Insights into the Kinetics of the Resistance Formation of Bacteria

Subscriber access provided by - Access paid by the | UCSB Libraries

Article

Insights into the kinetics of the resistance formation of bacteria against ciprofloxacin poly(2-methyl-2-oxazoline) conjugates Martin Schmidt, Alina Romanovska, Youssef Wolf, Thanh-Duong Nguyen, Anna Krupp, Hannah Lea Tumbrink, Jonas Lategahn, Jan Volmer, Daniel Rauh, Stephen Luetz, Christian Krumm, and Joerg C Tiller Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.8b00361 • Publication Date (Web): 21 Jun 2018 Downloaded from http://pubs.acs.org on June 23, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

Insights into the kinetics of the resistance formation of bacteria against ciprofloxacin poly(2-methyl-2-oxazoline) conjugates

Martin Schmidt1, Alina Romanovska1, Youssef Wolf1, Thanh-Duong Nguyen1, Anna Krupp, Hannah L. Tumbrink2, Jonas Lategahn2, Jan Volmer3, Daniel Rauh2, Stephan Luetz3, Christian Krumm1 and Joerg C. Tiller1*

1) Biomaterials and Polymer Science, Department of Bio- and Chemical Engineering, TU Dortmund, Emil-Figge-Straße 66, 44227 Dortmund, Germany

2) Faculty of Chemistry and Chemical Biology, TU Dortmund University, Otto-HahnStrasse 4a, 44227 Dortmund, Germany

3) Bioprecess Technology, Department of Bio- and Chemical Engineering, TU Dortmund, Emil-Figge-Straße 66, 44227 Dortmund, Germany

1 ACS Paragon Plus Environment

Bioconjugate Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 33

Abstract: The influence on the resistance formation of polymers attached to antibiotics is rarely investigated. In this study, ciprofloxacin (CIP) was conjugated to poly(2-methyl-2oxazoline)s with an ethylene diamine end group (Me-PMOx28-EDA) via two different spacers (CIP modified with α,α´-dichloro-p-xylene - xCIP, CIP modified with chloroacetyl chloride eCIP). The antibacterial activity of the conjugates against a number of bacterial strains shows a great dependence on the nature of the spacer. The Me-PMOx39-EDA-eCIP, containing a potentially cleavable linker, does not exhibit a molecular weight dependence on antibacterial activity in contrast to Me-PMOx27-EDA-xCIP. The resistance formation of both conjugates against Staphylococcus aureus and Escherichia coli was investigated. Both conjugates showed potential of significantly delaying the formation of resistant bacteria compared to the unmodified CIP. Closer inspection of a possible resistance mechanism by genome sequencing of the topoisomerase IV region of resistant S. aureus revealed that this bacterium mutates at the same position when building up resistance to CIP and to Me-PMOx27-EDA-xCIP. However, the S. aureus cells that became resistant against the polymer conjugate are fully susceptible to CIP. Thus, conjugation of CIP with PMOx seems to alter the resistance mechanism.


Page 3 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Infections caused by multi-resistant bacterial strains are one of the major problems of the modern globalized society.

1

Thus, the demand for new antibiotics is more urgent than ever

since Fleming found penicillin. Unfortunately, the number of antibiotics that reach the market is rather limited because of the exploding costs for drug development and approval.

2, 3

A

promising alternative to shorten the time for the development of new antibiotics is the formulation and the derivatization of existing antimicrobial agents. Antibiotics are modified to change charge density, solubility, degradability, selectivity, efficiency, and lower resistance formation. 4, 5 In the last decades the formulation based on polymers moved in focus of research. Such macromolecules of the shape of nanoparticles 6-9, liposomes 10, or molecular micelles 11, 12 are used for a controlled drug release or to optimize the bioavailability. In case of antibiotics, macromolecules are often used as temporary drug carriers. The antibiotic is bound by a degradable bond to a non-degradable polymer

13

or incorporated into a degradable polymer

matrix 14. Covalent polymer therapeutics conjugates are an increasingly important alternative to the low molecular weight derivatization of drugs, because such polymer drug conjugates afford lower toxicity, increased solubility and stability, and prolonged activity

4, 5

For example,

antimicrobial polymers are often considered as an alternative for low molecular weight biocides. They are classified as biocide-releasing polymers, polymerized biocides, and biocidal polymers.

15

Polymerized biocides often show improved selectivity and lower

toxicity than the respective low molecular weight biocide. 15 In some cases a lower potential for the formation of resistant bacteria could be observed.

16

Conjugates of biocides and

polymers that show the satellite group effect exceed in some cases the activity of the free



Page 4 of 33

biocide 17 and can be used as switched off in their activity by cleaving the satellite group and not the biocide. 18 Polymer antibiotic conjugates (PACs) with a permanent bond between polymer and antibiotic are less often described. Most permanent PACs contain antibiotics such as doxorubicin because of their anti-cancer properties. 19, 20 Permanent PACs which focus on the treatment on bacterial infections are rarely considered. The few known examples show that PACs can exhibit higher activity21 and higher efficiency against biofilms22 and can become more stable23. In previous work, we presented the conjugation of ciprofloxacin (CIP)24 and penicillin25 with poly(2-oxazoline) (POx) via end group modification. In case of penicillin, the conjugates exhibit a high resistance against the hydrolysis caused by penicillinase and are thus more active against typical penicillin-resistant strains. The previously reported CIP-POx-conjugates show excellent activity against Gram-positive strains. The most active conjugate even exceeds the molar activity of the pristine antibiotic. The activity of these conjugates was influenced by the spacer group between polymer backbone and antibiotic. The directly coupled antibiotic exhibits no activity in contrast to conjugates with a suited spacer between polymer and antibiotic.

24

In the present study, CIP-

POx-conjugates with two different spacers, one permanent and the other potentially cleavable, between polymer and antibiotic were synthesized and their antimicrobial activity was investigated with respect to the formation of bacterial resistance against the different PACs. Results and Discussion The objective of this study is the comparison of CIP poly(2-oxazoline) (POx) conjugates with two different spacer groups regarding their antimicrobial activity and their bacterial resistance forming potential. The conjugation of ciprofloxacin is generally performed via a polymer analog reaction of an ethylene diamine terminated PMOx (analytical data shown in Table S 2) 4 ACS Paragon Plus Environment

Page 5 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and an amino-reactive derivate of CIP (see Figure 1). This synthesis strategy allows the introduction of a spacer between polymer and antibiotic. In a previous study we reported on a α,α’-dichloro-p-xylene

24, 26, 27

modification of CIP as amino-reactive derivate. The formed

conjugates (PMOx-xCIP) are highly antimicrobially active and stable. Additionally to those, we have synthesized conjugates by using CIP reacted with chloroacetyl chloride (eCIP), 28 as alternative PMOx-CIP-conjugate with a shorter more hydrophilic spacer. The eCIP was obtained with 70% yield and high purity (>98%) confirmed by 1H NMR spectroscopy (supplementary Figure S10). The conjugation was carried out in a mixture of acetonitrile and

N,N-dimethylformamide with 2 eq. sodium hydrogen carbonate. All isolated conjugates were dialyzed twice against water to remove unreacted CIP.



Page 6 of 33

Figure 1: Syntheses strategy of the CIP conjugation via xCIP and eCIP.

As seen in Figure 2, all signals in the 1H NMR spectrum of Me-PMOx39-EDA-eCIP can be assigned to the expected conjugate structure. All signals of the PMOx backbone could be clearly identified at 2.12 ppm and 3.43 ppm (signal 2-5). The methyl initiator group shows a multiplett at 3.04 ppm (1). The integrals of these signals were used to determine the degree of polymerization. In this case, the degree of polymerization is 39 repeating units. Besides these 6 ACS Paragon Plus Environment

Page 7 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


signals another multiplett is found at 2.50 ppm, which corresponds to the protons of the EDA end group (7, 8) and the last methylene unit of the polymer backbone (6). Moreover, the signals of the cyclopropane ring and the aromatic protons of CIP are seen at 1.19-1.40 ppm (14, 15) and 7.38-8.74 (12, 16, 17) ppm. These signals indicate a successful functionalization of the polymer with eCIP. Comparing the integrals of the signal of the starter CH3-group with those of the eCIP end group indicates more than 99% conversion, i.e. all polymers carry an eCIP end group.

Figure 2: 1H-NMR of Me-PMOx39-EDA-eCIP in CDCl3 (7.27 ppm).

A series of PMOx-eCIPs with different molecular weight was prepared accordingly and the analytical data are provided in supplementary Table S3. The NMR data suggest full end group functionalization in all cases.



Page 8 of 33

The antimicrobial activity of the new PACs against a number of clinically relevant infectious bacterial strains was investigated by measuring the minimal inhibitory concentrations (MIC), which is the concentration at which 99% of bacteria are inhibited in growth. The obtained antimicrobial activities of the PACs are compared to that of CIP and the previously reported Me-PMOx27-EDA-xCIP. As seen in Figure 3, the Me-PMOx39-EDA-eCIP conjugate shows high antimicrobial activities, which, however, are in most cases decreased as compared to free CIP. In comparison to the previously reported Me-PMOx27-EDA-xCIP conjugate, the activity against the Gram-positive bacterium Staphylococcus aureus is lower, while the activities against all tested Gram-negative strains are higher. In case of Kleibsiella pneumoniae, the difference is most pronounced. While Me-PMOx27-EDA-xCIP is about 250 times lower active than CIP, the PMOx-eCIP conjugate shows the same molar activity as the low molecular weight antibiotic. A similar picture is found for other Me-POx-EDA-eCIP conjugates, but not for Me-PEG45-EDA-eCIP, which shows lower activities compared to MePEG45-EDA-xCIP in all cases (see supplementary Figure S16). The generally high difference in the activities of the conjugates against Gram-positive (Staphylococcus aureus) and Gramnegative (Escherichia coli, Kleibsiella pneumoniae, Pseudomonas aeruginosa) bacterial strains can be explained by the fact that CIP needs to enter the cytoplasm and therefore must cross the cell membranes. Gram-negative bacterial strains have only one cell membrane and are therefore more susceptible for the CIP-conjugates than the Gram-negative strains with two cell membranes.


Page 9 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3: MIC-values of Me-PMOx39-EDA-eCIP (black) 24 and Me-PMOx27-EDA-xCIP (striped) in comparison to the low molecular CIP (white).

Furthermore, it was found that the antimicrobial activity of the eCIP-Conjugates is not influenced by the molecular weight of polymer (see Figure 4). This is in contrast to the behavior of the xCIP-conjugates, which show a significant increase of the antimicrobial activity with decreasing length of the polymer. 24



Figure 4: MICS.

aureus

and MICE.

coli

Page 10 of 33

of the conjugates Me-PMOxn-EDA-eCIP and Me-PMOxn-

EDA-xCIP with different degrees of polymerization (n).

We assume that this might be due to the fact that the antimicrobial mechanism of the eCIP conjugates is partially based on cleavage of the bond between CIP and polymer, which might be caused by hydrolytic enzymes, such as amidases or esterases that can be found in the bacterial cell wall. 29, 30 10 ACS Paragon Plus Environment

Page 11 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The formation of bacterial resistance against the two PMOx CIP conjugates compared to that of CIP and the respective CIP-linker was measured with a modified MIC-test. To this end, the bacterial cells grown at the highest possible antibiotic concentration (half of the MIC) were collected after 24 h and used to inoculate the next MIC-test. This procedure was repeated for at least 9 days or until the MIC value increased above 500 µmol·L-1. Thereby, the evolutionary stress on the bacteria was kept constantly high. We chose E. coli and S. aureus as representative bacterial strains for this test. The results are summarized in Figure 5. As seen in Figure 5, left column of diagrams, S. aureus cells become resistant against CIP, xCIP, and eCIP after nine days after being challenged with the highest possible antibiotic concentration. The MICS.aureus-values are up to 620 times higher than the starting value after this time. S. aureus also becomes more resistant to Me-PMOx27-EDA-xCIP over time, but the MIC only increases to a 51-fold of the originally MIC-value after 9 d, showing that the resistance formation of CIP is significantly slowed down by conjugation with PMOx. Thus, this conjugate has a more than ten times lower potential to form resistant S. aureus. In contrast, the S. aureus cells build up resistance to Me-PMOx39-EDA-eCIP with the same rate as free CIP, showing that the resistance formation is highly dependent on the nature of the linker used to link CIP to PMOx. The potential cleavage of the bond between PMOx and CIP in the case of the eCIP linker might be the reason for the faster resistance formation in case of

S. aureus. A different reaction on the resistance challenge was observed for E. coli (see Figure 5, right column of diagrams). The MICE.coli value of CIP increases from 0.10 µmol·L-1 to 63 µmol·L-1 within 10 days. This 630-fold drop in activity is similar to that found for S. aureus. The xCIP as well as the eCIP are raised from 0.28 and 0.40 µmolL-1, respectively, to more than 500 µmolL-1 after four days. Thus both linkers induce strong resistance formation. The MICE.coli of Me-PMOx27-EDA-xCIP increases from 5.33 to 400 µmolL-1 (75-fold drop in 11 ACS Paragon Plus Environment


Page 12 of 33

activity) after 9 days, indicating a less pronounced resistance formation than CIP and a similar behavior compared to that found for S. aureus cells. The MICE.coli of Me-PMOx39-EDA-eCIP is raised from 4.6 to 34 µmol·L-1 after 9 days. Thus, the resistance formation of this conjugate is much slower than that of the respective linker and pristine CIP. The MICE.coli-values of CIP during the resistance challenge increased 630 times, while MICE.coli of Me-PMOx39-EDAeCIP increased only by a factor of 8. This is significantly less than the resistance formed against this conjugate by S. aureus (116-fold). One possibility to explain this might be the different hydrolysis rate that leads to cleavage of CIP from PMOx in the two different bacterial strains. If S. aureus cells cleave the bond between PMOx and CIP to a high extent, the bacterial cells react to free CIP and thus show a similar resistance built up as found for CIP. In case of E. coli, the hydrolysis rate might be lower and thus the PMOx-conjugate is the major active compound, which will then lead to the slower resistance formation caused by the conjugate.


Page 13 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5: Resistance test for the compounds CIP, xCIP, eCIP and the two conjugates MePMOx27-EDA-xCIP and Me-PMOx39-EDA-eCIP for the strains E. coli and S. aureus. The tests were run at least twice and the different curves each represent an individual experiment.



Page 14 of 33

The two main resistance mechanisms of fluoroquinolones are the mutation of the target enzyme, topoisomerase, and an overexpression of efflux pumps.

31, 32

the AcrAB-TolC efflux pumps results in a multi-drug resistance.

The overexpression of

32, 33

It is possible that the

high molecular weight of the polymer attached to CIP inhibits the transport via efflux pump enzymes. In order to investigate this, the antimicrobial activity of the two conjugates against

Escherichia coli and its mutants Escherichia coli JW0453 and Escherichia coli JW5503 was determined. Escherichia coli JW5503 exhibits no gene for the deregulation of the efflux pump system, which leads to an overexpression of AcrAB-TolC efflux pump. Escherichia coli JW0453 with a deleted AcrAB-TolC efflux pump was investigated as well. 34

Figure 6: MIC-values against E. coli and its mutants of CIP, and the two conjugates MePMOx27-EDA-xCIP and Me-PMOx39-EDA-eCIP.

Figure 6 shows, that the amount of efflux pumps has a huge influence on the antimicrobial activity of CIP and its derivates against Escherichia coli. The activity increases with a 14 ACS Paragon Plus Environment

Page 15 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


decreasing amount of efflux pumps due to the deletion of the tolC gene. The antimicrobial activity of Me-PMOx27-EDA-xCIP against Escherichia coli JW0453 without the AcrABTolC efflux pump system is 10 times higher than the antimicrobial activity against the wild type. The mutant with an overexpression shows with an MIC of 16 µmolL-1 the lowest susceptibility against the antimicrobial agents. However, the activity of the conjugates and the pristine CIP is influenced in same magnitude. This indicates that the low molecular CIP and the conjugates are equally transported by the AcrAB-TolC efflux pumps and thus, the expression of efflux pumps is most likely a resistance mechanism for both, CIP and its polymer conjugates. The other main resistance mechanism is the mutation of the target structure. 31, 32, 35 In case of

S. aureus the primary target of ciprofloxacin is the enzyme topoisomerase IV. In order to investigate a possible structural change of this enzyme, the DNA-sequence of topoisomerase IV of both, the CIP-resistant and the PAC-resistant S. aureus, was examined. First, the respective DNA-sequences were duplicated via polymerase chain reaction (PCR). The oligonucleotides

GGGCTTCACGTTACAACGTTAC

and

CCTCGCATCCTCTACATGAATC were used as PCR-primers. The duplicated gene segments were sequenced and compare to the wild type genome of S. aureus. Surprisingly, both strains show the same point mutation in the grlA subunit. The nucleotide base cytosine was replaced by adenosine. This causes an exchange of serine to tyrosine at position 80 in the active site of topoisomerase IV. This mutation could be associated with fluoroquinolone resistance in other studies.

35

The same mutations in conjugate-resistant and the CIP-resistant

strains indicate the same resistance mechanisms for CIP and its conjugates. This result indicates that the activity of CIP is more influenced by the amino acid exchange than the conjugate. One explanation might be that PMOx itself combined with an enzyme-affine



Page 16 of 33

function acts as inhibitor itself. 36 This might somewhat compensate the lower affinity of CIP to the mutated active site of topoisomerase IV. In order to explore, if the mechanism of resistance formation against CIP is indeed similar to that against PMOx-xCIP as suggested by these results, the MIC of the CIP resistant S. aureus strain against PAC and the MIC of the PAC-resistant S. aureus strain against CIP was determined. In the first case, the MICS.aureus was found to be 32 µmolL-1, which is close to the MIC value of the PAC-resistant S. aureus cells of 63 µmolL-1. This suggests that the resistance mechanism of S. aureus induced by CIP is effective for Me-PMOx27-EDA-xCIP as well. In contrast, the MICS.aureus of the PAC-resistant S. aureus cells for CIP is 0.5 µmolL-1, which is close to the value of CIP against the non-resistant bacterium. Obviously, the structural change that occurs during resistance formation of S. aureus against Me-PMOx27EDA-xCIP is not the crucial mutation that leads CIP resistance, i.e. the structural change in topoisomerase IV is not sufficient for full resistance of S. aureus against CIP. Compatibility Investigations with red blood cells show a high hemocompatibility of the polymeric compounds (HC50>20000 µg·mL-1, supplementary Table S1). In order to test for tissue toxicity A431 and H1975 cells were used as a model system in a CellTiter-Glo viability assay. The compatibility test with these cells shows low toxicity of the low molecular CIP derivatives (18-20 µmol·L-1) and the Me-PMOx39-EDA-eCIP conjugate (24 µmol·L-1). No toxicity was observed for Me-PMOx27-EDA-xCIP and CIP (>30 µmol·L-1). A summary of the results of the compatibility test is given in supplementary Table S2.


Page 17 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Conclusions It was shown in the present study that conjugation of CIP with poly(2-methyl-2-oxazoline) via two different linkers is a successful strategy to slow down the resistance formation of S.

aureus and E. coli cells. Thereby the nature of the linker plays a significant role. While MePMOx27-EDA-xCIP induces resistance formation of S. aureus and E. coli less strong than CIP, Me-PMOx39-EDA-eCIP inducing slower resistance formation only in E. coli, but to a higher extent than Me-PMOx27-EDA-xCIP. The latter conjugate induces the same structural change of the topoisomerase IV as pristine CIP. Cross-testing of antimicrobial activities of the resistant S. aureus strains shows that CIP seems to induce an additional structural change that is not induced by the PAC. Thus, Me-PMOx27-EDA-xCIP resistant S. aureus cells are still fully susceptible of pristine CIP.

Materials All reactions, purifications and polymerizations were carried out under an inert atmosphere. Chloroform (AppliChem) was distilled under reduced pressure from aluminum oxide (Merck) and stored over 4 Å molecular sieves. N,N-dimethylformamide (VWR) and acetonitrile (Merck) were distilled from diphosphorus pentoxide (VWR), then from potassium carbonate (VWR) and stored over 3 Å molecular sieves. The water content was determined by Karl Fischer titration (< 0.5 ppm). The monomer 2-methyl-2-oxazoline (MOx, Sigma Aldrich) was distilled from CaH2 (ABCR). Ethylene diamine (EDA, ABCR) was distilled under reduced pressure. α,α´-dichloro-p-xylene (ACROS, TCI) was recrystallized in chloroform. Ciprofloxacin (Alfa aesar, Sigma Aldrich, TCI), 2,3,5‐triphenyltetrazolium chloride (AppliChem), chloroacetyl chloride (Acros), triethylamine (Sigma Aldrich) sodium hydrogen carbonate (Merck) sodium chloride (Fischer), sodium dihydrogen phosphate dihydrate 17 ACS Paragon Plus Environment


Page 18 of 33

(Merck), sodium hydroxide (Merck), sodium citrate (Sigma Aldrich), citric acid monohydrate (Sigma Aldrich), glucose monohydrate (Sigma Aldrich), hydrochloric acid (VWR) and nutrient both (ISO, APHA, VWR) were used without further purifications. The bacterial strains Escherichia coli (Gram-negative, ATCC 25922), Klebsiella pneumoniae (Gramnegative, ATCC 13883), Pseudomonas aeruginosa (Gram-negative, ATCC 17423), and

Staphylococcus aureus (Gram-positive, ATCC 25323) were provided by the German Resource Center for Biological Material (DSMZ). E. coli JW0453 and E. coli JW5503 were obtained from the Keio collection.(34) Measurements. 1H-NMR spectra were recorded in deuterated solvents (CDCl3, DMSO-d6) using FT-appliances of Bruker, types DPX-300 (300 MHz), DRX-400 (400 MHz), DRX-500 (500 MHz) or FT-appliances of Varian type Inova 500 (500 MHz). The residual protons of the not fully deuterated solvents served as an internal standard.

7-(4-(4-(chloromethyl)benzyl)piperazin-1-yl)-1-cyclopropyl-6-fluoro-4-oxo-1,4dihydroquino-line-3-carboxylic acid (xCIP-Spacer): The synthesis of the xCIP-Spacer was carried out according to literature. 24

7-(4-(2-chloroacetyl)piperazin-1-yl)-1-cyclopropyl-6-fluoro-4-oxo-1,4-dihydroquino-3carboxylic acid (eCIP-Spacer): Ciprofloxacin (332 mg, 1.00 mmol, 1 eq) was suspended in 5 mL dichloromethane. Triethylamine (101 mg, 1.00 mmol, 1 eq) was added at room temperature and the reaction mixture stirred for 15 min. Chloroacetyl chlorid (0.17 g, 1.55 mmol, 1.55 eq) was slowly added to the solution at 0 °C. The reaction was heated to room temperature and stirred for 24 h at this temperature. The product was precipitated in Et2O, the supernatant was decanted and the solid residue was purified by column 18 ACS Paragon Plus Environment

Page 19 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


chromatography (SiO2; CH2Cl2:MeOH = 20:1) to get the product as slightly yellow solid (67%, 0.67 mmol, 273 mg). 13

General procedure of polymerization for Polymers with 30 repeating units: The synthesis of the Me-PMOx-EDA was carried out according to literature. 24 Me-PMOx30-EDA. 1H NMR (500 MHz, chloroform-d) δ = 1.74 – 2.20 (m, 81 H), 2.66 – 2.89 (m, 4 H), 2.91 - 3.02 (m, 3H), 3.10 – 3.72 (m, 112 H) ppm.

General procedure of xCIP-linking: xCIP-derivate (93.8 mg, 2.00 mmol, 2 eq.) and NaHCO3 (16.8 mg, 2.00 mmol, 2 eq.) were suspended in a mixture of N,N-dimethylformamide and acetonitrile (1:1, 4 mL). The polymer (300 mg, Me-PMOx30-EDA; 219 mg, 0.10 mmol, 1 eq.) was added to the suspension at room temperature. The reaction mixture was stirred at 80 °C for 24 h. The product was precipitated in Et2O and the supernatant was decanted. The residue was dissolved in water and polymers were dialyzed in membranes of Roth (ZelluTrans) with a molecular cutoff of 2000 g·mmol-1. Polymers with a lower molecular weight were dialyzed twice using membranes with a cutoff of 1000 g·mmol-1. The water was removed by lyophilization and the purify polymers were obtained in yields of 45%-85%. Me-PMOx30-EDA-xCIP. 1H NMR (400 MHz, chloroform-d) δ = 1.18 (br. s., 2 H), 1.35 (br. s., 2 H), 1.70 - 2.30 (m, 79 H), 2.54 - 2.86 (m, 8 H), 3.01 - 3.05 (m, 2 H), 3.24 - 3.72 (m, 107 H), 7.23 - 7.33 (m, 6 H), 7.89 - 7.99 (m, 1 H) 8.65 - 8.74 (m, 1 H) ppm.

General procedure of eCIP-linking: The eCIP-linking was carried out analogously to the xCIP-linking with 81.6 mg eCIP-derivate (2.00 mmol, 2 eq.).



Page 20 of 33

Me-PMOx36-EDA-eCIP. 1H-NMR (500 MHz, Chloroform-d) δ = 1.10 - 1.27 (m, 2 H), 1.40 (br. s., 2 H), 1.84 - 2.25 (m, 105 H), 2.38 (br. s., 7 H), 2.98 - 3.09 (m, 3 H), 3.23 - 3.72 (m, 148 H), 7.33 - 7.49 (m, 1 H), 7.92 - 8.07 (m, 1 H), 8.74 (s, 1 H) ppm. Bacterial Susceptibility; Minimal inhibitory concentration (MIC): The investigation of the antimicrobial activity was carried out according to literature. 24

Hemocompatibility (HC50): The investigation of the Hemocompatibility was carried out according to literature. 24

DNA sequencing: Gene amplification was performed by PCR. A colony of the respective strain was transferred to a sterile microcentrifuge tube containing 30 µL of sterile water and boiled for 5 min. A routine PCR with a single primer pair was carried out using Primers 1 and 2 (see Table 1). All Buffers and enzymes were used according to supplier’s recommendations (Thermo scientific, see Table 2). Table 1: Primer used in this study.

Primer name

Sequence

Primer 1

5’-GGGCTTCACGTTACAACGTTAC-3’

Primer 2

5’-CCTCGCATCCTCTACATGAATC-3’

Primer 3

5’-TGCCCTTAATCCGGTATCTG-3’

Primer 4

5’-CGAATGGACGTAAACAG-3’

Primer 5

5’-CCTCGCATCCTCTACATGAATC-3’


Page 21 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 2: Pipetting instructions.

Component

Amount

Sterile Water

add to 20 µL

5X Phusion HF Buffer

4 µL

10 mM dNTPs

0.4 µL

Forward Primer

0.5 µM

Reverse Primer

0.5 µM

DMSO

0.6 µL

Phusion DNA Polymerase

0.2 µL

The purification and the sequencing of the DNA strains were carried out by Eurofins genomic using Primer 1-5.

Cell Culture and Viability Assay A431 and H1975 cells were obtained from the American Type Culture Collection (ATCC). A431 cells were cultured in DMEM high glucose media (Life Technologies, Germany), and H1975 cells were cultured in RPMI media (Life Technologies, Germany), both containing Lglutamine and supplemented with 10% FBS (PAN-Biotech, Germany) and 1% PenStrep (Life Technologies, Germany) in a humidified incubator at 37 °C and 5% CO2. Cell line authentication was performed last in August 2017 by STR profiling of 16 alleles. Cells were seeded at cell numbers that assure linearity and optimal signal intensity (150 cells/well, 25 µL) and cultured for 24 hours in serum- and antibiotics-containing media in humidified chambers at 37 °C / 5% CO2. The cells were treated with EGFR inhibitors in serial dilutions (14 nM to 30 µM) with DMSO and staurosporine as control and incubated for 96 hours. Compound dilutions were generated using the acoustic dispensing system “ECHO 21 ACS Paragon Plus Environment


Page 22 of 33

520 Liquid Handler” from Labcyte (Sunnyvale, California, USA) and the according doseresponse software “Echo Dose-Response v1.5.4”. Afterwards viability studies were carried out using the CellTiter-Glo Assay (Promega, USA) that is a homogeneous method of determining the number of viable cells in culture. It is based on quantification of ATP, indicating the presence of metabolically active cells. For these studies, CellTiterGlo Reagent was prepared according to the instructions of the kit and diluted 1:1 with the complete growth medium suitable for the corresponding cell line. Thereon, reagent and assay plates were equilibrated at room temperature for 20 min. Equal volumes of the reagent were added to the volume of culture medium present in each well (25 µL). The plates were shaken for 2 minutes on an orbital shaker to induce cell lysis. The microplates were then incubated at room temperature for 20 minutes for stabilization of the luminescent signal. Following incubation, the luminescence was recorded on an EnVision microplate reader (Perkin Elmer) using 500 ms integration time. The data was then analyzed using the Quattro Software Suite for EC50-determination. As quality control the Z’-factor was calculated from 16 positive and negative control values. Only assay results showing a Z’-factor ≥0.5 were used for further analysis. All experimental points were measured in duplicates for each plate and were replicated in at least two plates.

Acknowledgement The authors would like to thank the Deutsche Forschungsgemeinschaft (DFG) for financing this project (KR 4700/1-1: Selbst-deaktivierende biozide Polymere). All polymers were synthesized using CEM Discover microwaves, which were kindly provided by CEM for ungraduated student education. We thank Dr. Wolf Hiller and his team from the department of chemistry for recording the NMR spectra at the TU Dortmund. We also thank the butcher shop Schultenhof, Dortmund for providing the fresh porcine blood. This work was supported by


Page 23 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the Ministerium für Innovation, Wissenschaft und Forschung des Landes Nordrhein Westfalen

and by grants from the Bildungsministerium für Bildung und Forschung.

Associated Content The Supporting Information is available free of charge on the ACS Publications website. 1HNMR spectra and tables with the antimicrobial and hemotoxical evaluation of different PACS.



(1)

(2)

(3)

(4) (5)

(6)

(7)

(8)

(9)

(10) (11) (12)

(13)

(14) (15) (16)

(17)

(18)

Page 24 of 33

Angulo, F. J., Collignon, P., Powers, J. H., Chiller, T. M., Aidara-Kane, A., and Aarestrup, F. M. (2009) World Health Organization Ranking of Antimicrobials According to Their Importance in Human Medicine: A Critical Step for Developing Risk Management Strategies for the Use of Antimicrobials in Food Production Animals. Clinical Infectious Diseases 49 (1), 132-141. Boucher, H. W., Talbot, G. H., Bradley, J. S., Edwards, J. E., Gilbert, D., Rice, L. B., Scheld, M., Spellberg, B., and Bartlett, J. (2009) Bad Bugs, No Drugs: No ESKAPE! An Update from the Infectious Diseases Society of America. Clinical Infectious Diseases 48 (1), 1-12. Spellberg, B., Powers, J. H., Brass, E. P., Miller, L. G., and Edwards, J. E. (2004) Trends in Antimicrobial Drug Development: Implications for the Future. Clinical Infectious Diseases 38 (9), 1279-1286. Craig, W. A. (2004) Overview of newer antimicrobial formulations for overcoming pneumococcal resistance. The American Journal of Medicine Supplements 117 (3), 16-22. Vila, J., Sánchez-Céspedes, J., Sierra, J. M., Piqueras, M., Nicolás, E., Freixas, J., and Giralt, E. (2006) Antibacterial evaluation of a collection of norfloxacin and ciprofloxacin derivatives against multiresistant bacteria. International Journal of Antimicrobial Agents 28 (1), 19-24. Das, D., Srinivasan, S., Kelly, A. M., Chiu, D. Y., Daugherty, B. K., Ratner, D. M., Stayton, P. S., and Convertine, A. J. (2016) RAFT polymerization of ciprofloxacin prodrug monomers for the controlled intracellular delivery of antibiotics. Polymer Chemistry 7 (4), 826-837. Pichavant, L., Bourget, C., Durrieu, M.-C., and Héroguez, V. (2011) Synthesis of pH-Sensitive Particles for Local Delivery of an Antibiotic via Dispersion ROMP. Macromolecules 44 (20), 7879-7887. Trousil, J., et al. (2017) System with embedded drug release and nanoparticle degradation sensor showing efficient rifampicin delivery into macrophages. Nanomedicine: Nanotechnology, Biology and Medicine 13 (1), 307-315. Peng, K.-T., Chen, C.-F., Chu, I. M., Li, Y.-M., Hsu, W.-H., Hsu, R. W.-W., and Chang, P.-J. (2010) Treatment of osteomyelitis with teicoplanin-encapsulated biodegradable thermosensitive hydrogel nanoparticles. Biomaterials 31 (19), 5227-5236. Drulis-Kawa, Z., and Dorotkiewicz-Jach, A. (2010) Liposomes as delivery systems for antibiotics. International Journal of Pharmaceutics 387 (1), 187-198. Wang, C.-H., Wang, W.-T., and Hsiue, G.-H. (2009) Development of polyion complex micelles for encapsulating and delivering amphotericin B. Biomaterials 30 (19), 3352-3358. Zhou, L., Zhang, P., Chen, Z., Cai, S., Jing, T., Fan, H., Mo, F., Zhang, J., and Lin, R. (2017) Preparation, characterization, and evaluation of amphotericin B-loaded MPEG-PCL-g-PEI micelles for local treatment of oral Candida albicans. International Journal of Nanomedicine 12, 4269-4283. Parwe, S. P., Chaudhari, P. N., Mohite, K. K., Selukar, B. S., Nande, S. S., and Garnaik, B. (2014) Synthesis of ciprofloxacin-conjugated poly (L-lactic acid) polymer for nanofiber fabrication and antibacterial evaluation. International Journal of Nanomedicine 9 (1), 1463-1477. Woo, G. L. Y., Mittelman, M. W., and Santerre, J. P. (2000) Synthesis and characterization of a novel biodegradable antimicrobial polymer. Biomaterials 21 (12), 1235-1246. Siedenbiedel, F., and Tiller, J. C. (2012) Antimicrobial Polymers in Solution and on Surfaces: Overview and Functional Principles. Polymers 4 (1), 46-71. Milović, N. M., Wang, J., Lewis, K., and Klibanov, A. M. (2005) Immobilized N-alkylated polyethylenimine avidly kills bacteria by rupturing cell membranes with no resistance developed. Biotechnology and Bioengineering 90, (6) 715-722. Krumm, C., Hijazi, M., Trump, S., Saal, S., Richter, L., Noschmann, G., Nguyen, T. D., Preslikoska, K., Moll, T., and Tiller, J. C. (2017) Highly active and selective telechelic antimicrobial poly(2-oxazoline) copolymers. Polymer 118, 107-115. Krumm, C., Harmuth, S., Hijazi, M., Neugebauer, B., Kampmann, A.-L., Geltenpoth, H., Sickmann, A., and Tiller, J. C. (2014) Antimicrobial Poly(2-methyloxazoline)s with Bioswitchable Activity through Satellite Group Modification. Angewandte Chemie International Edition 53 (15), 3830-3834. 24 ACS Paragon Plus Environment

Page 25 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(19)

(20) (21)

(22)

(23) (24)

(25)

(26)

(27)

(28)

(29)

(30)

(31) (32) (33)

(34)

(35)

Řı ́hová, B., Jelı ́nková, M., Strohalm, J., Šubr, V., Plocová, D., Hovorka, O., Novák, M., Plundrová, D., Germano, Y., and Ulbrich, K. (2000) Polymeric drugs based on conjugates of synthetic and natural macromolecules.: II. Anti-cancer activity of antibody or (Fab′)2-targeted conjugates and combined therapy with immunomodulators. Journal of Controlled Release 64 (1-3), 241-261. Haag, R., and Kratz, F. (2006) Polymer Therapeutics: Concepts and Applications. Angewandte Chemie International Edition 45 (8), 1198-1215. Turos, E., Shim, J.-Y., Wang, Y., Greenhalgh, K., Reddy, G. S. K., Dickey, S., and Lim, D. V. (2007) Antibiotic-conjugated polyacrylate nanoparticles: New opportunities for development of anti-MRSA agents. Bioorganic & Medicinal Chemistry Letters 17 (1), 53-56. Du, J., Bandara, H. M. H. N., Du, P., Huang, H., Hoang, K., Nguyen, D., Mogarala, S. V., and Smyth, H. D. C. (2015) Improved Biofilm Antimicrobial Activity of Polyethylene Glycol Conjugated Tobramycin Compared to Tobramycin in Pseudomonas aeruginosa Biofilms. Molecular Pharmaceutics 12 (5), 1544-1553. Panarin, E. F., and Solovskij, M. V. (1989) Polymer derivatives of β-lactam antibiotics of the penicillin series. Journal of Controlled Release 10 (1), 119-129. Schmidt, M., Harmuth, S., Barth, E. R., Wurm, E., Fobbe, R., Sickmann, A., Krumm, C., and Tiller, J. C. (2015) Conjugation of Ciprofloxacin with Poly(2-oxazoline)s and Polyethylene Glycol via End Groups. Bioconjugate Chemistry 26 (9), 1950-1962. Schmidt, M., Bast, L. K., Lanfer, F., Richter, L., Hennes, E., Seymen, R., Krumm, C., and Tiller, J. C. (2017) Poly(2-oxazoline)–Antibiotic Conjugates with Penicillins. Bioconjugate Chemistry 28 (9), 2440-2451. Kerns, R. J., Rybak, M. J., Kaatz, G. W., Vaka, F., Cha, R., Grucz, R. G., Diwadkar, V. U., and Ward, T. D. (2003) Piperazinyl-linked fluoroquinolone dimers possessing potent antibacterial activity against drug-resistant strains of Staphylococcus aureus. Bioorganic & Medicinal Chemistry Letters 13 (10), 1745-1749. Kerns, R. J., Rybak, M. J., Kaatz, G. W., Vaka, F., Cha, R., Grucz, R. G., and Diwadkar, V. U. (2003) Structural features of piperazinyl-linked ciprofloxacin dimers required for activity against drug-resistant strains of Staphylococcus aureus. Bioorganic & Medicinal Chemistry Letters 13 (13), 2109-2112. Azéma, J. et al.(2009) 7-((4-Substituted)piperazin-1-yl) derivatives of ciprofloxacin: Synthesis and in vitro biological evaluation as potential antitumor agents. Bioorganic & Medicinal Chemistry 17 (15), 5396-5407. Priyadarshini, R., de Pedro, M. A., and Young, K. D. (2007) Role of Peptidoglycan Amidases in the Development and Morphology of the Division Septum in Escherichia coli. Journal of Bacteriology 189 (14), 5334-5347. Ezzat, N., El Soda, M., El Shafei, H., and Olson, N. F. (1993) Cell-wall associated peptide hydrolase and esterase activities in several cheese-related bacteria. Food Chemistry 48 (1), 19-23. Wiedemann, B., and Heisig, P. (2001) Wirkungs- und Resistenzmechanismen der Chinolone: Actio und Reactio. Pharmazie in unserer Zeit 30 (5), 382-393. Hooper, D. C. (2000) Mechanisms of Action and Resistance of Older and Newer Fluoroquinolones. Clinical Infectious Diseases 31 (Suppl 2), 24-S28. Sun, J., Deng, Z., and Yan, A. (2014) Bacterial multidrug efflux pumps: Mechanisms, physiology and pharmacological exploitations. Biochemical and Biophysical Research Communications 453 (2), 254-267. Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K. A., Tomita, M., Wanner, B. L., and Mori, H. (2006) Construction of Escherichia coli< K-12 in-frame, singlegene knockout mutants: the Keio collection. Molecular Systems Biology 2 (1), 1-11. Fitzgibbon, J. E., John, J. F., Delucia, J. L., and Dubin, D. T. (1998) Topoisomerase Mutations in Trovafloxacin-ResistantStaphylococcus aureus. Antimicrobial Agents and Chemotherapy 42 (8), 2122-2124. 25 ACS Paragon Plus Environment


(36)

Page 26 of 33

Hijazi, M., Krumm, C., Cinar, S., Arns, L., Alachraf, W., Hiller, W., Schrader, W., Winter, R., and Tiller Joerg, C. (2018) Entropically driven Polymeric Enzyme Inhibitors by End-Group directed Conjugation. Chemistry – A European Journal 24 (18), 4523-4527.


Page 27 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table of contents grafic 91x53mm (150 x 150 DPI)

ACS Paragon Plus Environment


Figure 1: Syntheses strategy of the CIP conjugation via xCIP and eCIP. 166x174mm (150 x 150 DPI)


Page 28 of 33

Page 29 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2: 1H-NMR of Me-PMOx39-EDA-eCIP in CDCl3 (7.27 ppm). 160x102mm (150 x 150 DPI)



Figure 3: MIC-values of Me-PMOx39-EDA-eCIP (black) and Me-PMOx27-EDA-xCIP (striped) in comparison to the low molecular CIP (white). 158x114mm (150 x 150 DPI)


Page 30 of 33

Page 31 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4: MICS. aureus and MICE. coli of the conjugates Me-PMOxn-EDA-eCIP and Me-PMOxn-EDA-xCIP with different degrees of polymerization (n). 154x172mm (150 x 150 DPI)



Figure 5: Resistance test for the compounds CIP, xCIP, eCIP and the two conjugates Me-PMOx27-EDA-xCIP and Me-PMOx39-EDA-eCIP for the strains E. coli and S. aureus. The tests were run at least twice and the different curves each represent an individual experiment. 143x208mm (150 x 150 DPI)


Page 32 of 33

Page 33 of 33 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6: MIC-values against E. coli and its mutants of CIP, and the two conjugates Me-PMOx27-EDA-xCIP and Me-PMOx39-EDA-eCIP. 156x100mm (150 x 150 DPI)


Insights into the Kinetics of the Resistance Formation of Bacteria

Recommend Documents