating that PEG-L-PA thermogel is more promising than the HTG system for injectable tissue engineering application. Comparing the HTG system, the mRNA expressions of ALB, CK18, HNF4a, G6P, CYP7A1, and HNF3b were 10, 6, 10, 5, 7, and 18-times higher, respectively, in the PTG systems. As an injectable system, the characteristics of the polymer is important not only as a sustained release systems of the TUDCA and soluble factors but also as a cell-holding matrix. HTG is based on hyaluronic acid and PEG; both hyaluronic acid and PEG are too hydrophilic to supply TUDCA and growth factors in a sustained manner over 21 days, whereas the polymers used in the PTG system form micelles in water, and the factors incorporated in the PTG thermogel system are continuously released during the cell culture period, as proven in the previous section. When human embryonic stem cells (hESCs) were 3Dcultured in the poly(methyl methacrylate) and gelatin

occurred during the thermal gelation of the polymer aqueous solution. Hepatogenic differentiating factors of TUDCA, FGF4, and HGF were released over 21 days from the in situ formed gel (Figure 4). The factors were incorporated into the gel through thermal gelation of the aqueous polymer solution (14.0 wt %) containing the soluble factors. TUDCA, FGF4, and HGF released 93%, 58%, and 48%, respectively, of the dose over 21 days. The continuous supply of the growth factors is very important for the differentiation of the TMSCs. Ideally, the release profile of the factors should match with the need for cell cycle during the differentiation. FGF-4 is involved in the initial stage of hepatogenic differentiation to form immature hepatocyte-like cells.41 HGF drives stem cells to differentiate into hepatocyte-like cells.42 The HGF and FGF-4 synergistically promote hepatic differentiation of the stem cells.29 TUDCA initiates hepatic differentiation of MSCs and induces mature hepatocyte-like cells.31 TMSCs recovered from an 11 year old female donor were 3D-cultured according to 5 protocols of P, PT, PG, PTG, and HTG as described in the Experimental Section. P, PT, PG, and PTG used PEG-L-PA as an in situ gelling system, whereas HTG was prepared by thiol−ene reactions of a commercially available hyaluronic acid−based gelling system. TMSCs exhibited excellent survival in the P, PT, PG, PTG, and HTG systems over 21 days (Figure 5a). Most of the cells remained scattered in the hydrogel for 21 days. The cells developed spherical phenotype for the first weeks of the 3D culture period, and 11572

DOI: 10.1021/acsami.7b02488 ACS Appl. Mater. Interfaces 2017, 9, 11568−11576

Research Article

ACS Applied Materials & Interfaces

Figure 7. Immunofluorescence images for hepatic biomarkers of ALB (a) and HNF4a (b) at 21st days from 3D-cultured cells in each protocol. The scale bar is 20 μm.

Figure 8. Cellular uptakes of ICG (a) and LDL (b) by the 3D-cultured cells for 21 days in the PTG and HTG systems compared with HepG2 cells. The scale bar is 20 μm. c) Semiquantitative analysis of ICG and LDL uptakes relative to HepG2 cells. The data are presented as the mean ± SEM of triplicate experiments. * and ** indicate p < 0.05 and p < 0.01, respectively.

methacrylate system, 90-fold increases in ALB mRNA expressions were observed at day 18.43 When hMSCs were 3D-cultured in a nanofiber mesh of poly(L-lactide)-copolycaprolactone (PLACL), collagen, and PLACL/collagen blend, 7-, 25-, and 40-fold increases in albumin mRNA expressions were observed, respectively, while 10-, 30-, and 40-fold increases in HNF4a mRNA expressions were observed, respectively, at day 28.44 When human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) were 3D-cultured in gelatin-vinyl acetate (GEVAC), chitosan-hyaluronic acid (CH1), and dextran-gelatin (DG1), 17-, 15-, and 13-fold increases in HNF4a mRNA expressions, 18-, 15-, and 13-fold increases in ALB mRNA expressions, and 16-, 15-, and 14-fold increases in G6P mRNA expressions were reported, respectively, at day 28.45 When MSCs were 3D-cultured in acellular mice liver scaffolds, 25-fold, 50-fold, and 30-fold increases in HNF3b, HNF4a, and G6P mRNA expressions, respectively, were reported at day 28.46 Even though there are differences in stem cell sources and culture protocols, 95-, 131-, 179-, and 75fold increases in mRNA expressions of ALB, HNF4a, HNF3b, and G6P, respectively, were observed in our current PTG system at day 21, indicating that PTG system is very effective, compared with other previous systems.

Biomarker expressions were compared at the protein level for ALB and HNF4a, which appear in red by immunofluorescence assay (Figure 7a,b). The higher fluorescence intensity in PTG system is compared to P, PT, PG, and HTG systems, indicating that TMSCs differentiated into hepatocytes quite well in the PTG system. Hepatogenically differentiated cells from TMSCs in PTG and HTG systems were compared with HepG2 cells for the uptakes of ICG and LDL, and the production of ALB and urea, which are typical bioactivities of hepatocytes. HepG2 cells have been widely used as an alternative to hepatocytes in assaying their biofunctions.29,47−49 The fluorescence intensity of ICG (green) and LDL (red) was quite impressive in PTG system than HTG (Figure 8a,b). And, semiquantitative analysis of the images also indicates that the values (52−76%) of PTG system are comparable to those of HepG2 cells (Figure 8c). ALB and urea production from the hepatogenically differentiated cells from TMSCs after 21 days of 3D culture in PTG and HTG systems were compared with HepG2 cells. ALB was produced 160 (ng/mL/106 cells) in the PTG, whereas HepG2 11573

DOI: 10.1021/acsami.7b02488 ACS Appl. Mater. Interfaces 2017, 9, 11568−11576

Research Article

ACS Applied Materials & Interfaces

4. CONCLUSIONS We investigated a PEG-L-PA thermogelling system as an injectable 3D culture system by incorporating hepatogenic differentiating factors as well as TMSCs at a time. The system undergoes thermal gelation by increasing the temperature to 37 °C, where a TMSC-embedded matrix was produced in situ. To study the cooperative effect among TUDCA, HGF, and FGF4 in hepatogenic differentiation of the TMSCs, thermogel incorporating TMSCs (P), thermogel incorporating TMSCs and TUDCA (PT), thermogel incorporating TMSCs, HGF, and FGF4 (PG), thermogel incorporating TMSCs, TUDCA, HGF, and FGF4 (PTG), and a commercially available Hystem system incorporating TMSCs, TUDCA, HGF, and FGF4 (HTG) were compared as 3D scaffolds for hepatogenic differentiation. TMSCs survived and proliferated well in the 3D scaffolds of above systems. TMSCs exhibited initially spherical morphology, and then they developed some fibers around the spherical cells in days 14−21 in the 3D culture systems of PT, PG, and PTG systems, whereas they maintained spherical morphology in the P and HTG systems. The PTG system exhibited significantly higher expressions of hepatic biomarkers of at both mRNA and protein levels than P, PT, PG, and HTG systems, indicating the cooperative effect of the factors in the hepatogenic differentiation of the TMSCs. Biofunctions of hepatocytes derived from TMSCs were compared between PTG and HTG systems, and HepG2 cells were used as a standard for comparison of biofunctions for the production of ALB and urea as well as uptakes of IGG and LDL. The TMSCs cultured in the PTG system exhibited significantly greater hepatic biofunctions than HGT systems, and the biofunction levels in the PTG system were comparable to the values of HepG2 cells. The continuous supply of the hepatogenic differentiating factors in a cytocompatible environment might induce the favorable hepatogenic differentiation of the embedded TMSCs. The PTG system is comparable or even better than previous 3D culture systems, as discussed in the previous chapter. The combination of TMSCs and soluble factors of TUDCA, FGF4, and HGF in a PEG-L-PA thermogel is an effective system for hepatogenic differentiation of the incorporated stem cells. The characteristics of polymers are important as a drug releasing carrier for the continuous supplies of the soluble factors for the hepatogenic differentiation.

Figure 9. Production of ALB (a) and urea (b) from the 3D-cultured cells for 21 days in the PTG and HTG systems. The production of ABL and urea by HepG2 cells are also shown form comparison. ALB and urea were assayed by using the ALB ELISA kit and the urea assay kit, respectively. The data are presented as the mean ± SEM of triplicate experiments. * and ** indicate p < 0.05 and p < 0.01, respectively.

produced 410 (ng/mL/106 cells) of ALB (Figure 9a). However, when comparing the ALB production of the differentiated cells between PTG and HTG systems, the PTG system exhibited 1.6 times higher than the HTG system. Human adipose-derived stem cells were 3D-cultured in a porous poly(lactide-co-glycolide) scaffold,130 (ng/mL/106 cells) of ALB was produced for 24 h.50 Mouse embryonic stem cells were 3D-cultured in a hybrid gel consisting of Matrigel and PLGA fibers, 110 (ng/mL/106 cells) of ALB was produced for 24 h.51 Rat bone marrow-derived MSCs were 3Dcultured in collagen-coated porous PLGA scaffold, 300 (ng/ mL/106 cells) of ALB was produced for 24 h.52 When murinederived stem cells were 3D-cultured in a gelatin microsphere/ cross-linked alginate hydrogel, 16 (ng/mL/106 cells) ALB produced.53 Twenty-two and 12 (μg/mL/106 cells) of urea was produced in the PTG and HTG systems, respectively, whereas HepG2 produced 42 (μg/mL/106 cells) of urea (Figure 9b). The study indicates that the hepatogenically differentiated cells from TMSCs in the PTG system exhibited comparable (52%) production of urea to the HepG2 cells. When murine-derived stem cells were 3D cultured in a gelatin microsphere/crosslinked alginate hydrogel, 1.3 (μg/mL/106 cells) of urea were produced.48 When MSCs were 3D-cultured in decellularized rat liver, 10−170 (μg/mL/106 cells) of urea was produced, depending on the culture conditions.54 There are limitations in direct comparison with previous systems due to the differences in stem cell sources and culture protocols, our current PTG system is very promising in hepatogenic differentiation of the incorporated stem cells.

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +82 2 3277 3411. Fax: +82 2 3277 2384. E-mail: [email protected] (B.J.). ORCID

Byeongmoon Jeong: 0000-0001-9582-1343 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by the National Research Foundation of Korea Grant funded by the Korean Government (2012M3A9C6049835 and 2014M3A9B6034223).

■

REFERENCES

(1) Li, F.; Xiang, Y.; Potter, J.; Dinavahi, R.; Dang, C. V.; Lee, L. A. Conditional Deletion of c-myc Does Not Impair Liver Regeneration. Cancer Res. 2006, 66, 5608−5612.

11574

DOI: 10.1021/acsami.7b02488 ACS Appl. Mater. Interfaces 2017, 9, 11568−11576

Research Article

ACS Applied Materials & Interfaces (2) Michalopoulos, G. K. Liver Regeneration. J. Cell. Physiol. 2007, 213, 286−300. (3) Keeffe, E. B. Liver Transplantation: Current Status and Novel Approaches to Liver Replacement. Gastroenterology 2001, 120, 749− 762. (4) Lee, H. J.; Jung, J.; Cho, K. J.; Lee, C. K.; Hwang, S. G.; Kim, G. J. Comparison of in Vitro Hepatogenic Differentiation Potential Between Various Placenta-Derived Stem Cells and Other Adult Stem Cells as an Alternative Source of Functional Hepatocytes. Differentiation 2012, 84, 223−231. (5) Lee, K. D.; Kuo, T. K. C.; Whang-Peng, J.; Chung, Y. F.; Lin, C. T.; Chou, S. H.; Chen, J. R.; Chen, Y. P.; Lee, O. K. S. In Vitro Hepatic Differentiation of Human Mesenchymal Stem Cells. Hepatology 2004, 40, 1275−1284. (6) Subramanian, K.; Owens, D. J.; O’Brien, T. D.; Verfaillie, C. M.; Hu, W. S. Enhanced Differentiation of Adult Bone Marrow-Derived Stem Cells to Liver Lineage in Aggregate Culture. Tissue Eng., Part A 2011, 17, 2331−2341. (7) Piryaei, A.; Valojerdi, M. R.; Shahsavani, M.; Baharvand, H. Differentiation of Bone Marrow-Derived Mesenchymal Stem Cells into Hepatocyte-Like Cells on Nanofibers and Their Transplantation into a Carbon Tetrachloride-Induced Liver Fibrosis Model. Stem Cell Rev. Rep. 2011, 7, 103−118. (8) Wertheim, J. A.; Petrowsky, H.; Saab, S.; Kupiec-Weglinski, J. W.; Busuttil, R. W. Major Challenges Limiting Liver Transplantation in the United States. Am. J. Transplant. 2011, 11, 1773−1784. (9) Ryu, K. H.; Cho, K. A.; Park, H. S.; Kim, J. Y.; Woo, S. Y.; Jo, I.; Choi, Y. H.; Park, Y. M.; Jung, S. C.; Chung, S. M.; Choi, B. O.; Kim, H. S. Tonsil-Derived Mesenchymal Stromal Cells: Evaluation of Biologic, Immunologic and Genetic Factors for Successful Banking. Cytotherapy 2012, 14, 1193−1202. (10) Janjanin, S.; Djouad, F.; Shanti, R. M.; Baksh, D.; Gollapudi, K.; Prgomet, D.; Rackwitz, L.; Joshi, A. S.; Tuan, R. S. Human Palatine Tonsil: a New Potential Tissue Source of Multipotent Mesenchymal Progenitor Cells. Arthritis Res. Ther. 2008, 10, R83. (11) Patel, M.; Moon, H. J.; Jung, B. K.; Jeong, B. MicrosphereIncorporated Hybrid Thermogel for Neuronal Differentiation of Tonsil Derived Mesenchymal Stem Cells. Adv. Healthcare Mater. 2015, 4, 1565−1574. (12) Moon, H. J.; Patel, M.; Chung, H.; Jeong, B. Nanocomposite Versus Mesocomposite for Osteogenic Differentiation of Tonsil Derived Mesenchymal Stem Cells. Adv. Healthcare Mater. 2016, 5, 353−363. (13) Park, M.; Kim, Y. H.; Woo, S. Y.; Lee, H. J.; Yu, Y.; Kim, H. S.; Park, Y. S.; Jo, I.; Park, J. W.; Jung, S. C.; Lee, H.; Jeong, B.; Ryu, K. H. Tonsil-Derived Mesenchymal Stem Cells Ameliorate CCl4-Induced Liver Fibrosis in Mice via Autophagy Activation. Sci. Rep. 2015, 5, 8616−8622. (14) Park, M. H.; Yu, Y.; Moon, H. J.; Ko, D. Y.; Kim, H. S.; Lee, H. J.; Ryu, K. H.; Jeong, B. 3D Culture of Tonsil-Derived Mesenchymal Stem Cells in Poly(ethylene glycol)-poly(L-alanine-co-L-phenyl alanine) Thermogel. Adv. Healthcare Mater. 2014, 3, 1782−1791. (15) Kim, S. J.; Park, M. H.; Moon, H. J.; Park, J. H.; Ko, D. Y.; Jeong, B. Polypeptide Thermogels as a 3D Culture Scaffold for Hepatogenic Differentiation of Human Tonsil-Derived Mesenchymal Stem Cells. ACS Appl. Mater. Interfaces 2014, 6, 17034−17043. (16) Kye, E. J.; Kim, S. J.; Park, M. H.; Moon, H. J.; Ryu, K. H.; Jeong, B. Differentiation of Tonsil-Tissue-Derived Mesenchymal Stem Cells Controlled by Surface-Functionalized Microspheres in PEGPolypeptide Thermogels. Biomacromolecules 2014, 15, 2180−2187. (17) Loh, X. J.; Li, J. Biodegradable Thermosensitive Copolymer Hydrogels for Drug Delivery. Expert Opin. Ther. Pat. 2007, 17, 965− 977. (18) Yu, L.; Ding, J. Injectable Hydrogels as Unique Biomedical Materials. Chem. Soc. Rev. 2008, 37, 1473−1481. (19) Nagahama, K.; Ouchi, T.; Ohya, Y. Temperature-Induced Hydrogels Through Self-Assembly of Cholesterol-Substituted Star PEG-b-PLLA Copolymers: An Injectable Scaffold for Tissue Engineering. Adv. Funct. Mater. 2008, 18, 1220−1231.

(20) Moon, H. J.; Ko, D. Y.; Park, M. H.; Joo, M. K.; Jeong, B. Temperature-Responsive Compounds as in Situ Gelling Biomedical Materials. Chem. Soc. Rev. 2012, 41, 4860−4883. (21) Dou, Q. Q.; Liow, S. S.; Ye, E.; Lakshminarayanan, R.; Loh, X. J. Biodegradable Thermogelling Polymers: Working Towards Clinical Applications. Adv. Healthcare Mater. 2014, 3, 977−988. (22) Park, M. H.; Joo, M. K.; Choi, B. G.; Jeong, B. Biodegradable Thermogels. Acc. Chem. Res. 2012, 45, 424−433. (23) He, C.; Kim, S. W.; Lee, D. S. In Situ Gelling Stimuli-Sensitive Block Copolymer Hydrogels for Drug Delivery. J. Controlled Release 2008, 127, 189−207. (24) Zhang, Z.; Ni, J.; Chen, L.; Yu, L.; Xu, J.; Ding, J. Biodegradable and Thermoreversible PCLA-PEG-PCLA Hydrogel as a Barrier for Prevention of Post-Operative Adhesion. Biomaterials 2011, 32, 4725− 4736. (25) Loh, X. J.; Nguyen, V. P. N.; Kuo, N.; Li, J. Encapsulation of Basic Fibroblast Growth Factor in Thermogelling Copolymers Preserves Its Bioactivity. J. Mater. Chem. 2011, 21, 2246−2254. (26) Nguyen, V. P. N.; Kuo, N.; Loh, X. J. New Biocompatible Thermogelling Copolymers Containing Ethylene-Butylene Segments Exhibiting Very Low Gelation Concentrations. Soft Matter 2011, 7, 2150−2159. (27) Zheng, C.; Gao, H.; Yang, D. P.; Liu, M.; Cheng, H.; Wu, Y. L.; Loh, X. J. PCL-Based Thermo-Gelling Polymers for In Vivo Delivery of Chemotherapeutics to Tumors. Mater. Sci. Eng., C 2017, 74, 110− 116. (28) Liow, S. S.; Dou, Q.; Kai, D.; Li, Z.; Sugiarto, S.; Yu, C. Y. Y.; Kwok, R. T. K.; Chen, X.; Wu, Y. L.; Ong, S. T.; Kizhakeyil, A.; Verma, N. K.; Tang, B. Z.; Loh, X. J. Long-Term Real-Time In Vivo Drug Release Monitoring with AIE Thermogelling Polymer. Small 2017, 13, 1603404−1603410. (29) Chien, C. C.; Yen, B. L.; Lee, F. K.; Lai, T. H.; Chen, Y. C.; Chan, S. H.; Huang, H. I. In Vitro Differentiation of Human PlacentaDerived Multipotent Cells into Hepatocyte-Like Cells. Stem Cells 2006, 24, 1759−1768. (30) Huang, W.; Ma, K.; Zhang, J.; Qatanani, M.; Cuvillier, J.; Liu, J.; Dong, B.; Huang, X.; Moore, D. D. Nuclear Receptor-Dependent Bile Acid Signaling is Required for Normal Liver Regeneration. Science 2006, 312, 233−236. (31) Sawitza, I.; Kordes, C.; Götze, S.; Herebian, D.; Häussinger, D. Bile Acids Induce Hepatic Differentiation of Mesenchymal Stem Cells. Sci. Rep. 2015, 5, 13320−13334. (32) Choi, Y. Y.; Jang, J. H.; Park, M. H.; Choi, B. G.; Chi, B.; Jeong, B. Block Length Affects Secondary Structure, Nanoassembly and Thermosensitivity of Poly(ethylene glycol)-poly(L-alanine) Block Copolymer. J. Mater. Chem. 2010, 20, 3416−3421. (33) Yu, L.; Zhang, H.; Ding, J. Effects of Precipitate Agents on Temperature-Responsive Sol−Gel Transitions of PLGA−PEG−PLGA Copolymers in Water. Colloid Polym. Sci. 2010, 288, 1151−1159. (34) Liu, C.; Zhang, Z.; Liu, K. L.; Ni, X.; Li, J. Biodegradable Thermogelling Poly(ester urethane)s Consisting of Poly(1,4-butylene adipate), Poly(ethylene glycol), and Poly(propylene glycol). Soft Matter 2013, 9, 787−794. (35) Choi, Y. Y.; Joo, M. K.; Sohn, Y. S.; Jeong, B. Significance of Secondary Structure in Nanostructure Formation and Thermosensitivity of Polypeptide Block Copolymers. Soft Matter 2008, 4, 2383− 2387. (36) Shinde, U. P.; Joo, M. K.; Moon, H. J.; Jeong, B. Sol−Gel Transition of PEG−PAF Aqueous Solution and Its Application for hGH Sustained Release. J. Mater. Chem. 2012, 22, 6072−6079. (37) Gupta, M. K.; Martin, J. R.; Werfel, T. A.; Shen, T.; Page, J. M.; Duvall, C. L. Cell Protective, ABC Triblock Polymer-Based Thermoresponsive Hydrogels with ROS-Triggered Degradation and Drug Release. J. Am. Chem. Soc. 2014, 136, 14896−14902. (38) Supper, S.; Anton, N.; Seidel, N.; Riemenschnitter, M.; Schoch, C.; Vandamme, T. Rheological Study of Chitosan/Polyol-phosphate Systems: Influence of the Polyol Part on the Thermo-Induced Gelation Mechanism. Langmuir 2013, 29, 10229−10237. 11575

DOI: 10.1021/acsami.7b02488 ACS Appl. Mater. Interfaces 2017, 9, 11568−11576

Research Article

ACS Applied Materials & Interfaces (39) Hou, S. S.; Hsu, Y. Y.; Lin, J. H.; Jan, J. S. Alkyl-poly(Lthreonine)/Cyclodextrin Supramolecular Hydrogels with Different Molecular Assemblies and Gel Properties. ACS Macro Lett. 2016, 5, 1201−1205. (40) Joo, M. K.; Ko, D. Y.; Jeong, S. J.; Park, M. H.; Shinde, U. P.; Jeong, B. Incorporation of D-Alanine into Poly(ethylene glycol) and Lpoly(alanine-co-phenylalanine) Block Copolymers Affects Their Nanoassemblies and Enzymatic Degradation. Soft Matter 2013, 9, 8014−8022. (41) Chivu, M.; Dima, S. O.; Stancu, C. I.; Dobrea, C.; Uscatescu, V.; Necula, L. G.; Bleotu, C.; Tanase, C.; Albulescu, R.; Ardeleanu, C.; Popescu, I. In Vitro Hepatic Differentiation of Human Bone Marrow Mesenchymal Stem Cells under Differential Exposure to Liver-Specific Factors. Transl. res. 2009, 154, 122−132. (42) Ghaedi, M.; Duan, Y.; Zern, M. A.; Revzin, A. Hepatic Differentiation of Human Embryonic Stem Cells on Growth FactorContaining Surfaces. J. Tissue Eng. Regener. Med. 2014, 8, 886−895. (43) Yao, R.; Wang, J.; Li, X.; Jung, D. J.; Qi, H.; Kee, K. K.; Du, Y. Hepatic Differentiation of Human Embryonic Stem Cells as Microscaled Multilayered Colonies Leading to Enhanced Homogeneity and Maturation. Small 2014, 10, 4310. (44) Bishi, D. K.; Mathapati, S.; Venugopal, J. R.; Guhathakurta, S.; Cherian, K. M.; Ramakrishna, S.; Verma, R. S. Trans-Differentiation of Human Mesenchymal Stem Cells Generates Functional Hepatospheres on Poly(L-lactic acid)-co-poly(ε-caprolactone)/collagen Nanofibrous Scaffolds. J. Mater. Chem. B 2013, 1, 3972−3984. (45) Chitrangi, S.; Nair, P.; Khanna, A. Three-Dimensional Polymer Scaffolds for Enhanced Differentiation of Human Mesenchymal Stem Cells to Hepatocyte-Like Cells: A Comparative Study. J. Tissue Eng. Regener. Med. 2016, DOI: 10.1002/term.2136. (46) Jiang, W. C.; Cheng, Y. H.; Yen, M. H.; Chang, Y.; Yang, V. W.; Lee, O. K. Cryo-Chemical Decellularization of the Whole Liver for Mesenchymal Stem Cells-Based Functional Hepatic Tissue Engineering. Biomaterials 2014, 35, 3607−3617. (47) Roelandt, P.; Sancho-Bru, P.; Pauwelyn, K.; Verfaillie, C. Differentiation of Rat Multipotent Adult Progenitor Cells to Functional Hepatocyte-Like Cells by Mimicking Embryonic Liver Development. Nat. Protoc. 2010, 5, 1324−1336. (48) Lee, O. K.; Kuo, T. K.; Chen, W. M.; Lee, K. D.; Hsieh, S. L.; Chen, T. H. Isolation of Multipotent Mesenchymal Stem Cells from Umbilical Cord Blood. Blood 2004, 103, 1669−1675. (49) Kazemnejad, S.; Allameh, A.; Soleimani, M.; Gharehbaghian, A.; Mohammadi, Y.; Amirizadeh, N.; Jazayery, M. Biochemical and Molecular Characterization of Hepatocyte-Like Cells Derived from Human Bone Marrow Mesenchymal Stem Cells on a Novel ThreeDimensional Biocompatible Nanofibrous Scaffold. J. Gastroenterol. Hepatol. 2009, 24, 278−287. (50) Wang, M.; Pei, H.; Zhang, L.; Guan, L.; Zhang, R.; Jia, Y.; Li, B.; Yue, W.; Wang, Y.; Pei, X. Hepatogenesis of Adipose-Derived Stem Cells on Poly-Lactide-co-Glycolide Scaffolds: In Vitro and In Vivo Studies. Tissue Eng., Part C 2010, 16, 1041−1050. (51) Liu, T.; Zhang, S.; Chen, X.; Li, G.; Wang, Y. Hepatic Differentiation of Mouse Embryonic Stem Cells in Three-Dimensional Polymer Scaffolds. Tissue Eng., Part A 2010, 16, 1115−1122. (52) Li, J.; Tao, R.; Wu, W.; Cao, H.; Xin, J.; Li, J.; Guo, J.; Jiang, L.; Gao, C.; Demetriou, A. A.; Farkas, D. L.; Li, L. 3D PLGA Scaffolds Improve Differentiation and Function of Bone Marrow Mesenchymal Stem Cell−Derived Hepatocytes. Stem Cells Dev. 2010, 19, 1427− 1436. (53) Lau, T. T.; Ho, L. W.; Wang, D. A. Hepatogenesis of Murine Induced Pluripotent Stem Cells in 3D Microcavitary Hydrogel System for Liver Regeneration. Biomaterials 2013, 34, 6659−6669. (54) Ji, R.; Zhang, N.; You, N.; Li, Q.; Liu, W.; Jiang, N.; Liu, J.; Zhang, H.; Wang, D.; Tao, K.; Dou, K. The Differentiation of MSCs into Functional Hepatocyte-Like Cells in a Liver Biomatrix Scaffold and Their Transplantation into Liver-Fibrotic Mice. Biomaterials 2012, 33, 8995−9008.

11576

DOI: 10.1021/acsami.7b02488 ACS Appl. Mater. Interfaces 2017, 9, 11568−11576