Subscriber access provided by Macquarie University
Interfaces: Adsorption, Reactions, Films, Forces, Measurement Techniques, Charge Transfer, Electrochemistry, Electrocatalysis, Energy Production and Storage
Interface Engineering of Fully Metallic Stent Enabling Controllable H2O2 Generation for Antirestenosis Jimin Park, Hyunseon Seo, Hae Won Hwang, Jonghoon Choi, Kyeongsoo Kim, Goeen Jeong, Eun Shil Kim, Hyung-Seop Han, Yeon-Wook Jung, Youngmin Seo, Hojeong Jeon, Hyun-Kwang Seok, Yu-Chan Kim, and Myoung-Ryul Ok Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.8b03753 • Publication Date (Web): 18 Feb 2019 Downloaded from http://pubs.acs.org on February 18, 2019
Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.
is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.
Page 1 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Langmuir
Interface Engineering of Fully Metallic Stent Enabling Controllable H2O2 Generation for Antirestenosis
Jimin Park,†,‡,⊥ Hyunseon Seo,†,⊥ Hae Won Hwang,†,¶ Jonghoon Choi,† Kyeongsoo Kim,† Goeen Jeong,†,
¶
Eun Shil Kim,† Hyung-Seop Han,†,§ Yeon-Wook Jung,† Youngmin Seo,†
Hojeong Jeon,†,ǁ Hyun-Kwang Seok,†,ǁ Yu-Chan Kim,*,†,ǁ and Myoung-Ryul Ok*,†
†Center
for Biomaterials, Korea Institute of Science and Technology (KIST), Seoul 02792,
Republic of Korea. ‡Department
of Materials Science and Engineering, Massachusetts Institute of Technology,
Cambridge, Massachusetts 02139, USA. ¶Department
of Materials Science and Engineering, Seoul National University, Seoul 08826,
Republic of Korea. §Nuffield
Department of Orthopaedics, Rheumatology and Musculoskeletal Sciences,
University of Oxford, Oxford OX37LD, U.K. ǁDivision
of Bio-Medical Science and Technology, KIST School, Korea University of
Science and Technology, Seoul 02792, Republic of Korea. * Corresponding ⊥These
Authors:
[email protected] and
[email protected] authors contributed equally to this work.
1 ACS Paragon Plus Environment
Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
ABSTRACT Despite significant advances in the design of metallic materials for bare metal stents (BMSs), restenosis induced by the accumulation of smooth muscle cells (SMCs) has been a major constraint on improving the clinical efficacy of stent implantation. Here, a new strategy for avoiding this issue utilizing hydrogen peroxide (H2O2) generated by the galvanic coupling of nitinol (NiTi) stents and biodegradable magnesium-zinc (Mg-Zn) alloys is reported. The amount of H2O2 released is carefully optimized via the biodegradability engineering of the alloys and by controlling the immersion time to selectively inhibit the proliferation and function of SMCs without harming vascular endothelial cells (VECs). Based on demonstrations of its unique capabilities, a fully metallic stent with antirestenotic functionality was successfully fabricated by depositing Mg layers onto commercialized NiTi stents. The introduction of surface engineering to yield a patterned Mg coating ensured the maintenance of a stable interface between Mg and NiTi during the process of NiTi stent expansion, showing high feasibility for clinical application. This new concept of a inert metal/degradable metal hybrid system based on galvanic metal coupling, biodegradability engineering, and surface patterning can serve as a novel way to construct functional and stable BMSs for preventing restenosis.
2 ACS Paragon Plus Environment
Page 2 of 30
Page 3 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Langmuir
INTRODUCTION For decades, the successful design of biocompatible high-strength metal alloys, such as stainless-steel, PtCr, CoCr, and NiTi alloys, has led to the development of clinically viable bare metal stents (BMSs) for the treatment of coronary and peripheral artery diseases.1,2 However, restenosis, which is induced by abnormal smooth muscle cell (SMC) migration and proliferation near BMSs, continues to hinder BMSs from becoming an ideal solution for angioplasty.3,4 Various types of coatings or surface treatments were applied to BMSs for providing antirestenotic functionality.5-10 Specifically, drug-eluting stents (DESs) were developed to suppress the action of SMCs pharmacologically.5,6 However, originated from the lack of selective cell control function of the drugs, antirestenotic agents also affect the physiological environment of adjacent tissues and cells, including vascular endothelial cells (VECs), leading to new types of complications, such as delayed re-endothelialization and thrombosis.5,11 Moreover, the lack of biocompatibility or interfacial stability of coating materials may induce excessive immune responses.7,8,12,13 Therefore, there has been a continuing demand for a selective cell control technique that can inhibit the accumulation of SMCs while does not disrupting the endothelialization of VECs. Interestingly, reactive oxygen species (ROS) that are implicated in diverse physiological responses in vivo have been revealed to exert both inhibitive and promotive effects on various cells depending on their concentration.14-18 For example, it has been confirmed that a certain concentration range of nitric oxide (NO), a type of ROS existing in vivo, shows marked suppression of SMC proliferation while promoting the proliferation of VECs.19,20 Despite this interesting ability to selectively inhibit SMC proliferation, efforts to utilize ROS as drugs for DESs have been met with some obstacles to be overcome. Specifically, the short half-life of ROS donor materials renders the delivery of ROS into tissues inefficient and uncontrollable.18,21 Moreover, coating layers, including ROS reservoir 3 ACS Paragon Plus Environment
Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
materials, could easily peel off or break under the harsh conditions of stenting, such as the expansion of BMSs during implantation.21 Therefore, an alternative ROS delivery system that can be integrated with the stent and stably generate ROS in vivo while enduring high mechanical stress is still required. Recently, we reported a new ROS generation method using galvanic coupling between two metals with different chemical potentials.22 Driven by the chemical potential difference of the metals, H2O2, a typical endogenous ROS, can be spontaneously generated by dissolved O2 molecules in solution through an oxygen reduction reaction (ORR). We have shown that H2O2 could be generated by connecting highly degradable Mg and inert Ti without the usage of any H2O2-releasing carriers and demonstrated its potential for use in orthopedic applications. Considering the innate metallic nature of BMSs, this new approach based on galvanic coupling between two metals could provide unprecedented opportunities for designing new BMSs with antirestenotic functionality. Besides, as Mg and its alloys have been successfully utilized for biomedical implantable devices, the excellent biocompatibility of Mg confirmed by numerous recent studies further supports the high potential of the introduction of biodegradable Mg to BMSs.23-30 Herein, we devised a carrier-free H2O2-releasing BMS by utilizing a NiTi stent and biodegradable Mg-Zn alloys as a model system (Figure 1 and Figure S1). Galvanic coupling between the NiTi stent and Mg-Zn alloys enabled the spontaneous formation of H2O2 from dissolved O2 molecules near the stent by following reactions: (NiTi, cathode) O2 + 2H+ + 2e- → H2O2 (Mg-Zn alloys, anode) Mg + 2H2O → Mg(OH)2 + 2H+ + 2eImportantly, in addition to the introduction of a new method for generating H2O2, we systemically engineered the biodegradation kinetics and the coating pattern of the Mg-Zn alloys to optimize the antirestenotic functionality and interfacial stability of our BMSs. The 4 ACS Paragon Plus Environment
Page 4 of 30
Page 5 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Langmuir
amount of H2O2 released from the BMSs could be tightly regulated by tuning the compositional ratio of Mg to Zn in the Mg-Zn alloys and the immersion time. The optimized release of H2O2 enabled selective inhibition of the proliferation and function of human aortic smooth muscle cells (hAoSMs) without affecting those of human umbilical vein endothelial cells (HUVECs), as confirmed by various cytological evaluations. Based on demonstrations of its unique capability for antirestenosis, a fully metallic stent was fabricated by depositing a submicron-thick layer of Mg onto a commercialized NiTi stent. By adopting the surface patterning strategy of Mg coating, the interfacial stability between the Mg and NiTi stents was significantly improved compared to the nonpatterned counterparts, and the interface could be stably maintained at a highly deformed state of 44% strain.
EXPERIMENTAL SECTION Materials Preparation. To fabricate cylindrical as-cast samples of Mg alloys (Mg-1wt% Zn and Mg-3wt% Zn), commercial pure Mg (99.99wt%) and pure Zn pellets (99.99wt%) were used. The raw materials of Mg alloys were melted by gravity casting in a stainless steel crucible under Ar atmosphere. Over the crucible at 700 °C, the molten metal was poured into stainless-steel mold of a cylindrical form 100 mm in diameter and 50 mm in height. Then ascast samples of Mg alloys were cut into a plate form (10 mm × 25 mm × 2 mm). The chemical compositional ratio of the Mg-Zn alloys was evaluated by inductively coupled plasma (ICP, ARIAN 710-ES) measurement. Biomedical-grade nitinol alloy (Alfa Aesar, Ward Hill, MA, USA) was cut into a plate form (10 mm × 25 mm × 2 mm) without further purification. Electrochemical Analyses. Electrochemical analyses were conducted utilizing a conventional three-electrode system and a potentiostat (CHI 760C, CH Instruments, Inc.). All measurements were performed at 37 ± 0.5 °C. Phosphate buffer saline (PBS, 1X, Gibco, 5 ACS Paragon Plus Environment
Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Life Technologies) solution and an Ag/AgCl reference electrode (BASiAg/AgCl/3 M NaCl) were used as the electrolyte and a reference electrode, respectively. For the open circuit potential (OCP) tests, a platinum plate and Mg-Zn alloys were selected as counter and working electrodes, respectively, and the saturated OCP values were recorded after 1800 s of measurement. For the cyclic voltammetry measurements, NiTi and Mg plates were utilized as working and counter electrodes, respectively, and the curves were obtained from 0.2 V to -0.5 V (vs. Ag/AgCl) under O2- or N2-saturated conditions at a scan rate of 5 mV/s. The voltage profiles of NiTi vs. Mg, NiTi vs. Ag/AgCl, and Mg vs. Ag/AgCl were evaluated with respect to the discharge current density at a scan rate of 0.005 mA/cm2s. Rotating disk electrode (RDE) measurements were obtained according to the method described in our previous report with slight modification.22 Briefly, a NiTi plate was cured into a disk form (5 mm in diameter) and attached to the rotating disk electrode (glassy carbon, 5 mm in diameter, Pine Instruments) using silver-doped epoxy resin. Then, at five different rotating speeds (400, 625, 900, 1225, and 1600 rpm), voltammetry curves were obtained at a scan rate of 5 mV/s with the modulated speed rotator (Pine Instruments). Finally, Koutecky-Levich equation was used to estimate the number of electrons involved in the ORR at the NiTi. Spectroscopy Measurement. The amount of H2O2 generated by the Mg alloy-NiTi system was determined using a fluorometric hydrogen peroxide assay kit (Sigma-Aldrich, USA). According to the manufacturer’s protocol, after specific durations of immersing the system in PBS, endothelial growth medium (EGM), and smooth muscle cell growth medium (SmGM) solutions, each solution was collected and then mixed with hydrogen peroxide assay buffer. Then, the fluorescence intensity (λex = 540 nm, λem = 590 nm) of the mixed solution was measured using a fluorescence plate reader (Tecan, Infinite F200 Pro) to estimate the released amount of H2O2 in each solution.
6 ACS Paragon Plus Environment
Page 6 of 30
Page 7 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Langmuir
Cell Proliferation Analysis. HUVECs (Lonza, USA) and hAoSMs (Lonza, USA) were cultured in EGM (Lonza, USA) and SmGM (Lonza, USA), respectively, under standard culture conditions (37 °C, 5% CO2). For H2O2 solution treatment, standard H2O2 solutions with different concentrations (Sigma-Aldrich, USA) were added to the cell culture media for 30 min. For Mg-NiTi system treatment, Mg-NiTi connected system was immersed in the cell culture media for 60 min. After each treatment, HUVECs and hAoSMs were centrifuged to remove the supernatant media and were resuspended in fresh media. Then, HUVECs and hAoSMs were seeded onto 48 well plates at a density of 10,000 cells/cm2. Cell proliferation was
investigated
with
4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-
benzenedisulfonate (WST-1) using the EZ-Cytotox Assay Kit (ITSBIO, Korea) after 48 h of cultivation. Briefly, cells were replenished with a working solution and incubated for an additional 2 h. The enzymatic activities were then measured at 440 nm using a spectrophotometer (Versa Probe, Physical Electronics, Inc., Chanhassen, USA). Real-time reverse transcription polymerase chain reaction (RT-PCR) Analysis. For the real-time PCR analysis, HUVECs and SMCs were centrifuged to remove the supernatant media after Mg-NiTi incubation (0, 30, and 60 min) and resuspended with fresh medium. After 24 h of cultivation, total RNA was extracted from HUVECs and SMCs using Qiagen miniprep kit (Qiagen, Inc., CA, USA) according to the manufacturer’s instructions. The extracted RNA was dissolved in nuclease-free water, and the RNA concentration was quantified using a NanoDrop ND1000 Spectrophotometer (Thermo Fisher Scientific Inc., MA, USA). Complementary DNA synthesis was performed using Maxime RT PreMix (iNtRON, Korea) following the manufacturer’s instructions. All polymerase chain reactions were carried out using an ABI Prism 7500 system (Applied Biosystems, CA, USA), and gene expression levels were quantified using SYBR Premix Ex Taq (TaKaRa, Japan). The relative gene expression levels were calculated by the comparative Ct method. All target primer 7 ACS Paragon Plus Environment
Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
sequences were received from Bioneer (Korea). MMP-14 (P192192), CD31 (P274160), VEcadherin (P226761), vWF (P213195), and GAPDH (P267613) are commercially available. The following primers were used: elastin: GGTATCCCATCAAGGCCCC (forward) and TTTCCCTGTGGTGTAGGGCA (reverse). Electrochemical stimulation for localized H2O2 release to cells. The surface of gold substrates (coverslip coated with 10 nm Au, AMS Biotechnology, UK) was pretreated by oxygen plasma and fibronectin coating. Polydimethylsiloxane (PDMS) mold with holes (φ4) was put on the gold substrates. hAoSMs were cultured on the gold substrates inside the hole with a density of 2,000 cells/hole under standard culture conditions (37 °C, 5% CO2). After 3 hours of stabilization for cell adhesion, the oxygen reduction reaction (ORR) was generated by applying reductive potential (–231 mV) for 5 min and 10 min, respectively (VersaSTAT3, AMETEK, USA). The number of living cells was counted over time. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) analyses. TEM analyses were performed using an FEI Titan 80-300 microscope. The sample was cross-sectioned using an FIB (Helios NanoLab 600, FEI Co., USA). SEM and the corresponding energy-dispersive X-ray spectroscopy (EDX) mapping images of Mg-coated NiTi stents were obtained using an Inspect F50 system (FEI Co., USA) and an Apollo XL system (AMETEK Co., USA), respectively. Finite element analysis (FEA). For FEA, a three-dimensional model of the NiTi stent with a planar structure (CG Bio Co., Republic of Korea) was reconstructed using AutoCAD LT 2013 (Autodesk, Inc., USA). FEA was performed using ANSYS Workbench (version 12.0.1; ANSYS, Inc., Canonsburg, PA). The model was composed of 48375 nodes and 16451 elements. The Young’s modulus and Poisson ratio of the NiTi used in the simulation were 75 GPa and 0.3, respectively.
8 ACS Paragon Plus Environment
Page 8 of 30
Page 9 of 30 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Langmuir
Patterned Mg Coating on NiTi Stent. To isolate the Mg coating layer as an island-pattern on node regions of the planar NiTi stent (CG Bio Co., Republic of Korea), a hole-patterned mask was first fabricated. A polyimide film (Kapton, DuPont, USA) was used as the mask. Square-shaped holes with a size of 600 × 600 μm were cut using a femtosecond laser (J200 Tandem LIBS-LA Instrument, Applied Spectra, USA) following the position of the node areas of the planar stent. The wavelength, pulse duration, and pulse repetition rate were 515 nm, 400 fs, and 10 kHz, respectively, and a 10 × objective lens (Mitutoyo, Japan) was used to focus the laser pulses. The film was put on a high-precision motorized X-Y-Z linear stage (Newport Inc., USA) controlled by a PC, and the holes were cut at a stage scan speed of 10 mm/s. The fabricated mask was placed on the planar NiTi stent, positioning the holes at the nodes. A Cr thin film (~5 nm) was first deposited by DC sputtering under an Ar atmosphere as an adhesive layer between the NiTi stent and Mg coating. The Mg layer (1 μm) was then sputtered on the Cr layer using RF power of 100 W under an Ar atmosphere. Pure Cr and pure Mg sputtering targets were purchased by VTM Co. (Republic of Korea). Stretching test of a mesh structure of planar NiTi Stent. To confirm the mechanical properties of a planar NiTi stent, a sample with a width of 10 mm, thickness of 0.15 mm, and length of 10 mm was stretched at a strain rate of 10% per minute using Instron 5565 instrument. For the delamination test, nonpattened and pattened Mg-coated NiTi stents were stretched at a strain rate of 10% per minute using a x-axis motion stage. Statistical Analysis. Statistical analysis of the current data was performed utilizing one-way analysis of variance (ANOVA) and Turkey’s honest significant difference test (GraphPad Prism 5). Statistical significance was determined as ns(not significant, p>0.05), *(p
