Internal Response Correction for Fluorescent Whole-Cell Biosensors

Michel W. F. Nielen, Toine F. H. Bovee, Marcel C. van Engelen, Paula Rutgers, Astrid R. M. Hamers .... TrAC Trends in Analytical Chemistry 2006 25 (9)...
0 downloads 0 Views 80KB Size
Download PDF
Anal. Chem. 2002, 74, 5948-5953

Internal Response Correction for Fluorescent Whole-Cell Biosensors Mara Mirasoli,†,‡ Jessika Feliciano,‡ Elisa Michelini,† Sylvia Daunert,*,‡ and Aldo Roda*,†

Department of Pharmaceutical Sciences, University of Bologna, Bologna, Italy, and Departments of Chemistry and Pharmaceutical Sciences, University of Kentucky, Lexington, Kentucky 40506-0055

Whole-cell biosensors based on reporter genes are finding a variety of applications in analytical chemistry. Despite their ability to selectively recognize the analyte in a complex mixture, few applications of such sensing devices to real sample analysis are reported. This is mainly due to nonspecific effects on the biosensor response caused by components of the sample matrix and by environmental changes. To overcome this problem, a bacterial biosensor with an internal correction mechanism of the analytical response was developed by introducing an additional reporter gene that provides a reference signal of the analytical performance of the biosensor. The first reporter (GFPuv), expressed in response to the concentration of L-arabinose, provides the analytical signal; the second reporter (EYFP), constitutively expressed if a constant amount of IPTG is added to each sample, was used as an internal reference. By inducing the biosensor with varying amounts of L-arabinose and a constant amount of IPTG, it was possible to obtain a dose-response curve for L-arabinose, together with a constant production of EYFP, which allowed for a dynamic evaluation of the metabolic activity of the cell. When tested in nonoptimal conditions (e.g., in the presence of either ethanol or deoxycholic acid at toxic concentrations), the presence of the internal reference system corrected the analytical response due to nonspecific interferences. Biosensors are analytical devices or biosensing systems in which a biological component specifically recognizes and binds the target analyte. This biological component in turn is coupled to a physical transducer, capable of producing a measurable analytical signal. Their main feature is the specificity of the biological recognition system, such as antibodies, enzymes, tissues, and cells.1 Among biosensors, genetically engineered cellbased sensing systems can be obtained by providing the cell with a reporter protein, whose expression is controlled by regulatory proteins and promoter (O/P) sequences.2 The regulatory protein is able to recognize the presence of the analyte and to conse* Corresponding authors. (S.D.) Phone: (859) 257-7060. Fax: (859) 323-1069. E-mail: [email protected]. (A.R.) Phone and Fax: +39-051-343398. E-mail: [email protected], http://www.unibo.it/anchem/. † University of Bologna. ‡ University of Kentucky. (1) Vo-Dinh, T.; Cullum, B. Fresenius J. Anal. Chem. 2000, 366, 540-551. (2) Daunert, S.; Barrett, G.; Feliciano, J. S.; Shetty, R. S.; Shrestha, S.; SmithSpencer, W. Chem. Rev. 2000, 100, 2705-2738.

5948 Analytical Chemistry, Vol. 74, No. 23, December 1, 2002

quently activate the expression of the reporter protein, by unbinding the O/P region.3,4 The reporter protein can then be readily measured and directly related to the analyte concentration in the sample. Among the advantages of cell-based biosensors that employ reporter genes is signal amplification due both to multiple mRNA copies being transcribed from each reporter gene copy and to multiple reporter protein copies being synthesized from each mRNA molecule.5 However, a major limitation encountered in the use of these sensing systems is that other factors influence the response time. This is mainly due to the time required for the analyte to diffuse into the cell, as well as that required for the cell to produce a measurable amount of the reporter protein in response to the presence of the analyte.3 Another limitation that cell-based sensing systems present is irreversibility. Nevertheless, these systems are inexpensive; thus irreversibility is not a concern. Whole-cell biosensors have been developed for the detection of various analytes6-14 and using various reporter proteins.15-19 Among these, the green fluorescent protein (GFP), a highly fluorescent protein originally isolated from the jellyfish Aequorea victoria, presents various advantages: low toxicity to host cells, direct detection without addition of substrates, and the possibility to be expressed in bacteria where it spontaneously folds in its active conformation with autocatalytic fluorophore synthesis.20,21 (3) D′Souza, S. F. Biosens. Bioelectron. 2001, 16, 337-353. (4) Ko ¨hler, S.; Belkin, S.; Schmid R. D. Fresenius J. Anal. Chem. 2000, 366, 769-779. (5) Ziegler, C. Fresenius J. Anal. Chem. 2000, 366, 552-559. (6) Hansen, L. H.; Sørensen, S. J. FEMS Microbiol. Lett. 2000, 193, 123-127. (7) Biran, I.; Babai, R.; Levcov, K.; Rishpon, J.; Ron, E. Z. Environ. Microbiol. 2000, 2, 285-290. (8) Scott, D. L.; Ramanathan, S.; Shi, W.; Rosen, B. P.; Daunert, S. Anal. Chem. 1997, 69, 16-20. (9) Bontidean, I.; Lloyd, J. R.; Hobman, J. L.; Wilson, J. R.; Cso¨regi, E.; Mattiasson, B.; Brown, N. L. J. Inorg. Biochem. 2000, 79, 225-229. (10) Joyner, D. C.; Lindow, S. E. Microbiol.-UK 2000, 146, 2435-2445. (11) Prest, A. G.; Winson, M. K.; Hammond, J. R.; Stewart, G. S. Lett. Appl. Microbiol. 1997, 24, 355-360. (12) Keane, A.; Phoenix, P.; Ghoshal, S.; Lau, P. C. K. J. Microbiol. Methods 2002, 49, 103-119. (13) Kubota, L. T.; Kleinke, M. U.; Mello, C.; Bueno, M.; Neto, G. O. Chem. Phys. Lett. 1997, 264, 662-666. (14) Tucker, C. T.; Fields, S. Nat. Biotechnol. 2001, 19, 1042-1046. (15) Bronstein, I.; Fortin, J.; Stanley, P. E.; Stewart, G.; Kricka, L. J. Anal. Biochem. 1994, 219, 169-181. (16) Bronstein, I.; Martin, C. S.; Fortin, J. J.; Olesen, C. E.; Voyta, J. C. Clin. Chem. 1996, 42, 1542-1546. (17) Cubitt, A. B.; Heim, R.; Adams, S. R.; Boyd, A. E.; Gross, L. A.; Tsien, R. Y. Trends Biochem. 1995, 20, 448-455. (18) Deo, S. K.; Daunert, S. Fresenius J. Anal. Chem. 2001, 369, 258-266. (19) Beck, R.; Burtscher, H. Protein Expression Purif. 1994, 5, 192-197. (20) Tsien, R. Y. Annu. Rev. Biochem. 1998, 67, 509-544. 10.1021/ac0259008 CCC: $22.00

© 2002 American Chemical Society Published on Web 11/01/2002

The availability of GFP mutants emitting at different wavelengths allowed for the development of various dual-analyte binding assays22 and microbial biosensors.23 One main drawback encountered in the analytical application of microbial biosensors is the high variability of the response caused by sample matrix or environmental conditions (e.g., pH, presence of toxic compounds), which determine nonspecific influence on gene expression activity. These stimuli may not induce directly a generation of signal, but they may affect cell metabolism. The various metabolic pathways existing in a bacterial cell deeply influence one another; therefore, the analyte-dependent reporter protein synthesis can be influenced by a variety of changes in the cell’s environment. Consequently, the modulation of the reporter protein expression is the result not only of the specific interaction with the analyte but also of the overall viability and metabolic activity of the cell. External controls on bacterial viability (e.g., determining the number of colony-forming units per milliliter in the sample or detecting ATP levels) can be performed; however, a reduction of cell metabolism does not lead to cell death and, therefore, cannot be assessed through viability studies. Moreover, the availability of an internal control system would allow for a faster, simpler, and more reliable evaluation of the analytical response. This could be achieved by providing the whole-cell biosensor with an internal reference signal to be used for correction of the response and, consequently, isolation of the analytical signal from nonspecific stimuli. To determine whether and to what extent these nonspecific stimuli may cause an effect in the sensor response, a second reporter protein whose signal emission is not coupled to the specific regulatory protein of the target analyte should be integrated. Thus, the second reporter would be emitting a baseline signal that could be then compared to the one generated by the target analyte. In this manner, the effect of nonspecific stimuli on the response of the sensor could be assessed by using this internal correction system. This concept has been successfully employed to detect lactose using beetle luciferases from Pyrophorus plagiophthalamus 24 and by Promega in their dual-flash assays for high-throughput screening with firefly and Renilla luciferases.25 A disadvantage of the luciferase-based internal correction methods is the need for the addition of external substrates, which may hamper field applications. In contrast, the use of a naturally fluorescent protein may circumvent all these limitations of luciferases, while still allowing for internal correction. This concept has not been tested yet with GFP. Herein, we report on the development of a novel bacterial biosensor that employs two GFP mutants as reporter genes within the same plasmid, each of which can be independently measured. Since the two variants of GFP are structurally related proteins and their expression is controlled by a similar mechanism, the presence of nonstandard conditions (e.g., toxic compounds) would influence their expression in a similar fashion. This condition is necessary to utilize one of them as an internal reference of the expression of the other. We used the commercially available (21) Lewis, J. C.; Feltus, A.; Ensor, C. M.; Ramanathan, S.; Daunert, S. Anal. Chem. 1998, 70, 579A-585A. (22) Lewis, J. C.; Daunert, S. Anal. Chem. 1999, 71, 4321-4327. (23) Shrestha, S.; Shetty, R.; Ramanathan, S.; Daunert, S. Anal. Chim. Acta 2001, 444, 251-260. (24) Wood, K. V.; Gruber, M. G. Biosens. Bioelectron. 1996, 11, 207-214. (25) Sherf, B. A.; Navarro, S. L.; Hannah, R. R.; Wood, K. W. Promega Notes 1996, 57, 2-9.

plasmid pBAD-GFPuv for the detection of L-arabinose as model system.26 This plasmid contains the gfpuv gene, which codes for a variant of GFP (GFPuv) optimized for maximal fluorescence when excited by UV light, and the system that controls its expression, constituted by the O/P region of the arabinose operon (PBAD) and its regulatory protein AraC, which permits transcription of the gene only in the presence of L-arabinose. The first reporter, namely, GFPuv, provides the analytical signal, since it is expressed in response to the concentration of the target molecule (Larabinose); the second reporter gene, namely, eyfp (enhanced yellow fluorescent protein), which codes for a variant of GFP with altered excitation and emission spectra, provides a control signal, since it is constitutively expressed, independent from the presence of the analyte. The described system was obtained by modifying pBAD-GFPuv: the eyfp gene was inserted under the control of O/P region of the lactose operon (PLAC), which in Escherichia coli allows for gene transcription in the presence of isopropyl β-Dthiogalactopyranoside (IPTG). When a constant amount of IPTG is added to each sample, the expression of EYFP remains constant in standard conditions. However, whenever the expression of GFPuv is altered due to nonspecific influences on cell metabolism or viability, the expression of EYFP is altered in the same fashion, thus providing a control signal. As a result, by performing two sequential fluorescence measurements, it is possible to evaluate the overall influence of nonspecific stimuli on gene expression and accordingly correct the analytical signal. EXPERIMENTAL SECTION Reagents. Plasmids pBAD-GFPuv and pEYFP were obtained from Clontech (Palo Alto, CA). Restriction enzymes SgrA I and Nsi I were from New England BioLabs (Beverly, MA). Ampicillin, L-arabinose, isopropyl β-D-thiogalactopiranosyde, and sodium deoxycholate (DCA) were obtained from Sigma (St. Louis, MO). Bacterial culture media were prepared according to standard protocols27 containing 75 µg/mL ampicillin. All reagents were reagent grade or better and were used as received. All solutions were prepared using deionized (Milli-Q Water purification system, Millipore, Badford, MA) distilled water. Apparatus. Polymerase chain reaction (PCR) was performed on a Minicycler MJ Research (Waltham, MA). Fluorescence measurements were taken in a Cary Eclipse spectrophotometer (Varian, Victoria, Australia) equipped with a xenon pulse lamp. Fluorescence intensities reported are the averages of a minimum of three replicates and were corrected for the contribution of the blank. Construction of Plasmid pSD2001. All molecular biology procedures were performed following standard protocols.27 A fragment containing the PLAC O/P sequence and the eyfp gene was PCR amplified from pEYFP. SgrA I and Nsi I restriction sites were inserted at the ends during amplification. The following oligonucleotides were used for the PCR: TGTTGTTGTCGCCGGTGGCGCAACGCAATTAATGTGAG (1); TGAACTAGTATGCATTTACTTGTACAGCTCGTCCA (2). The underlined bases encode for the restriction enzyme cleavage site, SgrA I in 1 and (26) Shetty, R. S.; Ramanathan, S.; Badr, I. H. A.; Wolford, J. L.; Daunert, S. Anal. Chem. 1999, 71, 763-768. (27) Molecular Cloning: A Laboratory Manual; Sambrook, J., Fritsch, E. F., Maniatis, T., Eds; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, 1989; Vol. 1.

Analytical Chemistry, Vol. 74, No. 23, December 1, 2002

5949

Figure 1. Noncorrected dose-response curve for L-arabinose. GFPuv emission against log[L-arabinose] (9); signal measured from the second reporter, EYFP in the same bacterial culture aliquots (1). Data are the average ( one standard deviation (n ) 3). Inset: schematic representation of plasmid pSD2001.

Nsi I in 2. The PCR product was cloned between SgrA I and Nsi I restriction sites of the plasmid pBAD-GFPuv to yield the plasmid pSD2001 (Figure 1). The new plasmid contains the ampR gene that confers resistance to ampicillin, the gfpuv gene with the regulatory system PBAD O/P region and the araC, and the eyfp gene with its regulatory O/P region PLAC. The plasmid pSD2001 was transformed into E. coli (strain JM 109). Single colonies of the transformed bacteria, isolated on Luria Bertani agar plates, were grown in Luria Bertani broth for plasmid isolation. Restriction digestion analysis with SgrA I and Nsi I enzymes followed by a 1% agarose gel electrophoresis was employed to confirm the presence of plasmid pSD2001. A glycerol stock from a single positive colony was prepared and stored at -80 °C until further use. Fluorescence Characterization of Bacteria Transformed with pSD2001. Bacteria harboring plasmid pSD2001 were scraped from the frozen glycerol stock and grown at 37 °C in Terrific broth until the bacteria reached an optical density of 0.8 at 600 nm. A 5-mL aliquot of the bacterial culture was mixed with 50 µL of a 0.1 M solution of L-arabinose and 50 µL of a 0.1 M solution of IPTG and was incubated at 37 °C for 2 h. Cells were collected by centrifugation at 4 °C, the supernatant was discarded, the bacterial pellet was washed three times, and then 6-fold diluted with phosphate-buffered saline (PBS) buffer (10 mM Na2HPO4‚ H2O, 1 mM KH2PO4, 0.1 M NaCl, 2 mM KCl, pH 7.4). Fluorescence excitation scans were performed at an emission wavelength (λem) of 509 nm for GFPuv and 527 nm for EYFP; fluorescence emission scans were performed at an excitation wavelength (λex) of 395 nm for GFPuv and 490 nm for EYFP. Regulation of Reporter Expression. Aliquots of 5 mL of freshly grown bacteria in Terrific broth (OD ) 0.8) were incubated with L-arabinose standard solutions (to reach a final concentration of 1 × 10-1-1 × 10-6 M) at 30 °C for 2 h with shaking at 250 rpm. The cells were harvested, washed, and diluted with PBS as described above. Fluorescence emission was measured at λex ) 490 nm and λem ) 527 nm for each bacterial sample. Likewise, aliquots of 5 mL of freshly grown bacteria in Terrific broth were incubated with IPTG standard solutions (to reach a final concentration of 1 × 10-1-1 × 10-6 M) at 30 °C for 2 h with shaking at 250 rpm. Cells were harvested, washed, and diluted with PBS as described above. Fluorescence emission was measured at λex ) 395 nm and λem ) 509 nm for each bacterial sample. 5950 Analytical Chemistry, Vol. 74, No. 23, December 1, 2002

Dose-Response Curves for L-Arabinose. Aliquots of 5 mL of freshly grown bacteria in Terrific broth were mixed with L-arabinose standard solutions (to reach a final concentration of 1 × 10-1-1 × 10-6 M) and IPTG (2 × 10-3 M final concentration). Bacteria were incubated at 30 °C for 2 h with shaking at 250 rpm, harvested, washed, and diluted with PBS as described above. Fluorescence emission was measured for GFPuv (λex ) 395 nm; λem ) 509 nm) and EYFP (λex ) 490 nm; λem ) 527 nm) for each bacterial sample. Dose-response curves for L-arabinose were produced either by reporting GFPuv emission against log[L-ara] (noncorrected curve) or by reporting the ratio of GFPuv emission over EYFP emission against log[L-ara] (corrected curve). The program Prism was used to fit the data for L-arabinose dose-response curves.28 The equation for the best-fit line, produced by the program, was used to calculate the amount of L-arabinose recovered. The detection limit is defined as the L-arabinose concentration that corresponds to the blank plus three times the standard deviation. Simulation of Cell Toxicity. Dose-response curves for L-arabinose in the presence of 2 × 10-3 M IPTG were produced as described above in Terrific broth containing either various amounts of ethanol (between 0.5 and 15%) or various amounts of DCA (between 0.5 and 10 mM). In addition, single samples containing 1 × 10-3 M L-arabinose and 2 × 10-3 M IPTG were exposed to various concentrations of either ethanol (from 0.5 to 15%) or DCA (from 0.5 to 10 mM). These samples were analyzed, and the results for L-arabinose concentration were obtained by interpolation of the calibration curve previously obtained. Bacterial viability was assessed by diluting the samples in Terrific Broth through serial dilution (from 1:100 to 1:108). A volume of 100 µL of each dilution was plated on Luria Bertani agar plates containing 75 µg/mL ampicillin. Petri dishes were incubated at 37 °C for 16 h, after which colonies were counted and the number of colony-forming units (cfu) per milliliter was determined. RESULTS AND DISCUSSION We have developed a dual fluorescence reporter system with internal correction for nonspecific stimuli. A second reporter gene was integrated into a bacterial biosensor, so that its expression occurred simultaneously and in the same cell as the analytical reporter gene. Therefore, both reporters were influenced by the same nonspecific stimuli. Our aim was to demonstrate that this system allows for correction of the analytical signal obtained when samples are assayed in nonoptimal conditions (e.g., sample matrix containing toxic compounds or environmental changes). In particular, we inserted into the plasmid pBAD-GFPuv a second reporter gene coding for EYFP, a mutant variant of GFP with yellow-shifted emission, under the control of PLAC. By adding a fixed amount of IPTG in each sample, an on-line monitoring of cell viability and protein synthesis activity was obtained and utilized to perform a correction of the signal emitted by GFPuv in response to the presence of L-arabinose. Fluorescence excitation and emission spectra of GFPuv and EYFP, expressed in E. coli cells harboring the plasmid pSD2001, were studied after induction with 1 mM L-arabinose and 1 mM IPTG. GFPuv showed maximum excitation at 395 nm while that (28) GraphPad Software, Inc., San Diego, CA 92121, http://www.graphpad.com.

for EYFP was at 513 nm with a shoulder at 490 nm; GFPuv showed maximum fluorescence emission intensity at 509 nm while that for EYFP was at 527 nm. From excitation and emission spectra, the following wavelengths were chosen for subsequent experiments: λex ) 395 nm and λem ) 509 nm for GFPuv and λex ) 490 nm and λem ) 527 nm for EYFP. Experiments were performed to assess whether the expression of EYFP was independent from the PBAD promoter. In particular, bacterial aliquots were incubated with various L-arabinose concentrations (from 1 × 10-1 to 1 × 10-6 M), and fluorescence emission was measured at the optimal wavelengths for EYFP. As expected, a signal in the blank range was detected at each L-arabinose concentration. Likewise, experiments were performed to demonstrate that the expression of GFPuv was independent from the lac promoter. Bacterial aliquots were incubated with various IPTG concentrations (from 1 × 10-1 to 1 × 10-6 M), and fluorescence emission was then measured at the optimal wavelengths for GFPuv. At each IPTG concentration, a signal in the blank range was detected. Dose-response curves for L-arabinose with different incubation times, from 15 to 180 min, were performed. It was observed that dose-response curves characterized by the lowest detection limit and wider dynamic range, together with similar EYFP fluorescent intensity, were obtained with 2-h incubation time, while longer periods did not yield further improvements. Dose-response curves for L-arabinose were produced in the presence of various IPTG concentrations (in the range of 2 × 10-4-2 × 10-3 M). The maximal inducing dose for IPTG was found to be 2 × 10-3 M. Maximal inducing dose is defined as the lowest concentration capable of producing EYFP fluorescence that cannot be improved at higher concentrations. Using the optimized parameters, the bacterial biosensor showed a limit of detection (blank plus three times the standard deviation) of (5 ( 0.3) × 10-5 M for L-arabinose, with a dynamic range from 0.5 to 100 mM. At the same time, similar fluorescent intensity was obtained from constant label of EYFP in each bacterial aliquot (Figure 1). Effect of Ethanol and Sodium Deoxycholate. Ethanol is known as the most efficient inducer of the bacterial heat shock response, aside from thermal shock.29 Exposure to ethanol can thus be related to protein misfolding and denaturation, which leads to partial or complete suppression of protein synthesis.29,30 Ethanol has also been found to affect the structure of proteins, nucleic aids, and membranes,31,32 cause oxidative stress,33-35 mistranslation,36 disruption of transmembrane transport and translocation,37 (29) Neidhardt, F. C.; VanBogelen, R. A. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology; Neidhart, F. C., Ingraham, J. L., Low, K. B., Magasanik, B., Schaechter, M., Umbarger, H. E., Eds.; American Society for Microbiology: Washington, DC, 1987; pp 1334-1345. (30) Missiakas, D.; Raina, S. Trends Biochem. Sci. 1997, 22, 59-63. (31) Gustafson, C.; Tagesson, C. Br. J. Ind. Med. 1985, 42, 591-595. (32) Cronan, J. E.; Rock, C. O. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology; Neidhart, F. C., Ingraham, J. L., Low, K. B., Magasanik, B., Schaechter, M., Umbarger, H. E., Eds.; American Society for Microbiology: Washington, DC, 1987; pp 474-497. (33) Lee, P. C.; Bochner, B. R.; Ames, B. N. Proc. Natl. Acad. Sci. U.S.A. 1983, 80, 7496-7500. (34) Belkin, S.; Smulski, D. R.; Vollmer, A. C.; Van Dyk, T. K.; LaRossa, R. A. Appl. Environ. Microbiol. 1996, 62, 2252-2256. (35) Cederbaum, A. I. Free Radical Biol. Med. 2001, 31, 1524-1526. (36) So, A. G.; Davie, E. W. Biochemistry 1964, 3, 1165-1169. (37) Ingram, L. O.; Buttke, T. M. Adv. Microb. Physiol. 1984, 25, 253-300.

and to increase the stringent response in E. coli.33,38,39 All of these effects might be contributing to the altered protein expression. By using ethanol in our assays, we can assess protein damage caused by different cellular stresses, including elevated temperature. DCA has been shown to have antibacterial activity (as growth inhibitor or cytotoxic depending on its concentration) and in particular to be toxic to the cell because of its ability to cause membrane damage.40,41 DCA has been found to induce three stress responses in E. coli: the outer membrane protein OmpF that is induced by oxidative stress; the periplasmic protein that responds to osmotic shock and oxidative stress; and a protein that is induced by DNA damage and serves as an indicator of the SOS response.42 The performance of the internal reference signal was evaluated under harsh conditions by producing dose-response curves for L-arabinose in the presence of toxic compounds (either ethanol at concentrations between 0.5 and 15% or DCA at concentrations of 0.5-10 mM). Ethanol was chosen for its capacity to cause protein damage by heat shock stress, while DCA was chosen for its detergent activity and, therefore, its ability to damage cell membranes. By exposing the cell to these toxicants, the biosensing system was tested under two unique toxicity mechanisms: (1) direct targeting of protein expression with ethanol; (2) indirect effect of protein expression due to overall changes in cell metabolism with DCA. In all experiments, noncorrected and corrected dose-response curves were produced and compared with those obtained when a dose-response curve was produced under standard conditions in which toxic compounds were absent. No significant reduction of either GFPuv or EYFP expression was observed at ethanol concentrations between 0.5 and 1% and at DCA concentrations between 0.5 and 2 mM. Figure 2A shows noncorrected dose-response curves produced in the presence of 0, 1, or 2% ethanol, respectively. When compared with the curve produced in the absence of ethanol, curves produced in the presence of ethanol showed significantly lower slopes and higher detection limits ((5 ( 0.5) × 10-4 and (1 ( 0.7) × 10-3 M in the presence of 1 and 2% ethanol, respectively). As a consequence, the evaluation of L-arabinose concentration on the basis of GFPuv emission caused underestimation, due to toxic effects produced by ethanol to the bacteria. This is what would be observed with a bacterial biosensor not provided with the internal reference signal. However, when the same experimental data were used to produce corrected dose-response curves, they were superimposed, as shown in Figure 2B. This shows that a correction of the analytical signal obtained from GFPuv can be performed by means of the reference signal obtained from EYFP. The same experimental design was used to produce dose-response curves either in the absence or in the presence of 5 or 10 mM DCA. Panels A and B in Figure 3 show noncorrected and corrected dose (38) Cashel, M.; Rudd, K. E. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology; Neidhart, F. C., Ingraham, J. L., Low, K. B., Magasanik, B., Schaechter, M., Umbarger, H. E., Eds.; American Society for Microbiology: Washington, DC, 1987; pp 1410-1438. (39) Mitchell, J. J.; Lucas-Lenard, J. M. J. Biol. Chem. 1980, 255, 6307-6313. (40) Roda A.; Hofman, A. F.; Roda, E. J. Lipid Res. 1984, 25, 1477-1489. (41) Itoh, M.; Wada, K.; Tan, S.; Kitano, Y.; Kai, J.; Makino, I. J. Gastroenterol. 1999, 34, 571-576. (42) Bernstein, C.; Bernstein, H.; Payne, C. M.; Beard, S. E.; Schneider, J. Curr. Microbiol. 1999, 39, 68-72.

Analytical Chemistry, Vol. 74, No. 23, December 1, 2002

5951

Figure 2. (A) Noncorrected dose-response curve for L-arabinose (GFPuv emission against log L-arabinose concentration) produced in standard conditions (b), in the presence of 1 (2) or 2% ([) ethanol. EYFP emission measured in the same bacterial culture aliquots in standard conditions (O), in the presence of 1 (4) or 2% (]) ethanol. Data are the average ( one standard deviation (n ) 3). (B) Corrected dose-response curves for L-arabinose (ratio of GFPuv emission over EYFP emission against log [L-arabinose]) produced in standard conditions (b), in the presence of 1 (2) or 2% ([) ethanol. Data are the average ( one standard deviation (n ) 3).

Figure 3. (A) Noncorrected dose-response curves for L-arabinose (GFPuv emission against log L-arabinose concentration) produced in standard conditions (b), in the presence of 5 (2) or 10 mM DCA ([). EYFP emission measured in the same bacterial culture aliquots in standard conditions (O), in the presence of 5 (4) or 10 mM DCA (]). Data are the average ( one standard deviation (n ) 3). (B) Corrected dose-response curves for L-arabinose (ratio of GFPuv emission over EYFP emission against log [L-arabinose]) produced in standard conditions (b), in the presence of 5 (2) or 10 mM DCA ([). Data are the average ( one standard deviation (n ) 3).

response curves for L-arabinose in the presence of DCA, respectively. Additional experiments were performed by analyzing samples containing known amounts of L-arabinose, as well as a fixed amount of IPTG, and various amounts of toxic compounds (ethanol or DCA). Results for L-arabinose concentrations were interpolated either from a noncorrected or from a corrected doseresponse curve produced in the absence of toxic compounds. This experiment was intended to mimic a situation that could be encountered when real samples of unknown matrix composition are analyzed. Results in Table 1 show that, in the presence of toxic compounds, the amount of GFPuv expressed was not always directly correlated with the concentration of L-arabinose present in the sample. For example, in the presence of 2% ethanol, it was not possible to detect L-arabinose by interpolation of a noncorrected curve, since samples were below the limit of detection. However, when results were interpolated using a corrected doseresponse curve, higher recovery values for L-arabinose were obtained. As shown in Table 1, these recovery values are closer to the spiked concentration, thus providing us with a more accurate L-arabinose detection. Viability studies showed that when bacteria were grown in 1 or 2% ethanol, a 26 ( 4 and 57 ( 9% loss in viability was observed, respectively; when bacteria were grown in the presence of 5 and 10 mM deoxycholate, a 18 ( 3 and 35 ( 6% loss in viability was detected, respectively.

It has been demonstrated by others that ethanol and DCA are toxic to bacterial and eukaryotic cells, although the exact toxicity mechanisms have not yet been fully elucidated. Such effect has been attributed to a combination of cell death and altered metabolism. This is confirmed by comparing the recovery results shown in Table 1 for noncorrected dose-response curves and the viability studies. In fact, it can be observed that the reduced expression of both GFPuv and EYFP can be partly attributed to the reduction in the number of viable cells, since the loss in viability is significantly lower than the reduction in L-arabinose recovery (e.g., 26% loss in viability as compared with 57.1% loss in recovery for samples containing 1% ethanol). The reduction in cell metabolism is a result of exposing the cell to sublethal concentrations of the toxicants. Ultimately, this altered overall metabolism affects protein expression in the cell, including the reporter proteins. The presence of ethanol or DCA does not specifically affect GFPuv and EYFP expression, but alters the cell ability to synthesize new proteins. Analytical Performance. Precision and Reproducibility. As shown in Table 1, the biosensor response was evaluated using samples containing 1 × 10-3 M L-arabinose, 2 mM IPTG, and various toxic compounds to determine the corrected L-arabinose concentration. The response was reproducible, with an intra-assay variability of 11.8 ( 4.7 and an interassay variability of 17.2 ( 7.8, with six replicates. Accuracy. Table 1 shows the total L-arabinose recovery in samples with different L-arabinose concentrations (1 × 10-1, 1 ×

5952 Analytical Chemistry, Vol. 74, No. 23, December 1, 2002

Table 1. Analysis of Samples Containing Known L-Arabinose Concentrations, 2 mM IPTG, and Various Toxic Compoundsa added interfering compound

5 mM DCA 10 mM DCA 1% ethanol 2% ethanol

added L-arabinose

(mM) 100 1 0.1 1 1 1 1

measured L-arabinose ( standard deviation (mM) uncorrected corrected 77.9 ( 7.1 1.23 ( 0.06 0.0815 ( 0.0051 0.435 ( 0.085 0.148 ( 0.050 0.429 ( 0.088 ndc

88.1 ( 8.3 1.07 ( 0.05 0.0993 ( 0.0048 0.825 ( 0.073 0.489 ( 0.055 0.977 ( 0.079 0.893 ( 0.059

recoveryb ( standard deviation (%) uncorrected corrected 77.9 ( 7.1 123 ( 6 81.5 ( 5.1 43.5 ( 8.5 14.8 ( 5.0 42.9 ( 8.8

88.1 ( 8.3 107 ( 5 99.3 ( 4.8 82.5 ( 7.3 48.9 ( 5.5 97.7 ( 7.9 89.3 ( 5.9

a L-Arabinose recovery was calculated by interpolation either of a noncorrected or of a corrected dose-response curve for L-arabinose produced in standard conditions. b Recovery (%) ) (measured L-ara/added L-ara) × 100. c nd, not detected.

10-3, and 1 × 10-4 M). As expected, the recovery of L-arabinose in samples containing different amounts of ethanol and DCA is accurate only if obtained by interpolation of a corrected doseresponse curve. Moreover, in samples without toxic compounds, it can be observed that L-arabinose recoveries obtained by interpolation of both noncorrected and corrected dose-response curves show a significant difference as well. Specifically, the use of the corrected dose-response curve permits correction due to unknown factors such as variation in nutrient and oxygen supplies among others. In some of the samples, the percent recovery for L-arabinose with the corrected dose-response curve was lower than 100%, possibly due to bioavailability. For 10 mM DCA, it is possible that DCA at this concentration affects not only the metabolism of the cell but also specifically the regulation of the L-ara operon. CONCLUSIONS An internal correction system for fluorescent whole-cell biosensors has been developed. The use of microbial cells as biological sensing elements is advantageous because microorganisms are physically robust, amenable for genetic modifications, inexpensive, and easy to manipulate. We further improved the analytical performance of cell-based sensing systems by using

internal correction for nonspecific stimuli, thereby enhancing the system’s analytical robustness. The L-arabinose sensor was used as a model system to differentiate changes due to the presence of the analyte from those caused by nonspecific stimuli. Any underestimation of the analyte concentration, for example, due to adverse experimental conditions, is revealed and corrected by taking into account the expression of the second reporter gene, providing an internal baseline signal of cell viability and metabolic activity. In addition, this baseline is crucial for correction due to unknown external factors. As a result, the described internal correction system is an indicator of the overall analytical performance of the biosensor. ACKNOWLEDGMENT This work was supported by the National Science Foundation (Grant CHE-9502299M). S.D. is a Cottrell Scholar and a Lilly Faculty Awardee. J.F. is a National Science Foundation Predoctoral Fellow and a NSF IGERT Fellow.

Received for review June 28, 2002. Accepted September 26, 2002. AC0259008

Analytical Chemistry, Vol. 74, No. 23, December 1, 2002

5953