Integrated and Quantitative Proteomic Approach ... - ACS Publications

Subscriber access provided by Kaohsiung Medical University

Article

An integrated and quantitative proteomic approach for charting temporal and endogenous protein complexes Mi Ke, Jie Liu, Wendong Chen, Lan Chen, Weina Gao, Yunqiu Qin, An He, Bizhu Chu, Jun Tang, Ruilian Xu, Yi Deng, and Ruijun Tian Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b02667 • Publication Date (Web): 03 Oct 2018 Downloaded from http://pubs.acs.org on October 4, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

An integrated and quantitative proteomic approach for charting temporal and endogenous protein complexes Mi Ke,§,† Jie Liu,‡,† Wendong Chen,§ Lan Chen,§ Weina Gao,§ Yunqiu Qin,§ An He,§ Bizhu Chu,§ Jun Tang,ǂ, § Ruilian Xu,ǂ Yi Deng,*,‡, ¶ Ruijun Tian,*,§,¶ §

Department of Chemistry, Southern University of Science and Technology, Shenzhen 518055, China; ‡

Department of Biology, Southern University of Science and Technology, Shenzhen 518055, China;

ǂ

Shenzhen People’s Hospital, The Second Clinical Medical College of Jinan University, Shenzhen 518020, China;

¶

Guangdong Provincial Key Laboratory of Cell Microenvironment and Disease Research, Shenzhen 518055, China.

†

These authors contribute equally.

*

E-mail: [email protected] and [email protected]. Phone: +86-755-88018905.

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Proteins often assemble into multi-protein complexes for carrying out their biological functions. Affinity purification combined with mass spectrometry (AP-MS) is a method of choice for unbiasedly charting protein complexes. Typically, genetically tagged bait protein and associated proteins are immunoprecipitated from cell lysate and subjected to in-gel or on-bead digestion for MS analysis. However, the sample preparation procedures are often time-consuming and skipping reduction and alkylation steps results in incomplete digestion. Here, by seamlessly combining AP with the simple and integrated spintip-based proteomics technology (SISPROT), we developed an integrated AP-MS workflow for simultaneously processing more than 10 AP samples from cells cultured in 6-well plates in 2 hours. Moreover, we developed a quantitation-based data analysis workflow for differentiating potential interacting proteins from nonspecific interferences. The AP-SISPROT ensures high digestion efficiency especially for large transmembrane proteins such as EGFR and high quantification precision for profiling temporal interaction network of key EGFR signaling protein GRB2 across 4 time points of EGF treatment. More importantly, the integration feature allows minimum sample lose and helps the development of an ideal AP-MS workflow for studying endogenous protein complexes by the CRISPER Cas9 technology for the first time. By generating endogenously expressed bait protein fused with affinity tag, protein complexes associated with endogenous Integrin-linked kinase (ILK) was identified with much higher selectivity as compared with overexpressed and tagged ILK. The AP-SISPROT technology and its combination with CRISPER Cas9 technology should be generally applicable for studying protein complexes in a more efficient and physiologically relevant manner.


Page 2 of 34

Page 3 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Proteins are major building blocks of the cell, playing structural, catalytic, and regulatory roles through more than 100,000 dynamic protein-protein interactions in the cell at any given time.1 These dynamic protein-protein interactions assemble proteome into various functional protein complexes which carry out almost all functions in different cellular processes such as cell cycle progression and protein synthesis and degradation.2 It is important that these protein complexes form at the right time and in the right place in a cellular signaling dependent manner.3 It is therefore important to precisely and systematically characterize these dynamic protein complexes for better understanding the dynamic nature of different cellular processes. Affinity purification and mass spectrometry (AP-MS) has been a major approach for unbiased characterization of protein complexes on a global level in the past two decades.4 Typically, an affinity tag (e.g. Flag and GFP) is genetically fused to the N-terminus or Cterminus of the protein-of-interest (called bait protein) in live cells. After the cells are treated with certain stimuli, they are lysed and the protein complexes associated with the bait protein are pulled down for MS analysis. Because normal scale of cell culture usually yields less than 10 µg of enriched proteins, traditional in-solution digestion is prone to introduce sample loss and variation for such an application. Two popular protocols are widely used for converting limited amount of purified proteins into tryptic peptides for MS analysis: in-gel digestion and on-bead digestion. For in-gel digestion, the purified proteins were separated in a SDS-PAGE gel and the targeting gel slices were reduced, alkylated, and digested. This approach has greatly facilitated the investigation of protein complexes on a global scale in variable biological systems including S.cerevisiae and



human.5-7 Although in-gel digestion is widely accepted due to its compatibility to other routine biochemical assays such as western blotting, the major drawback is that it is timeconsuming and labor-intensive. On-bead digestion is another popular and simple protocol for AP sample preparation as the trypsin digestion can be performed in the same tube right after the AP. This protocol has been widely applied for studying dynamic signaling protein complexes.8,9 However, the major drawback of this protocol is that it is prone to detergent contamination and incomplete digestion due to skipping the reduction and alkylation steps. Therefore, there is an urgent need for a robust AP sample preparation approach to obtain clean and efficiently digested protein samples from limited quantities of AP samples. Integrated sample preparation has been approved to be efficient for processing lowmicrogram quantity of protein samples for MS analysis.10-12 By integrating various sample preparation steps, including sample preconcentration, buffer exchange, reduction, alkylation and digestion into a single device, the integrated approach significantly increases the reaction efficiency and reduces sample loss and contamination. We and others have applied pressure-driven integrated sample preparation approaches to study dynamic protein complexes.13-15 Typically, affinity purified protein complexes are firstly eluted from antibody-conjugated beads and then pressure-driven trapped onto reactor column for integrated sample preparation. For example, Bisson et al. applied this sample preparation approach to study the temporal protein interaction network of the key EGFR signaling protein GRB2 upon EGF stimulation in HEK293 cells.14 In another report from the same research group, So et al. explored the protein interaction networks for more than 100 kinases using this sample preparation approach.15 Although these pressure-driven


Page 4 of 34

Page 5 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


systems based on microfluidic chip or capillary column showed high efficiency in processing limited amount of AP samples, using the pressure bomb in these systems are time-consuming and labor-intensive. It is always ideal to study protein complexes expressed at endogenous levels, which could recapitulate associated protein machineries with best physiological relevance. Current strategy for engineering cell lines transiently or stably expressing genetically tagged bait proteins often results in ten times or even higher expression level as compared with the endogenous level.4 Although it is possible to generate stable cell lines at which bait protein expression level is comparable to the endogenous level, it is time-consuming with relatively lower success rates as single cell sorting and the expansion of single-cell clones are unavoidable.9 Mann group reported a bacterial artificial chromosome (BAC) transgenes approach to generate tagged bait protein expressing to the endogenous level.16 Although this approach has been successfully applied for generating more than 1000 GFP-tagged bait proteins, the engineered cells inevitably results in containing two copies of the same bait proteins which might introduce interference in certain biological scenario. Immunoprecipitation with an antibody specifically targeting an endogenous protein has been well applied for AP-MS analysis.17 However, this approach is often limited by the quality of the antibody and results in less enrichment of the sample compare to tag-based enrichment. In this study, we aimed to develop an easy-to-use and integrated sample preparation procedure for AP-MS analysis based on our previously developed pressure-driven integrated sample preparation approach.13 Instead of using the pressure bomb for reagent loading, we adopted our recently developed simple and integrated spintip-based



proteomics technology (SISPROT) by which the integrated sample preparation including peptide desalting could be done in a single spintip device.18 The AP and SISPROT could then be seamlessly integrated by a simple acid elution of the bait protein and its associated protein complexes and completed in 2 hours. We used the AP-SISPROT to study the temporal interactome of GRB2 with high quantification precision and digestion efficiency, especially for large transmembrane protein EGFR. Furthermore, for the first time we combined the CRISPR/Cas9 and AP-MS technology to investigate protein complexes associated with endogenously tagged integrin-linked kinase (ILK). Taking advantage of the high sensitivity of the AP-SISPROT, we found that overexpressed tagged ILK pulls down significantly more proteins than endogenously tagged ILK, while only the four well-known interaction partners of ILK including PINCH-1, α-parvin, βparvin, and RSU1 were reproducibly associated with endogenous ILK. Our results demonstrated that the AP-SISPROT is a sensitive, multiplexed and quantitative approach for efficient detection of dynamic protein complexes. The combination of the APSISPROT and CRISPR/Cas9 technology provides a robust tool for studying endogenous protein complexes in a more efficient and physiologically relevant manner.

EXPERIMENTAL SECTION Generation of Stable Cell Lines and Cell Culture. A lentivirus infection system was used to construct the N-terminal triple Flag plus APEX2 tagged GRB2, CRKL, YWHAB and GFP stable cell lines according to previous report.19,20 The lentivirus system contains four plasmids: two lentiviral packaging plasmids pMDLg/pRRE and pRSV-Rev, one


Page 6 of 34

Page 7 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


envelope expressing plasmid VSV-G, and a doxycycline-inducible expression plasmid RAR3G (Addgene). The lentivirus was generated in HEK 293T cell line for 72 hours after transfection of the four aforementioned plasmids. The viruses were harvested by carefully transferring the supernatants into a syringe packed with a 0.22 µm filter. The HeLa cell line were infected with the viruses for 24 hours and subsequently treated with 0.6 µg/mL of puromycin (Sigma) for the stable cell line selection. For CRISPER Cas9-based stable cell line generation, DNA sequences encoding Venus (a variant of GFP) were introduced to the 3’- site of ILK loci in Gastric Adenocarcinoma (AGS) cells based on microhomology-mediated end-joining (MHEJ).21 The targeting sequence gcctatccttgagaagatgc located in the last exon of ILK was chosen to design guide RNA (gRNA) and cloned into Cas9 PX458 vector as described (http://crispr.mit.edu/).22 For microhomology-mediated end-joining,21 a donor vector was constructed as follows. The left arm sequence cccgggtgtgcctatccttgagaagatg containing the sequences in the last exon of ILK immediately before the selected Cas9 cutting site and a designed Cas9targeting sequence, and the right arm sequence tgcaggacaagtaggactggcccggg containing the sequences immediately after the selected Cas9 cutting site in the last exon of ILK and a designed Cas9-targeting sequence, were ligated into the pUC19 vector (Takara), which flank Venus sequence and puromycin resistant gene sequence. Two gRNAs targeting the left and right arm sequences, respectively, were also cloned into Cas9 PX458 vector as described (http://crispr.mit.edu/).22 Each of the 4 plasmids were co-transfected into AGS cells, selected for puromycin-resistant clones, and sorted by fluorescence-activated cell sorting (FACS) for single clones. To construct a plasmid expressing GFP-ILK, two primers, 5’-gagagctcgagctatggacgacattttcactcag-3’ and 5’-ctctcgaattcttacttgtcctgcatcttctc-



3’, were used to amplify ILK ORF and subcloned into pEGFP-C1 vector. To transiently express GFP-tagged ILK, AGS cells were transfected with GFP-tagged ILK with lipofectamine 3000 transfection kit. HeLa cells were cultured in DMEM medium with L-glutamine (Corning) supplemented with 10% FBS, 100 µg/mL penicillin/streptomycin (Gibco) and 0.6 µg/mL of puromycin. AGS cells were cultured in RPMI1640 medium with L-glutamine (Corning) supplemented with 10% FBS, and 100 µg/mL penicillin/streptomycin (Gibco). All cells were maintained in an incubator at 37 oC with 5% CO2. Proteomics Sample Preparation. HeLa cells stably expressing FLAG-GRB2 or FLAGGFP were induced to express FLAG-GRB2 or FLAG-GFP with doxycycline (1 mg/mL) for 24 hours, and subject to serum starvation for 3 hours. To activate the EGFR signaling, the FLAG-GRB2 cell line was treated with 100 ng/mL EGF for different times before harvest. Each experiment was carried out in triplicate. The cells were lysed in the Flag AP buffer containing 50 mM Tris, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% (v/v) Triton X100, 1 µg/mL leupeptin, 1 µg/mL pepstatin, 1 µg/mL aprotinin, 1 mM PMSF, and 1 mM Na3VO4, followed by contact sonication with 20% power of a 200 W sonicator (SCIENTZ). The obtained cell lysates were cleaned up by centrifugation at 13,000 g for 10 min and incubated with 15 µL of anti-FLAG M2 affinity gel (SIGMA) at 4 oC for 3 hours. AGS cells expressing Venus-tagged or GFP-tagged ILK were lysed in the GFP-Trap AP buffer (10 mM Tris, pH 7.4, with 150 mM NaCl, 1% NP-40, 1 µg/mL leupeptin, 1 µg/mL pepstatin, and 1 µg/mL aprotinin and 1 mM EDTA, and 1 mM PMSF), followed by sonication at the same condition. The obtained cell lysates were also cleaned up by


Page 8 of 34

Page 9 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


centrifugation at 13,000 g for 10 min and incubated with 15 µL of GFP-Trap_A (Chromotek)23 at 4oC for 3 hours (both GFP and Venus can be well recognized). After incubation, the FLAG M2 gel or GFP-Trap beads were washed one time with respective AP buffer and followed with two times of washing with 50 mM of ammonium bicarbonate. For on-bead digestion, 2 µg of trypsin (Promega) were added into the beads slurry. The samples were incubated in a 37oC incubator for about 16 hours, which is followed by the treatment with 1% formic acid (FA) to stop the digestion. The obtained peptides were desalted with a home-made spintip packed with a C18 disk and dried in a speedvac.24 For SISPROT-based digestion,18 the enriched proteins were eluted by incubating with 70 µL of 1% FA and vortexing on a mixing block for 10 min. The eluted proteins were directly loaded into the SISPROT spintip device for digestion. Briefly, a 200 µL spintip was packed with 3 pieces of C18 disk (3 M Empore) and 1.2 mg of SCX powder (Applied Biosystems) above the C18 layers. After MeOH and potassium citrate buffer (pH 2.0) washing, the eluted proteins were loaded into the spintip, followed with Tri βchlorocthyl phosphate (TCEP, pH 3.0, 10 mM) reducing for 15 min. 10 mM Iodoacetamide-based alkylation and 2.5 µg of trypsin (Promega) digestion were done simultaneously at room temperature for 60 min in dark. The peptides were eluted onto the C18 membranes with 200 mM of ammonium bicarbonate. The peptides were washed with 1% FA, eluted with 150 µL of 80% acetonitrile (ACN) and 0.5% acetic acid, and dried in a speedvac. Mass Spectrometry Analysis. The obtained peptides were resuspended in 15 µL of 0.1% (v/v) FA and 5 µL of samples were used for MS analysis. The peptides were separated by



an Easy-nLC 1000 and analyzed by an Orbitrap Fusion mass spectrometer (Thermo Fisher Scientific). The separation was done with a homemade capillary tip column (100 µm i.d. × 20 cm) packed with 0.5 cm of 3 µm/120 Å C4 and 20 cm of 1.9 µm/120 Å ReproSil-Pur C18 resins (Dr. Maisch GmbH) at a flow rate of 250 nL/min. 90 min of solvent B [0.1% (v/v) FA in ACN] gradient was programed as following: 0 min, 3%; 2 min, 7%; 77 min, 22%; 92 min, 35%; 94 min, 90%; 100 min, 90%; 102 min, 3%; 110 min, 3%. The solvent A consists of 0.1% (v/v) FA in water. The full MS scans were performed in an Orbitrap mass analyzer with the m/z range of 350 – 1550 and the mass resolution of 120,000. Peptides were selected in a quadrupole mass analyzer with 1.6 Da isolation window and fragmented by HCD with collision energy of 30 and dynamic exclusion time of 60 s. Data Analysis. The raw data was loaded into the MaxQuant software (version 1.5.5.1)25 and searched against the Uniprot Homo sapiens fasta database (162926 entries, downloaded on March 3, 2018). Cysteine carbamidomethylation (+57.0214) was set as fixed modification, and methionine oxidation (+15.9949) and asparagine/glutamine deamidation (+0.9840) was set as dynamic modifications. The label free quantification (LFQ) data were analyzed in the Perseus software (version 1.5.5.3)26 as follows. Firstly, the LFQ intensity from the “Protein Groups” txt file was loaded into the Perseus software and the proteins were filtered by “Reverse”, “Identified only by site”, and “Contamination”. Protein groups with ≥ 2 unique peptides and 3 valid values in at least one group were kept for quantification. After all the values were transformed by log2, the missing values were randomly replaced based on the total matrix. The volcano plots were created by two sample tests (p value < 0.05, S0 = 2). The missed bait unique proteins


Page 10 of 34

Page 11 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(zero or one value in GFP control group, but three values in the bait protein group) were rescued and combined with the significantly distinguished proteins from volcano plot as the potential interactome. The potential interactome were firstly ranked by LFQ intensity and 50% of the proteins with lower peptide number were further analyzed. Only proteins with 10% or less coefficient of variance (CV) of LFQ intensity were kept. The interaction network of GRB2 was constructed by Cytoscape software (version 3.6.1).27 Functional classification was done according to related annotation.9,14,28 Immunoprecipitation and western blotting. The FLAG affinity purification of GRB2, CRKL and YWHAB was done as described above. After incubation of the cell lysate with anti-FLAG M2 affinity gel, the beads were washed with FLAG AP buffer and boiled at 95 oC with SDS-PAGE loading buffer for 5 min. The obtained protein samples were separated by SDS-PAGE and transferred to membrane for western blotting analysis. The antibodies used were: anti-GRB2 (BD transduction Laboratories), anti-FLAG (Sigma Aldrich), anti-Phosphotyrosine clone 4G10 (Millipore), and the anti-ERBB2 (Cell Signaling Technology).

RESULTS AND DISCUSSION Design of the AP-SISPROT Approach. The purpose of this study is to develop an easyto-use and integrated sample preparation procedure for AP-MS analysis. The major factors to be considered to this end are as follows: (1) the technology should be able to efficiently process and digest low-microgram quantity of affinity purified protein samples. This is the typical amount of proteins one could obtain from affinity purification



of proteins obtained from cells cultured in 15-cm dish; (2) the technology should include complete steps of protein digestion including reduction, alkylation and digestion. This well-established procedure is expected to ensure complete digestion of larger proteins containing disulfide bonds; (3) the technology should be able to process the samples in a couple of hours and in a multiplex manner. We and others have developed the pressuredriven integrated sample preparation approach for fulfilling these needs.13,14 Both of the approaches were based on the similar principle as shown in Fig. 1. The affinity purified bait proteins and the associated interacting proteins through a conjugated antibody which specifically recognizes the affinity tags on the bait protein were eluted off by acidic buffer at pH 2. The obtained AP samples were loaded onto micrometer scale columns packed with strong cation exchange (SCX) beads for digestion. As majority of the proteins preserve a positive charge state at pH 2 while the SCX beads preserve a negative charge state, the affinity purified proteins were trapped onto the micrometer scale SCX column and subjected to reduction, alkylation and digestion in a nanoliter level of void space. This mechanism allows the trapped proteins to be fully digested in a couple of hours. The digested peptides are typically eluted off from the column for a separated step of C18 desalting before MS analysis. The whole process is operated on a multi-channel pressure bomb. Although these approaches fit for most of the aforementioned requirements, the pressure bomb operation makes the operation time-consuming and labor-intensive. Recently, we developed the SISPROT technology which allows full integration of the whole aforementioned sample preparation procedures, C18 desalting step, and in-line high pH RP or two dimensional fractionation into one spintip device (Fig. 1).29,30 As


Page 12 of 34

Page 13 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


compared

with

the

pressure bomb-based

integrated

sample preparation,

the

centrifugation-based design of the SISPROT allows multi-step sample preparation to be done on a standard benchtop centrifuge in 2 hours. Moreover, multiplex sample preparation can be implemented easily in a centrifuge. As shown in Fig. 1, through the acidic elution of affinity purified bait protein and associated prey proteins, the standard AP and SISPROT procedure (termed AP-SISPROT) can be seamlessly integrated together. The two most popular AP beads, including conjugated antibody and GFP-Trap, work well for the acidic elution. We systematically optimized three acidic elution buffers including 0.1% FA, 1% FA, and 50 mM glycine, pH 2, respectively (Table 1). All three buffers can efficiently recover comparable amounts of the bait protein GRB2 with sequence coverage of about 99%. However, 1% FA could recover slightly more total proteins as compared with the other two acidic buffers. The new AP-SISPROT technology by combining with 1% FA elution is therefore adopted for AP-MS analysis application, especially when small sample amount and system throughput are considered. Accurate and Sensitive AP-SISPROT Analysis Reveals High-confident GRB2 Interactome. As a first step to approve the performance of the AP-SISPROT, we carried out analysis of the interactome of GRB2, which is a well-studied key downstream adaptor protein of EGFR.14,28 GRB2 has two SH3 domains at both C-terminal and N-terminal ends which recognize hydrophobic amino acid proline, and one SH2 domain in the middle region which specifically recognizes phosphotyrosine.31,32 Upon EGF stimulation, the GRB2 protein forms tyrosine phosphorylation-dependent protein complexes. We selected the widely used GFP as a negative control for specifically distinguishing GRB2specific interacting proteins from these proteins adsorbed non-specifically onto agarose



beads during AP. As shown in Fig. 2A and Table S1 by the volcano plot, 114 potential GRB2 interacting proteins (shown in red) were significantly differentiated from the GFP control upon 2 min EGF stimulation. Among these identified proteins, many well-known GRB2 interacting proteins including EGFR, SHC1, SOS1, and GAB1 were confidently identified. When we looked more carefully at the raw data of the volcano plot generated by the Perseus software which is the most popular statistical analysis for proteomics data analysis,33,34 we found some potential GRB2-interacting proteins were buried in the pool of 790 non-significant proteins (shown in black), which contain two or three missing values in the corresponding GFP control triplicates, while no missing values in the experimental triplicates. In total, we found 77 proteins (shown in green) had the case of two or three missing values in GFP control experiments which were randomly replaced with values based on the total LFQ intensity matrix. Because their LFQ intensities in the GRB2 panels were not high enough as compared with the randomly assigned LFQ intensity values of GFP control, these proteins turned out to be non-significant in the volcano plot. However, these proteins were only specifically captured by GRB2 but not by GFP control. We therefore recovered these proteins and combined with those shown to be significant as the potential GRB2 interactome (Fig. 2C). In total, we obtained 191 potential interacting proteins for GRB2. Furthermore, the AP-SISPROT achieved high quantification precision by which majority of the potential interacting proteins had CV values of less than 30% (Fig. 2B). Interestingly, when we rank these proteins based on their abundance determined by the LFQ intensity, interacting proteins with lower abundance in the low 50% range have similar quantification precision as compared with those with high abundance. With the


Page 14 of 34

Page 15 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


high quantification precision of the AP-SISPROT, we propose a new quantitative data analysis workflow for identification of the high-confidence GRB2-interacting proteins (Fig. 2C). In this workflow, as top 50% proteins ranking by LFQ intensity shows high identification confidence, any obtained protein with less than 50% CV were kept. In our case, all the potential interacting proteins have CV values of less than 50%. Majority of the known GRB2 interacting proteins were kept as indicated by the number in the bar graph (Fig. 2B). For the remaining 50% of proteins with lower abundance ranking by LFQ intensity, only the proteins with high quantification precision of less than 10% CV were included. By these criteria, more than 1/3 of all the potential interacting proteins were removed while only one known GRB2 interacting proteins were removed, resulting in identifying 123 proteins as high-confidence GRB2 interacting proteins. Majority of them have CV values smaller than 30% (Fig. S1and Table S2). These high-confidence GRB2 interacting proteins covered well-known GRB2 related cellular functions, including 18 adaptor proteins, 3 receptors or membrane proteins, 4 GTPase regulators, 10 GAP/GEF proteins, 4 lipid signaling proteins, 5 cytoskeleton proteins, 5 phosphatases, 8 kinases, 10 ubiquitination related proteins and 14 trafficking proteins (Table S2). Furthermore, we also identified 43 proteins with unknown function relevant to GRB2. As compared with the known GRB2 interactome obtained in HEK293 cells (Fig. 2E),14 37 known GRB2-interacting proteins were commonly identified while the AP-SISPROT uniquely identified 86 potentially new GRB2-interacting proteins. The relative low overlap with the reported GRB2-interacting proteins should be explained by using the different cell lines and stimulation approaches, especially for the artificial sodium pervanadate treatment.14 Among these 86 proteins, we successfully validated the adaptor



protein CRKL as EGF stimulation-dependent interacting proteins with GRB2 (Fig. 2F). In summary, we proposed for the first time a quantification-based data analysis workflow for analyzing and filtering true interacting proteins. We further investigated the sensitivity of the AP-SISPROT with different scales of cell culture starting from 10-cm, 6-cm, one well of 6-well plate, to one well of 12-well plate. Typically, cells from one or two 15-cm culture dishes with full confluence are required for AP-MS analysis.9,35 As shown in Table 2, comparable amounts of peptide and sequence coverage of the bait protein prepared from different scales of cell culture were revealed by the AP-SISPROT, while the identified total proteins were relatively less for cells prepared from one well of 12-well plate. This result demonstrates that the APSISPROT shows good performance when working with low-microgram quantity of proteins, demonstrating good sensitivity of AP-SISPROT technology. Comparison of AP-SISPROT with On-bead Digestion. On-bead digestion is a popular approach for digesting affinity purified protein samples for MS analysis. As trypsin is added directly into the tube of AP for overnight digestion by skipping the reduction and alkylation steps, on-bead digestion significantly reduces the sample loss during multi-step sample preparation and therefore increases the system sensitivity for low-microgram quantity of affinity purified protein samples. However, the key drawback of this approach is (1) incomplete digestion caused by skipping the reduction and alkylation steps and (2) increased background caused by the direct digestion of the AP beads which carry both the affinity purified proteins and non-specific adsorbed proteins. As shown in Fig. 3A, with same amount of starting material prepared from one well of 6-well plate, both the APSISPROT and on-bead digestion could identify comparable number of proteins from


Page 16 of 34

Page 17 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


GRB2 and GFP control AP. On-bead digestion identified slightly more proteins which might be the result of digestion of non-specific adsorbed proteins. In addition, because acidic elution selectively breaks the conjugated antibody-Flag tag interaction, the APSISPROT should have better selectivity for digesting affinity purified proteins. Indeed, this was confirmed by comparing the significantly enriched proteins obtained from the AP-SISPROT with those from on-bead digestion (Fig. 3B). On-bead digestion identified significantly more proteins as compared with the AP-SISPROT for both GRB2 and GFP control AP. The trend is more significant for the case of GFP control AP. For further approve the advantage of the AP-SISPROT, we selected one GRB2-interacting protein YWHAB which is uniquely identified from the AP-SISPROT experiment. As shown in Fig. 3D, we validated YWHAB as a weak and EGF stimulation-dependent interacting protein for GRB2. Interestingly, on-bead digestion demonstrated similar identification and quantification performance with same small scale of cultured cells as starting material (Fig. 3C). When the GRB2-interacting proteins identified in both of the approaches were compared, almost all the proteins have similar sequence coverage and CV values. However, the APSISPROT significantly outperformed in the identification of EGFR with significantly higher sequence coverage. EGFR is a well-known GRB2-interacting protein upon EGF stimulation and a drug target for multiple Food and Drug Administration (FDA) approved anti-cancer drugs.36,37 With the large molecular weight of 130 kDa and more than 80 cysteine in its protein sequence, EGFR forms a rigid protein structure through multiple disulfide bonds. It was reasonable that on-bead digestion recovered less EGFR peptides by skipping the reduction and alkylation steps which selectively break disulfide bonds.



Therefore, we conclude that the AP-SISPROT is an alternative approach for AP-MS sample preparation if the duration of sample preparation, heavy background issues, and incomplete digestion are matters to be considered, especially for applications related to targeted proteomics and posttranslational modifications. Application of AP-SISPROT for Studying Temporal Interactome of GRB2. To test the quantification performance of the AP-SISPROT, we applied the technology for studying temporal interaction network of GRB2 at 4 different time points upon EGF stimulation (e.g. 0, 2, 5 and 30 min). We also challenged the throughput of the APSISPROT by processing 12 AP samples for the triplicate analysis simultaneously. As shown in Fig. 4A, the temporal profiles of the GRB2 associated protein complexes were successfully charted. The EGF stimulation-dependent formation of GRB2 associated protein complexes were readily distinguished by the statistic evaluation and volcano plot presentation. As expected, most of the GRB2 associated protein complexes were detected at 2 min of EGF stimulation, which include well-known GRB2-interacting proteins such as EGFR, SHC1, and PIK3CB. The number of GRB2-associated protein complexes was decreased slightly at 5 min of EGF stimulation, while most of the protein complexes disappeared at 30 min of EGF stimulation. Moreover, the AP-SISPROT ensured a high precision for quantitatively charting the dynamic protein complexes even when 12 AP samples were processed simultaneously (Fig. 4B and Fig. S2). As expected, the bait protein GRB2 showed a comparable level of LFQ intensity before normalization at all four time points demonstrating highly reproducible operation by the AP-SISPROT. EGFR, SHC1, and PIK3CB were quantified precisely and exhibited dynamic behavior with the highest levels detected at 2 min of EGF stimulation. In summary as shown in


Page 18 of 34

Page 19 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Fig. 4C, we observed 38 temporally regulated GRB2-associted protein complexes with different binding affinity to GRB2 and different trends of dynamic nature. Compared with previous studies of EGF-stimulated GRB2 associated protein complexes,14 we identified 30 more of these temporal protein complexes. Among these proteins, we validated that the important drug target ERBB2 have EGF stimulation-dependent temporal association with GRB2 (Fig. 4D). Comparison of Endogenous and Overexpressed ILK Interactome Revealed by APSISPROT and CRISPER Cas9 Technologies. Taking advantage of its integrated feature for working with small amount of AP samples, we next applied the AP-SISPROT for exploring low-abundance protein complexes associated with endogenously expressed bait protein. To overcome the limitation of the existing AP-MS technologies as mentioned above, we proposed to use CRISPR/Cas9-meidated targeted gene editing technology.21,22 The key advantage of this technology is that affinity tag could be introduced to the endogenous bait protein directly, which avoid the potential issue of double copies of bait protein in the same cells and provide high AP efficiency as compared with endogenous IP by antibody. As shown in Fig. 5A, we successfully engineered an AGS cell line for expressing endogenous ILK tagged with Venus protein at the C-terminus. For comparison, we also generated cell line carried with overexpressed ILK tagged with GFP protein at the C-terminus. As expected, a second copy of overexpressed GFP-tagged ILK protein was added into the cell line which has around 10 times higher expression level as compared with the endogenous ILK. The cell line generated by the CRISPER Cas9 technology only contains one copy of the Venus-tagged ILK protein with an expression level even lower than the endogenous ILK. We then performed AP-SISPROT analysis



and compared the results obtained with endogenous Venus-tagged ILK to those obtained with overexpressed GFP-tagged ILK. Surprisingly, we found that overexpressed GFPtagged ILK pulled down much more significantly enriched proteins (i.e. 336 proteins) than does endogenous Venus-tagged ILK (i.e. 9 proteins; Fig. 5B and 5C). Four wellknown interaction partners of ILK including PINCH-1 (i.e. LIMS1), α-parvin (i.e. PARVA), β-parvin (i.e. PARVB), and RSU1 were confidently identified from endogenous Venus-tagged ILK cell line with high confidence, while the result obtained from overexpressed cell line contains much more interference (Fig. 5D).38-40 These results clearly demonstrated the need for performing AP-MS analysis at endogenous level and the superior performance of the combination of AP-SISSPROT and CRISPER Cas9 technologies.

CONCLUSIONS The developed AP-SISPROT approach has provided a seamless coupling of standard affinity purification procedures with the SISPROT technology, resulting in an easy-to-use approach for generic protein complex profiling. Due to its integration feature, the sample loss for low-microgram quantity of protein complex samples is significantly reduced and the quantification precision is greatly improved. Dynamic protein complex network was successfully charted by processing more than 10 AP samples from 6-well cultured cells simultaneously. Furthermore, by further combing with the CRISPER Cas9 technology, the AP-SISPROT was successfully applied for exploring endogenous protein complexes with limited amount of protein samples. We expect that the combination of the AP-


Page 20 of 34

Page 21 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


SISPROT and the CRISPER-Cas9 technology will be helpful for studying dynamic and endogenous protein complexes in a more efficient and physiologically relevant manner.

ASSOCIATED CONTENT The supporting information available: Figures S1, Figure S2, Tables S1, and Tables S2.

ACKNOWLEDGEMENT This study was supported by grants from the China State Key Basic Research Program Grants (2016YFA0501403 and 2016YFA0501404), the Shenzhen Innovation of Science and Technology Commission (JCYJ20150901153557178, JCYJ20170412154126026, JSGG20160301103415523 and JCYJ20160229153100269), the National Natural Science Foundation

of

China

(21575057)

and

the

Guangdong

Provincial

Grants

(2017B030301018 and 2016A030312016).

REFERENCES 1. Bonetta, L. Nature 2010. 468, 851-854. 2. Alberts, B. Cell 1998. 92, 291-294. 3. Scott, J. D.; Pawson, T. Science 2009. 326, 1220-1224. 4. Gingras, A. C.; Gstaiger, M.; Raught, B.; Aebersold, R. Nat. Rev. Mol. Cell. Biol. 2007. 8, 645-654. 5. Gavin, A. C.; Bosche, M.; Krause, R.; Grandi, P.; Marzioch, M.; Bauer, A.; Schultz, J.; Rick, J. M.; Michon, A. M.; Cruciat, C. M.; Remor, M.; Hofert, C.; Schelder, M.;



Brajenovic, M.; Ruffner, H.; Merino, A.; Klein, K.; Hudak, M.; Dickson, D.; Rudi, T.; Gnau, V.; Bauch, A.; Bastuck, S.; Huhse, B.; Leutwein, C.; Heurtier, M. A.; Copley, R. R.; Edelmann, A.; Querfurth, E.; Rybin, V.; Drewes, G.; Raida, M.; Bouwmeester, T.; Bork, P.; Seraphin, B.; Kuster, B.; Neubauer, G.; Superti-Furga, G. Nature 2002. 415, 141-147. 6. Ho, Y.; Gruhler, A.; Heilbut, A.; Bader, G. D.; Moore, L.; Adams, S. L.; Millar, A.; Taylor, P.; Bennett, K.; Boutilier, K.; Yang, L.; Wolting, C.; Donaldson, I.; Schandorff, S.; Shewnarane, J.; Vo, M.; Taggart, J.; Goudreault, M.; Muskat, B.; Alfarano, C.; Dewar, D.; Lin, Z.; Michalickova, K.; Willems, A. R.; Sassi, H.; Nielsen, P. A.; Rasmussen, K. J.; Andersen, J. R.; Johansen, L. E.; Hansen, L. H.; Jespersen, H.; Podtelejnikov, A.; Nielsen, E.; Crawford, J.; Poulsen, V.; Sorensen, B. D.; Matthiesen, J.; Hendrickson, R. C.; Gleeson, F.; Pawson, T.; Moran, M. F.; Durocher, D.; Mann, M.; Hogue, C. W.; Figeys, D.; Tyers, M. Nature 2002. 415, 180-183. 7. Ewing, R. M.; Chu, P.; Elisma, F.; Li, H.; Taylor, P.; Climie, S.; McBroom-Cerajewski, L.; Robinson, M. D.; O'Connor, L.; Li, M.; Taylor, R.; Dharsee, M.; Ho, Y.; Heilbut, A.; Moore, L.; Zhang, S.; Ornatsky, O.; Bukhman, Y. V.; Ethier, M.; Sheng, Y.; Vasilescu, J.; Abu-Farha, M.; Lambert, J. P.; Duewel, H. S.; Stewart, II; Kuehl, B.; Hogue, K.; Colwill, K.; Gladwish, K.; Muskat, B.; Kinach, R.; Adams, S. L.; Moran, M. F.; Morin, G. B.; Topaloglou, T.; Figeys, D. Mol. Syst. Biol. 2007. 3, 89. 8. Gupta, G. D.; Coyaud, E.; Goncalves, J.; Mojarad, B. A.; Liu, Y.; Wu, Q.; Gheiratmand, L.; Comartin, D.; Tkach, J. M.; Cheung, S. W.; Bashkurov, M.; Hasegan, M.; Knight, J. D.; Lin, Z. Y.; Schueler, M.; Hildebrandt, F.; Moffat, J.; Gingras, A. C.; Raught, B.; Pelletier, L. Cell 2015. 163, 1484-1499. 9. Zheng, Y.; Zhang, C.; Croucher, D. R.; Soliman, M. A.; St-Denis, N.; Pasculescu, A.; Taylor, L.; Tate, S. A.; Hardy, W. R.; Colwill, K.; Dai, A. Y.; Bagshaw, R.; Dennis, J. W.; Gingras, A. C.; Daly, R. J.; Pawson, T. Nature 2013. 499, 166-171. 10. Tian, R.; Wang, S.; Elisma, F.; Li, L.; Zhou, H.; Wang, L.; Figeys, D. Mol. Cell. Proteomics 2011. 10, M110 000679. 11. Kulak, N. A.; Pichler, G.; Paron, I.; Nagaraj, N.; Mann, M. Nat. Methods 2014. 11, 319-324.


Page 22 of 34

Page 23 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


12. Hughes, C. S.; Foehr, S.; Garfield, D. A.; Furlong, E. E.; Steinmetz, L. M.; Krijgsveld, J. Mol. Syst. Biol. 2014. 10, 757. 13. Tian, R.; Hoa, X. D.; Lambert, J. P.; Pezacki, J. P.; Veres, T.; Figeys, D. Anal. Chem. 2011. 83, 4095-4102. 14. Bisson, N.; James, D. A.; Ivosev, G.; Tate, S. A.; Bonner, R.; Taylor, L.; Pawson, T. Nat. Biotechnol. 2011. 29, 653-658. 15. So, J.; Pasculescu, A.; Dai, A. Y.; Williton, K.; James, A.; Nguyen, V.; Creixell, P.; Schoof, E. M.; Sinclair, J.; Barrios-Rodiles, M.; Gu, J.; Krizus, A.; Williams, R.; Olhovsky, M.; Dennis, J. W.; Wrana, J. L.; Linding, R.; Jorgensen, C.; Pawson, T.; Colwill, K. Sci. Signal. 2015. 8, rs3. 16. Hein, M. Y.; Hubner, N. C.; Poser, I.; Cox, J.; Nagaraj, N.; Toyoda, Y.; Gak, I. A.; Weisswange, I.; Mansfeld, J.; Buchholz, F.; Hyman, A. A.; Mann, M. Cell 2015. 163, 712-723. 17. Malovannaya, A.; Lanz, R. B.; Jung, S. Y.; Bulynko, Y.; Le, N. T.; Chan, D. W.; Ding, C.; Shi, Y.; Yucer, N.; Krenciute, G.; Kim, B. J.; Li, C.; Chen, R.; Li, W.; Wang, Y.; O'Malley, B. W.; Qin, J. Cell 2011. 145, 787-799. 18. Chen, W.; Wang, S.; Adhikari, S.; Deng, Z.; Wang, L.; Chen, L.; Ke, M.; Yang, P.; Tian, R. Anal. Chem. 2016. 88, 4864-4871. 19. Dull, T.; Zufferey, R.; Kelly, M.; Mandel, R. J.; Nguyen, M.; Trono, D.; Naldini, L. J. Virol. 1998. 72, 8463-8471. 20. Rhee, H. W.; Zou, P.; Udeshi, N. D.; Martell, J. D.; Mootha, V. K.; Carr, S. A.; Ting, A. Y. Science 2013. 339, 1328-1331. 21. Nakade, S.; Tsubota, T.; Sakane, Y.; Kume, S.; Sakamoto, N.; Obara, M.; Daimon, T.; Sezutsu, H.; Yamamoto, T.; Sakuma, T.; Suzuki, K. T. Nat. Commun. 2014. 5, 5560. 22. Ran, F. A.; Hsu, P. D.; Wright, J.; Agarwala, V.; Scott, D. A.; Zhang, F. Nat. Protoc. 2013. 8, 2281-2308. 23. Albrecht, D.; Winterflood, C. M.; Ewers, H. Methods Appl. Fluoresc. 2015. 3, 024001. 24. Rappsilber, J.; Mann, M.; Ishihama, Y. Nat. Protoc. 2007. 2, 1896-1906. 25. Cox, J.; Mann, M. Nat. Biotechnol. 2008. 26, 1367-1372.



26. Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M. Y.; Geiger, T.; Mann, M.; Cox, J. Nat. Methods 2016. 13, 731-740. 27. Su, G.; Morris, J. H.; Demchak, B.; Bader, G. D. Curr. Protoc. Bioinformatics 2014. 47, 8 13 11-24. 28. Caron, E.; Roncagalli, R.; Hase, T.; Wolski, W. E.; Choi, M.; Menoita, M. G.; Durand, S.; Garcia-Blesa, A.; Fierro-Monti, I.; Sajic, T.; Heusel, M.; Weiss, T.; Malissen, M.; Schlapbach, R.; Collins, B. C.; Ghosh, S.; Kitano, H.; Aebersold, R.; Malissen, B.; Gstaiger, M. Cell Rep. 2017. 18, 3219-3226. 29. Chen, W.; Adhikari, S.; Chen, L.; Lin, L.; Li, H.; Luo, S.; Yang, P.; Tian, R. J Chromatogr. A 2017. 1498, 207-214. 30. Xue Lu, Lin Lin, Wenbin Zhou，Wendong Chen, Jun Tang, Xiujie Sun, Peiwu Huang,and Ruijun Tian. J. Chromatogr. A 2018. 1564, 76-84. 31. Nguyen, J. T.; Turck, C. W.; Cohen, F. E.; Zuckermann, R. N.; Lim, W. A. Science 1998. 282, 2088-2092. 32. Sadowski, I.; Stone, J. C.; Pawson, T. Mol. Cell. Biol. 1986. 6, 4396-4408. 33. Eberl, H. C.; Spruijt, C. G.; Kelstrup, C. D.; Vermeulen, M.; Mann, M. Mol. Cell 2013. 49, 368-378. 34. Collins, B. C.; Gillet, L. C.; Rosenberger, G.; Rost, H. L.; Vichalkovski, A.; Gstaiger, M.; Aebersold, R. Nat. Methods 2013. 10, 1246-1253. 35. Youn, J. Y.; Dunham, W. H.; Hong, S. J.; Knight, J. D. R.; Bashkurov, M.; Chen, G. I.; Bagci, H.; Rathod, B.; MacLeod, G.; Eng, S. W. M.; Angers, S.; Morris, Q.; Fabian, M.; Cote, J. F.; Gingras, A. C. Mol. Cell 2018. 69, 517-532 e511. 36. Lemmon, M. A.; Schlessinger, J. Cell 2010. 141, 1117-1134. 37. Yarden, Y.; Pines, G. Nat. Rev. Cancer 2012. 12, 553-563. 38. Dougherty, G. W.; Jose, C.; Gimona, M.; Cutler, M. L. Eur. J. Cell Biol. 2008. 87, 721-734. 39. Huang, Y.; Wu, C. Int. J. Mol. Med. 1999. 3, 563-572. 40. Wu, C. Biochim. Biophys. Acta. 2004. 1692, 55-62.


Page 24 of 34

Page 25 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


FIGURE LEGENDS Figure 1. Schematic workflow of the AP-SISPROT. Figure 2. Development of the AP-SISPROT and quantitative AP-MS analysis workflow. (A) Volcano plot of the FLAG tagged GRB2 interactome upon EGF stimulation for 2 min with FLAG-tagged GFP as control (n=3). (B) CV distribution of 191 potential GRB2interacting proteins. Numbers in the bar indicate the reported GRB2-interacting proteins.14 (C) Quantitative AP-MS analysis workflow and related data cutoff. (D) Function annotation of the final GRB2-interacting proteins. The radius of the node circle indicates the cubic root of the LFQ intensity of the indicated proteins. (E) Comparison of the identified GRB2 interactome by the AP-SISPROT and the reported GRB2 interactome.14 (F) CRKL validation by reversed AP and western blotting. Figure 3. Comparison of the AP-SISPROT with on-bead digestion by using 6-well plate cultured cells. (A) The distribution of the identified protein group and peptide numbers in the triplicate analysis of GRB2 and GFP control AP. (B) Overlap of identified proteins in GRB2 and GFP control AP by the AP-SISPROT and the on-bead digestion. (C) The distribution of protein sequence coverage and CV for the common GRB2-interacting proteins identified by the AP-SISPROT and on-bead digestion. (D) YWHAB validation by reversed AP and western blotting. Figure 4. Application of the AP-SISPROT for charting dynamic interactome of GRB2 upon 0 min, 2 min, 5 min or 30 min EGF stimulation (100 ng/mL), respectively (n = 3). 6-well plate cultured cells were used and processed simultaneously. (A) Volcano plots of the stimulation-dependent GRB2-interacting proteins of 2 min, 5 min or 30 min vs. 0 min. Identified proteins with significant change were labeled in red. (B) The LFQ



intensity distribution of the bait protein GRB2 and interacting protein SHC1, PIK3CA and EGFR. (C) Interaction network of all the stimulation-dependent GRB2-interacting proteins. Color-coded bar indicates the relative LFQ intensity of the indicated proteins at different time points. The thickness of the edge indicates the relative LFQ abundance of the GRB2-interacting proteins against highest LFQ intensity of the four time points. (D) Validation of the EGF stimulation-dependent temporal interaction between ERBB2 and GRB2 by AP and western blotting. Figure 5. Comparison of the endogenous and overexpressed interactome of ILK. (A) The expression pattern of Venus-tagged or GFP-tagged ILK and Venus in AGS cell lines as indicated by western blotting. (B-C) Volcano plots of the significant ILK-interacting proteins compared with Venus control for endogenous ILK (B) and overexpressed ILK (C). Significant changed proteins were labeled in red. (D) Interaction network of ILK. The thickness of the edge indicates the LFQ abundance of each interacting proteins.


Page 26 of 34

Page 27 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1



Figure 2


Page 28 of 34

Page 29 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3



Figure 4


Page 30 of 34

Page 31 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5



Page 32 of 34

Table 1. Acidic elution buffer optimization for the AP-SISPROT.

Elution buffer

Protein groups

Peptides

Peptides of bait protein

Sequence coverage of bait protein

Exp. 1

Exp. 2

Exp. 1

Exp. 2

Exp. 1

Exp. 2

Exp. 1

Exp. 2

0.1 % FA

1467

2329

17451

31015

51

50

98.3%

99.6%

1 % FA

2062

2569

24336

33293

51

51

98.3%

99.8%

50 mM glycine

2091

2428

22591

31362

52

51

98.3%

99.6%


Page 33 of 34 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 2. Sensitivity investigation of the AP-SISPROT. Peptides of bait protein

Sequence coverage of bait protein

Cell culture scale

Exp. 1

Exp. 2

Exp. 1

Exp. 2

Exp. 1

Exp. 2

Exp. 1

Exp. 2

10 cm

1583

1700

12852

13413

45

47

100%

100%

6 cm

1531

1607

11212

11675

40

45

97.4%

100%

6-well

1501

1625

10560

9710

41

35

97.4%

92.6%

12-well

1167

1148

8168

7724

39

31

97.4%

97.4%

Protein groups

Peptides



For TOC only


Page 34 of 34

Integrated and Quantitative Proteomic Approach ... - ACS Publications

Recommend Documents