Article pubs.acs.org/JAFC
Isogarcinol Extracted from Garcinia mangostana L. Ameliorates Systemic Lupus Erythematosus-like Disease in a Murine Model Wei Li,† Hu Li,† Mu Zhang,† Youxiu Zhong,† Mengqi Wang,† Juren Cen,†,§ Hezhen Wu,‡ Yanfang Yang,‡ and Qun Wei*,† †
Department of Biochemistry and Molecular Biology, Gene Engineering and Biotechnology, Beijing Key Laboratory, Beijing Normal University, Beijing 100875, PR China ‡ College of Pharmacy, Hubei University of Chinese Medicine, Wuhan 430061, PR China § Key Laboratory of Protection and Development Utilization of Tropical Crop Germplasm Resources, Ministry of Education, College of Landscape and Horticulture, Hainan University, Haikou 570228, PR China ABSTRACT: Isogarcinol is a new immunosuppressant that we extracted from Garcinia mangostana L. In the present study, we elucidate its beneficial effect in chronic graft-versus-host disease (cGVHD) in mice -- a model for systemic lupus erythematosus (SLE) in human. The oral administration of 60 mg/kg isogarcinol significantly reduced proteinuria, corrected the abnormal serum biochemical indicator, and decreased the amount of serum antibodies and lowered the renal histopathology score. In addition, isogarcinol alleviated the abnormal activation of CD4 T cells and decreased the expression of inflammatory genes and cytokines in the kidneys and peritoneal macrophages. The mechanism of action of isogarcinol is associated with downregulation of CD4 T cells and inflammatory effects. Therefore, we believe that isogarcinol may be a potential therapeutic drug candidate for future treatment of SLE. KEYWORDS: Garcinia mangostana L., isogarcinol, systemic lupus erythematosus, CD4 T cells, chronic graft versus host disease, inflammation
■
INTRODUCTION It is popularly believed that the consumption of fruits can reduce the incidence of cancer, heart disease, cardiovascular disease, and inflammation.1 The purple mangosteen (Garcinia mangostana L.) is a tropical evergreen tree believed to have originated in the Sunda Islands and the Moluccas of Indonesia. The endocarp is the white part of the fruit containing a mild flavor that makes the fruit popular for eating, whereas the pericarp is thought to be agriculture waste.2,3 However, the pericarp of the plant has a history of use in traditional medicine, mostly in Southeast Asia. It may have been previously used to treat skin infections, wounds, dysentery, and urinary tract infections. Experimental studies have demonstrated that the extracts of mangosteen have antioxidant and antibacterial activities,4 and the use of mangosteen extracts for the prevention of chronic diseases is very popular.2 Lupus nephritis, one of the most severe complications of systemic lupus erythematosus (SLE), is associated with a loss of tolerance, production of autoantibodies, and deposition of immune complexes.5,6 Immune-complex-mediated inflammation in SLE can lead to multisystem injury including glomerulonephritis, arthritis, serositis, and blood dyscrasias.7 It is believed that chronic graft-versus-host disease (cGVHD) is a well-established model resembling SLE among the SLE-like disease models. In this model, the injection of parental DBA/2 mouse spleen cells into (C57BL/6 × DBA/2) F1 (BDF1) hybrids leads to murine cGVHD. Mice exhibit a SLE-like disease characterized by proteinuria, autoantibody production, splenomegaly, and glomerulonephritis.8−10 CD4 T cell activation and inflammation play a vital role in regulating the © 2015 American Chemical Society
self-immune response in the cGVHD mice mouse model. Common characteristics of the mouse strain combination used in cGVHD models involve disparities in Class 2 major histocompatibility complex (MHC), indicating that stimulation of CD4 T cells are crucial in SLE-cGVHD.11 Recent studies have shown that inflammation is also strongly associated in this mouse model.12,13 Cyclosporine A (CsA) is a therapy drug that can inhibit the calcineurin (CN) pathway and target T cells to modulate GVH responses.14 However, the use of CsA is often concomitant with severe hepatotoxicity and nephrotoxicity.15 Because of the side effects of this novel drug and its long-term potential, safer and more effective drugs containing natural compounds from human food or agriculture are needed. Our group focused on screening immunosuppressants from natural products with CN as the target enzyme and also focused on docking the binding domain between CN and CN inhibitors.16−18 Isogarcinol (Figure 1A) is a natural compound that we screened from G. mangostana L. with CN as the target enzyme. It is reported that isogarcinol is a new and powerful low-toxicity immunosuppressant because of its inhibition of the proliferation of spleen T-lymphocytes induced by concanavalin A and of the mixed lymphocyte reaction; oral administration of isogarcinol in mice resulted in a dose-dependent decrease in delayed type hypersensitivity and prolonged graft survival in Received: Revised: Accepted: Published: 8452
July 15, 2015 September 2, 2015 September 2, 2015 September 2, 2015 DOI: 10.1021/acs.jafc.5b03425 J. Agric. Food Chem. 2015, 63, 8452−8459
Article
Journal of Agricultural and Food Chemistry
Figure 1. Isogarcinol decreased proteinuria and reduced the histopathological changes caused by cGVHD. Chronic GVHD mouse model was induced as mentioned in Materials and Methods. Mice were placed in metabolic cages for urine collection and proteinuria was measured using the Bradford assay. Mice were sacrificed at week 10 to evaluate the histological scores in the kidney with H&E stain. (A) Chemical structure of isogarcinol. (B) Proteinuria during the development of cGVHD. (C) Isogarcinol reduced proteinuria at week 10. (D) Renal histopathology in different groups at week 10. A, glomerulus, and B, tubules. (E) Isogarcinol lowered the histological score in the kidneys. **, p < 0.01 versus control; #, p < 0.05 versus cGVHD.
allogeneic skin transplantation.19 In addition, isogarcinol showed a desirable effect on rheumatoid arthritis and its antiinflammatory effect has also been reported.20 Furthermore, isogarcinol had lower toxicity on liver and kidney function than did CsA in experimental animals.19,20 On the basis of our previous study, we hypothesized that isogarcinol can inhibit the stimulation of CD4 T cells and exhibit an anti-inflammatory effect in the cGVHD mouse model, and we aimed both to determine whether orally administered isogarcinol could be a novel and effective agent for the treatment of SLE and to elucidate the potential underlying mechanisms.
■
serum (FBS) were from Life Technologies (Carlsbad, CA, USA). RNA and quantitative real-time PCR (qRT-PCR) reagents such as oligodT primers, TaqMan Reverse Transcription Reagents, and SYBR Premix Ex Taqkit were from TaKaRa Bio (Kusatsu, Shiga, Japan). Flow cytometry antibodies such as FITC-conjugated anti-mouse CD4, PEconjugated CD8, IFN-γ, and IL-4 and Golgi Stop were brought from BD biosciences (San Jose, CA, USA). Tumor necrosis factor-α (TNFα), IL-1β, and IL-6 ELISA kits were from Neobioscience (Shenzheng, China). Murine Model of cGVHD. DBA/2 mice were sacrificed, and spleen cells were filtered through sterile mesh, lysed in hemolysis buffer, washed, and processed into single-cell suspensions. Either 0.9% NaCl (control group) or 6 × 107 DBA/2 spleen cells (other groups) per mouse were twice injected into the tail vein of a BDF1 mouse at day −7 and day 0. For the drug effect study, the mice were divided into 5 groups (n = 7): control, cGVHD, isogarcinol 30 mg/kg, isogarcinol 60 mg/kg, and CsA 30 mg/kg. For further mechanism study, the mice were divided into 3 groups (n = 4−6): control, cGVHD, and isogarcinol 60 mg/kg group. Isogarcinol is insoluble in water, so isogarcinol and CsA were dissolved in 20% DMSO and 80% distilled water. Isogarcinol and CsA were continuously given daily by gavage from day 1 until the end of the experiment. The control and the cGVHD groups received the same dose of the vehicle (20% DMSO + 80% distilled water, total of 0.2 mL per mouse per day). Animal experiments were repeated twice. Determination of Proteinuria, Serum Blood Urea Nitrogen, Triglyceride, Creatinine, and Cholesterol Content. Serum and urine were collected every 2 weeks. The mice were placed in metabolic cages for urine collection. Proteinuria was tested using the Bradford assay kit. The serum blood urea nitrogen (BUN), creatinine, triglyceride, and cholesterol levels were measured using an automatic biochemical analyzer (Olympus AU400,Tokyo, Japan).
MATERIALS AND METHODS
Six- to eight-week-old female DBA/2 and BDF1 (C57BL/6 × DBA/2) mice were purchased from Beijing Vital River. The mice were housed in a controlled environment (12 h light/12 h dark period, 25 ± 1 °C) in the Animal Center of Beijing Normal University for 1 week before gaining access to standard food and water for mice. All animal experimental procedures were conducted according to protocols approved by Ethic and Animal Welfare Committee (NO.CLS-EAW2013-015) and were conducted in strict accordance with institutional guidelines. Isogarcinol (purity >95%) was extracted and purified in our lab by J.C. Bradford assay kit was purchased from Bioteke (Beijing, China). Blood urea nitrogen, creatinine, triglyceride, and cholesterol test kits were brought from Reegen (Beijing, China). Calf thymus DNA, 3,3′5,5′-tetramethylbenzidine (TMB), rabbit antibody against mouse IgG, goat anti-mouse IgG1, lipopolysaccharide (LPS, L2880), phorbol, 12myristate 13-acetate (PMA), and ionomysin were purchased from Sigma (St. Louis, MO USA). HRP-conjugated rabbit anti-goat IgG and HRP-conjugated goat anti-mouse IgG were brought from CST (Danvers, MA, USA). TRIzol reagent, DMEM, and fetal bovine 8453
DOI: 10.1021/acs.jafc.5b03425 J. Agric. Food Chem. 2015, 63, 8452−8459
Article
Journal of Agricultural and Food Chemistry
Figure 2. Isogarcinol corrected abnormal serum indices in the cGVHD mice. Chronic GVHD mouse model was induced as mentioned in Materials and Methods. Serum was collected every 2 weeks, and the serum indices were measured by an automatic biochemical analyzer. Isogarcinol lowered (A) blood urea nitrogen, (B) creatinine, (C) triglyceride, and (D) cholesterol in the cGVHD mouse model. The bars show the mean ± SEM (n = 7). **, p < 0.01 versus control; # and ##, p < 0.05 and p < 0.01 versus cGVHD, respectively. Determination of Serum Antibody Production. The serum anti-double-stranded DNA (anti-dsDNA) or total antibody was tested by ELISA as follows: Microtiter plates were coated with calf thymus DNA. Then, HRP-conjugated goat anti-mouse IgG was added, followed by TMB. The reaction was stopped with 2 M H2SO4, and the plates were read at 450 nm in a Polarstar Omega (BMG labtech, Cary, NC, USA). Serum IgG1 was measured as follows: Microtiter plates were coated with rabbit antibody against mouse IgG. Goat antimouse IgG1 was used as primary antibody. The HRP-conjugated rabbit anti-goat IgG was then added as the secondary antibody. TMB and H2SO4 were added in order, and the plates were read at 450 nm. The samples were diluted 1:250. Real-Time PCR. Mice were sacrificed at the end of the experiment, and total RNA was isolated from the fresh spleen and kidney using TRIzol reagent. Then, cDNA synthesis was initiated by adding oligodT primers and TaqMan Reverse Transcription Reagents. qRTPCR was performed according to the instructions of SYBR Premix Ex Taqkit in an Applied Biosystems 7500 fast Real-Time PCR system (Thermo Fisher, Grand Island, NY, USA). β-actin was used for normalization, and the sequences of the primers used are as follows: Tbet, gttcaaccagcaccagacagag (forward), tggtccaccaagaccacatc (reverse); GATA-3, ggatgtaagtcgaggcccaag (forward), attgcaaaggtagtgcccggta (reverse); IFN-γ cggcacagtcattgaaagccta (forward), gttgctgatggcctgattgtc (reverse); IL-4 acggagatggatgtgccaaac (forward), agcaccttggaagccctacaga (reverse), TNF-α, actccaggcggtgcctatgt (forward), gtgagggtctgggccatagaa (reverse); IL-1β tccaggatgaggacatgagcac (forward), gaacgtcacacaccagcaggtta (reverse); IL-6 caacgatgatgcacttgcaga (forward), ctccaggtagctatggtactccaga (reverse); β-actin, agagggaaatcgtgcgtgac (forward), caatagtgatgacctggccgt (reverse). Flow Cytometry. BDF1 mice were sacrificed at week 8, and spleen cells were filtered through sterile mesh, lysed in hemolysis buffer, washed, and processed into single-cell suspensions. To determine the content of CD4 and CD8, single-cell suspensions were directly used without stimulation of PMA and ionomysin. FITC-conjugated antimouse CD4 and PE-conjugated CD8 were used for the flow cytometry assay.
To determine the intracellular cytokine staining, the cells were cultured in 20% FBS DMEM for 2 h. Then, 100 ng/mL PMA and 1000 ng/mL ionomycin together with Golgi Stop were added for an additional 4 h. Next, the cells were harvested, blocked, and stained with FITC-conjugated anti-mouse CD4, PE-conjugated anti-mouse IFN-γ, and PE-conjugated anti-mouse IL-4 according to the respective manufacturer’s protocol. Finally, the cells were analyzed on a FACS Calibur flow cytometer system with CellQuest software (BD, San Jose, CA, USA). Macrophage Preparation and Cytokine Measurement. At the end of the experiment, macrophages of every group of mice were collected and adjusted to 1 × 106/mL in plates. Then, cells were cultured in 20% FBS DMEM at 37 °C for 2 h. Then, cells were stimulated by 10 μg/mL LPS for an additional 12 h before culture supernatants were harvested. Cytokines in culture supernatants, such as TNF-α, IL-1β, and IL-6, were determined using ELISA kits. Renal Histopathology. The mice were sacrificed at week 10 to evaluate the histological scores in the kidney. After being fixed in 4% formalin and embedded in paraffin, the kidney was sectioned, mounted on slides, and stained with H&E. Each observer was blinded when evaluating each section, scoring the glomeruli, and classifying the lesion.21 The following scale was applied: 0, normal morphology; 1, moderate expansion of the glomerular matrix without glomerulonephritis; 2, mild glomerulonephritis with mesangial hypercellularity and/or segmental necrosis; 3, moderate glomerulonephritis with extensive sclerosis and/or loop necrosis and/or cellular crescent; 4, severe glomerulonephritis with large area of loop necrosis and cellular crescent. Statistical Analyses. The results are expressed as the means ± standard error of the mean (SEM). One-way analysis of variation (ANOVA) followed by Bonferroni’s multiple comparison test was used to compare experimental groups and the control groups. The statistical analyses were performed in GraphPad Prism 5.0 software. The level of statistical significance was set at p < 0.05. 8454
DOI: 10.1021/acs.jafc.5b03425 J. Agric. Food Chem. 2015, 63, 8452−8459
Article
Journal of Agricultural and Food Chemistry
Figure 3. Isogarcinol decreases serum autoantibodies in cGVHD mouse model. Chronic GVHD mouse model was induced as mentioned in Materials and Methods. Serum was collected every 2 weeks and ELISA assay was used to determine the content of serum IgG1 and anti-dsDNA antibody. (A) Isogarcinol reduced the content of serum IgG1 at week 10 ; (B) Isogarcinol reduced the content of serum anti-dsDNA antibody. The bars show the mean ± SEM (n = 7). **, p < 0.01 versus control; #, p < 0.05 versus cGVHD.
■
RESULTS Isogarcinol Reduced Proteinuria and Ameliorated Histopathological Changes Caused by cGVHD. Nephritis is a notable characteristic in both human SLE and the animal SLE model.10,12 During the experiment, increased proteinuria was observed in cGVHD mice at week 6 and continued to increase in the following weeks. Daily treatment with 30 and 60 mg/kg isogarcinol significantly decreased proteinuria (Figure 1B,C). Renal histopathology was evaluated at week 10 after cGVHD induction with H&E stain (Figure 1D). Severe glomerulonephritis with extensive sclerosis was observed in cGVHD mice, and the renal histopathology score was significantly higher in the cGVHD group compared to that in the control group (3.3 versus 0.2, p < 0.01). Treatment with 60 mg/kg isogarcinol lowered the score to 2.0 (p < 0.05) (Figure 2E). Isogarcinol Corrected Abnormal Serum Triglyceride, Creatinine, Blood Urea Nitrogen and Cholesterol in cGVHD Mice. SLE is a systemic autoimmue disease that affects many internal organs in the body. It is reported that during the experiment the biochemical indices such as triglyceride, creatinine, blood urea nitrogen, and cholesterol in serum were increased in similar models.10,13,22 We measured the concentration of these indices every 2 weeks with an automatic biochemical analyzer and found that the indices of cGVHD group mice exhibited a significant high level. Treatment with 60 mg/kg isogarcinol and 30 mg/kg CsA significantly lowered these indices (Figure 2). Isogarcinol Reduced Serum anti-dsDNA Antibody and IgG1 Concentrations. Anti-dsDNA antibody is the signature antibody in the cGVHD mouse model and in human SLE. It is documented that IgG1 was also upregulated in this model.10 Serum was collected every 2 weeks, and levels of antidsDNA antibody as well as of IgG1 were determined using ELISA assay. The results manifested that after treatment with isogarcinol the anti-dsDNA and IgG1 antibodies were inhibited (Figure 3A,B). Treatment with 60 mg/kg isogarcinol and 30 mg/kg CsA were equally effective in preventing anti-dsDNA and IgG1 antibody. Isogarcinol Alleviated the CD4 Activation in the cGVHD Mouse Model. From all of the above results, the new immunosuppressant isogarcinol displayed an outstanding effect in the cGVHD mouse model. Next, we divided the mice into 3 groups: control, cGVHD, and 60 mg/kg isogarcinol for the further mechanism studies (n = 4−6). CD4 T cell activation and interaction with CD8 T cells, together with the antibody-
producing B cells, have been a major focus of investigation in SLE-cGVHD, and both CD4 T cell expansion and ineffective CD8 T cells play a role in the model.23 Flow cytometry was applied to measure the proportion of CD4/spleen cells and the ratio of CD4/CD8. The experimental results exhibited that both were increased in the cGVHD mice, whereas isogarcinol lowered them (Figure 4A,B). These results suggest that isogarcinol might alleviate CD4 activation during the development of cGVHD. Furthermore, we extracted RNA directly from spleen cells, and the gene expression levels of Th1 (T-bet) and Th2 (GATA-3) and their key cytokines IFN-γ and IL-4 were determined. All four genes were significantly upregulated in spleen cells, whereas isogarcinol decreased their expression (Figure 4C−E). Next, we tried to evaluate the activation form of CD4 T cells. After stimulation by 100 ng/mL PMA and 1000 ng/mL ionomycin and together with Golgi stop for another 4 h, the spleen cells were intracellularly strained for IFN-γ and IL-4. Flow cytometry was used to determine the content of CD4+IFN+ and CD4+IL4+ in spleen cells. We found that both cytokines of CD4 T cells, IFN-γ and IL-4, were increased in the cGVHD mice (Figure 5A). We also calculated the absolute content of IFN-γ+CD4+ and IL-4+CD4+ cells, and treatment with isogarcinol markedly reduced the secretion (Figure 5B). Furthermore, the relative content of the cells was also measured, and the ratio of IFN-γ+ and IL-4+ in CD4+ T cells also decreased after isogarcinol treatment (Figure 5C). In total, these results suggest that isogarcinol alleviated CD4 activation in both inactivated form and under activated condition. Isogarcinol Exhibited Anti-Inflammatory Effects in the cGVHD Mouse Model. After stimulation with various agents such as LPS, macrophages participate in quite a few autoimmune diseases through a number of mechanisms. A variety of signal pathways are involved in the action of macrophages such as secretion of cytokines. Finally, at week 8 peritoneal macrophages were collected and cultured in vitro for the ELISA test. The levels of inflammatory cytokines TNF-α, IL-1β, and IL-6 were determined after stimulation with LPS. We found that the expression of three kinds of inflammatory cytokines was increased in cGVHD mice, yet the treatment of isogarcinol lowered these levels (Figure 6A). The overproduction of autoantibodies assembled in kidney and deposition of immune complexes results in inflammation, then finally renal failure. In the process, inflammatory cytokines play a crucial role in the effect of inflammation. At week 8, 8455
DOI: 10.1021/acs.jafc.5b03425 J. Agric. Food Chem. 2015, 63, 8452−8459
Article
Journal of Agricultural and Food Chemistry
and ameliorated lethal renal injury (Figure 1), corrected the abnormal biochemical index in serum (Figure 2), and significantly lowered the serum antibody (Figure 3). Further work with 60 mg/kg isogarcinol treatment inhibited the activation of CD4 T cells (Figures 4 and 5) and inflammation in kidneys and macrophages (Figure 6). The therapeutic effect of isogarcinol may at least partially contribute to the inhibition of CD4 T cells and the inflammation effect. In our further work with 60 mg/kg isogarcinol treatment, we picked week 3 (day 21) and week 8 (day 56) to evaluate the CD4 expansion and inflammatory cytokine secretion. However, we did not find any differences among the groups at week 3 (data not shown). Recognition of the foreign MHC of the F1 host by parental spleen cells leads to a GVH disease. There are two major types of GVHD: acute and chronic.28 Compared to acute GVHD, which is more likely to reflect apoptosis and necrosis, chronic GVHD is characterized by inflammatory and fibrotic processes.29,30 During the development of cGVHD, stimulation of CD4 T cells plays an paramount role in SLE-cGVHD, and both CD4 T cell expansion and ineffective CD8 T cells play a role in this model. Similar reports demonstrated that genetic lupus mice displayed increased CD4 T cell activation at a higher CD4/CD8 ratio.31,32 In our present study, we compared the ratio of CD4/CD8 and CD4/spleen cells, and we found that treatment with 60 mg/kg isogarcinol could alleviate the activation of CD4 cells. Depending on the pattern of cytokine production, CD4+ T cells can be divided into at least three different subsets: Th1, Th2, and Th17 cells. Th1 cells preferentially produce IFN-γ and IL-2, which activate macrophages and stimulate production of IgG2a in mice. Th2 cells preferentially produce IL-4 and IL10, which provide potent B cells and help induce IgG1 production in mice. It has been traditionally reported that the cytokines produced during acute GVHD are Th1 cells, whereas those produced during cGVHD are Th2 cytokines. However, recent studies have suggested that cGVHD could be caused by cytokines secreted by Th1 cells.33,34 The mechanisms leading to the development of cGVHD are still not completely understood. In similar models, there was a significant expansion of Th2 cells in the early phase (week 2) of the model,35 whereas some reported that both Th1 and Th2 cells were increased but that the increase of Th2 cells was more significant.8,12 In our experiment, we found serum IgG1 (Figure 3) and IL-4 (data not shown) increased in cGVHD mice at week 10. These results suggest that there might be Th2 cell expansion in this model. However, the gene expressions of Th1 (T-bet) and Th2 (GATA-3) and their key cytokines IFN-γ and IL-4 were all increased in spleen cells before stimulation (Figure 4). Furthermore, after the stimulation with PMA and ionomysin, we compared the absolute content and relative content of Th1 and Th2 cells, and the results were similar to the inactivated experiments (Figure 5). In addition, we did not find any differences of Th17 cells at week 8 (data not shown). In our previous work, we have reported that isogarcinol significantly inhibited the proliferation of murine spleen Tlymphocytes induced by ConA.19 These results indicate to us that isogarcinol downregulates both Th1 and Th2 cells and alleviates CD4 activation resulting in attenuation of lupus-like disease. We also found isogarcinol significantly decreased NO production and inducible nitric oxide synthase mRNA expression in the LPS-stimulated RAW 264.7 macrophages and the anti-inflammatory effect associated with isogarcinol in
Figure 4. Isogarcinol alleviated the CD4 activation in cGVHD mouse model. At week 8, spleen cells of BDF1 mice were processed into single-cell suspensions and directly stained for flow cytometry test without stimulation. (A) Isogarcinol decreased the CD4 in spleen cells. (B) Isogarcinol reduced the ratio of CD4/CD8. In contrast, total RNA of fresh spleen tissues was extracted, and the expressions of relevant genes were measured using qRT-PCR. The expression levels of (C) Tbet, (D) GATA-3, (E) IFN-γ, and (F) IL-4 were lowered by isogarcinol. The bars show the mean ± SEM (n = 4−6). **, p < 0.01 versus control; # and ##, p < 0.05 and p < 0.01 versus cGVHD, respectively.
mRNA was directly extracted from the kidneys, and qRT-PCR was performed to analyze the inflammatory gene factors. The mRNA expression of TNF-α and IL-6 were prominently reduced in the isogarcinol group compared to expression in the cGVHD group, but we did not find any differences of IL-1β among the groups (Figure 6B). Together, these results suggest that the anti-inflammatory effects of isogarcinol might protect against the disease.
■
DISCUSSION Injecting DBA/2 spleen cells into the tail vein of a BDF1 mouse can lead to an SLE-like disease resembling human SLE.24−26 Compared to the traditional gene SLE models, such as (NZB × NZW) F1 and MRL/lpr mouse models, chronic GVHD models are easier to control, more adjustable, and have a shorter period that are widely used in studying the mechanism of quite a few chronic diseases. In our SLE model, the female donor will make the female host more vulnerable to SLE than a male, which is similar to human SLE.27 All of these reasons make our mouse model a favorable model for the lupus study. In our present work, we proved that the immunosuppressant isogarcinol (especially 60 mg/kg group) markedly prevented the development of proteinuria 8456
DOI: 10.1021/acs.jafc.5b03425 J. Agric. Food Chem. 2015, 63, 8452−8459
Article
Journal of Agricultural and Food Chemistry
Figure 5. Isogarcinol alleviated PMA/ionomycin induced CD4 activation in cGVHD mouse model. At week 8, spleen cells of BDF1 mice were processed into single-cell suspensions and were cultured in 20% FBS DMEM for 2 h. After stimulatation by 100 ng/mL of PMA and 1000 ng/mL ionomycin and together with Golgi stop for another 4 h, the spleen cells were harvested and then intracellularly strained with IFN-γ and IL-4 on CD4 T cells. Flow cytometry was used to determine the content of CD4+IFN+ and CD4+IL4+ in spleen cells. (A) The content of CD4+IFN+ and CD4+IL4+ cells in the different groups. (B) Isogarcinol lowered the absolute content (AC) of spleen cells. (C) Isogarcinol lowered relative content (RC) of CD4+ cells. AC = IFN-γ+CD4+(IL-4+CD4+)/spleen cells; RC = IFN-γ+CD4+(IL4+CD4+)/Total CD4+ cells. The bars show the mean ± SEM (n = 4−6). **, p < 0.01 versus control; # and ##, p < 0.05 and p < 0.01 versus cGVHD, respectively.
chronic inflammatory arthritis.19,20 The inflammatory cytokines TNF-α, IL-1β, and IL-6 produced by macrophages play an essential role in responding to infection and inflammation. Moreover, the kidney mRNA levels of TNF-α and IL-1β as well as protein levels in lupus-prone MRL/lpr mice have been found to increase.36 We first tested the cytokines of the macrophages and found the inflammatory cytokines, such as TNF-α, IL-6, and IL-1β, were highly expressed in cGVHD mice. The gene expression in kidneys of two inflammatory cytokines, TNF-α and IL-6, displayed a similar result (Figure 6). Treatment with 60 mg/kg isogarcinol can effectively reduce inflammatory cytokine secretion and finally protect the injury of the kidneys and prevent proteinuria (Figure 1). These results suggest that the anti-inflammatory effects of isogarcinol may protect from the GVH response. Antibody- and immune-complex-mediated inflammation in SLE can trigger the development of glomerulonephritis, arthritis, and serositis. The most common cause of death in SLE is renal failure, and the 5-year survival rate is approximately 77%. Current therapies for lupus are broad-spectrum, including steroids and immunosuppressants, which are compromised by
toxicity and side effects in the medications. Immunosuppressants, such as CsA, can inhibit the CN pathway and target T cells to regulate GVH responses. In our present research, we found a similar effective therapy between daily oral 60 mg/kg isogarcinol and 30 mg/kg CsA in preventing proteinuria, autoantibodies, and abnormal serum indicators. However, the CsA group manifested a higher renal histological score than did the isogarcinol group (Figure 1). In addition, during the experiment, a significant body weight change in the CsA treatment mice and abdominal edema was observed during the experiment (data not shown), and because of edema, the CsA group mice showed less activity than the other mice group. All of these may have to do with the toxicity of CsA with daily oral treatment. Moreover, we compared the toxicity of CsA and isogarcinol for both in vitro and in vivo experiments. Isogarcinol exhibited a better viability of spleen cells, and the serum indices, such as glutamic-pyruvic transaminase, glytamicoxalacetic transaminease, total bilirubin, urea nitrogen, and creatinine, were abnormally high in the CsA group compared with the isogarcinol group.19 Similar experiments regarding the toxicity of CsA were found in the collagen-induced arthritis 8457
DOI: 10.1021/acs.jafc.5b03425 J. Agric. Food Chem. 2015, 63, 8452−8459
Article
Journal of Agricultural and Food Chemistry
Figure 6. Isogarcinol exhibited an anti-inflammatory effect in the cGVHD mouse model. At week 8, macrophages of BDF1 mice were collected and adjusted to 1 × 106/mL in plates. Cells were cultured in 20% FBS DMEM for 2 h then stimulated with LPS in vitro for 12 h. The supernatants were harvested for the ELISA assay. (A) Isogarcinol reduced the content of TNF-α, IL-1β, and IL-6 expression. Messenger RNA of kidney tissue was directly extracted, and relevant genes were measured using qRT-PCR. (B) The effect of Isogarcinol on gene expression of TNF-α, IL-6, and IL-1β in the kidneys. The bars show the mean ± SEM (n = 4−6). **, p < 0.01 versus control; # and ##, p < 0.05 and p < 0.01 versus cGVHD, respectively.
mouse model.37 These results all link with the severe hepatotoxicity and nephrotoxicity of CsA. In our present work, we found an immunosuppression and anti-inflammatory effect of isogarcinol extracted from mangosteen fruit. Therefore, we have reason to expect it will become a potential candidate drug in the future. Isogarcinol is a low-toxicity, peroral compound we extracted from mangosteen fruit. Experimental data in this study elucidated that it is effective against SLE-like disease, and the therapeutic effect was associated with the downregulation of the activation of CD4 T cells and the inflammatory effect.
■
mangostana) product in humans. J. Agric. Food Chem. 2009, 57, 8788−92. (3) Jung, H. A.; Su, B. N.; Keller, W. J.; Mehta, R. G.; Kinghorn, A. D. Antioxidant xanthones from the pericarp of Garcinia mangostana (Mangosteen). J. Agric. Food Chem. 2006, 54, 2077−82. (4) Pedraza-Chaverri, J.; Cardenas-Rodriguez, N.; Orozco-Ibarra, M.; Perez-Rojas, J. M. Medicinal properties of mangosteen (Garcinia mangostana). Food Chem. Toxicol. 2008, 46, 3227−39. (5) Eisenberg, R. A.; Via, C. S. T cells, murine chronic graft-versushost disease and autoimmunity. J. Autoimmun. 2012, 39, 240−7. (6) Shlomchik, M. J.; Craft, J. E.; Mamula, M. J. From T to B and back again: positive feedback in systemic autoimmune disease. Nat. Rev. Immunol. 2001, 1, 147−53. (7) Wenderfer, S. E.; Ke, B.; Hollmann, T. J.; Wetsel, R. A.; Lan, H. Y.; Braun, M. C. C5a receptor deficiency attenuates T cell function and renal disease in MRLlpr mice. J. Am. Soc. Nephrol. 2005, 16, 3572− 3582. (8) Kuroiwa, T.; Iwasaki, T.; Imado, T.; Sekiguchi, M.; Fujimoto, J.; Sano, H. Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease. Arthritis. Res. Ther 2006, 8, R123. (9) Schorlemmer, H. U.; Brendel, S.; Bartlett, R. R. Malononitrilamides prevent the development of murine systemic lupus erythematosus-like diseases in BDF1 hybrid mice and MRL/lpr autoimmune mice. Transplant. Proc. 1996, 28, 3040−3042. (10) Xiao, Z. Y.; Chen, S. H.; Cheng, J. P.; Zhou, W. X.; Zhang, Y. X.; Yang, R. F.; Yun, L. H. Y27, a novel derivative of 4-hydroxyquinoline3-formamide, prevents the development of murine systemic lupus erythematosus-like diseases in MRL/lpr autoimmune mice and BDF1 hybrid mice. Arthritis. Res. Ther 2012, 14, R235. (11) Via, C. S.; Shearer, G. M. T-cell interactions in autoimmunity: insights from a murine model of graft-versus-host disease. Immunol. Today 1988, 9, 207−13. (12) Zhang, J. L.; Sun, D. J.; Hou, C. M.; Wei, Y. L.; Li, X. Y.; Yu, Z. Y.; Feng, J. N.; Shen, B. F.; Li, Y.; Xiao, H. CD3 mAb treatment ameliorated the severity of the cGVHD-induced lupus nephritis in mice by up-regulation of Foxp3+ regulatory T cells in the target tissue: kidney. Transplant Immunol. 2010, 24, 17−25. (13) Xiao, Z. Y.; Zhou, W. X.; Zhang, Y. X.; Cheng, J. P.; He, J. F.; Yang, R. F.; Yun, L. H. Roquinimex-mediated protection effect on the development of chronic graft-versus-host disease in mice is associated with induction of Th1 cytokine production and inhibition of proinflammatory cytokine production. Life Sci. 2007, 81, 1403−10.
AUTHOR INFORMATION
Corresponding Author
*Tel.: 86-010-58807365. Fax: 86-010-58807365. E-mail:
[email protected]. Funding
The work was supported by the National Natural Science Foundation of China, the National Important Novel Medicine Research Project, and the special fund of the coconstruction project from the Beijing Education Committee. Notes
The authors declare no competing financial interest.
■
ABBREVIATIONS anti-dsDNA, anti-double-stranded DNA; BUN, blood urea nitrogen; cGVHD, chronic graft versus host disease; CN, calcineurin; CsA, cyclosporine A; FBS, fetal bovine serum; IFNγ, interferon gamma; LPS, lipopolysaccharides; PMA, phorbol, 12-myristate 13-acetate; SLE, systemic lupus erythematosus; TNF-α, tumor necrosis factor-α
■
REFERENCES
(1) Feskanich, D.; Ziegler, R. G.; Michaud, D. S.; Giovannucci, E. L.; Speizer, F. E.; Willett, W. C.; Colditz, G. A. Prospective study of fruit and vegetable consumption and risk of lung cancer among men and women. J. Natl. Cancer. Inst 2000, 92, 1812−1823. (2) Kondo, M.; Zhang, L.; Ji, H.; Kou, Y.; Ou, B. Bioavailability and antioxidant effects of a xanthone-rich Mangosteen (Garcinia 8458
DOI: 10.1021/acs.jafc.5b03425 J. Agric. Food Chem. 2015, 63, 8452−8459
Article
Journal of Agricultural and Food Chemistry
versus-host disease, a model for human scleroderma. J. Invest. Dermatol. 2007, 127, 281−92. (34) Nishimori, H.; Maeda, Y.; Teshima, T.; Sugiyama, H.; Kobayashi, K.; Yamasuji, Y.; Kadohisa, S.; Uryu, H.; Takeuchi, K.; Tanaka, T.; Yoshino, T.; Iwakura, Y.; Tanimoto, M. Synthetic retinoid Am80 ameliorates chronic graft-versus-host disease by downregulating Th1 and Th17. Blood 2012, 119, 285−95. (35) Rus, V.; Svetic, A.; Nguyen, P.; Gause, W. C.; Via, C. S. Kinetics of Th1 and Th2 cytokine production during the early course of acute and chronic murine graft-versus-host disease. Regulatory role of donor CD8+ T cells. J. Immunol. 1995, 155, 2396−2406. (36) Boswell, J. M.; Yui, M. A.; Burt, D. W.; Kelley, V. E. Increased tumor necrosis factor and IL-1 beta gene expression in the kidneys of mice with lupus nephritis. J. Immunol. 1988, 141, 3050−3054. (37) Fu, Y.; Zhou, H.; Wang, S.; Wei, Q. Glycyrol suppresses collagen-induced arthritis by regulating autoimmune and inflammatory responses. PLoS One 2014, 9, e98137.
(14) MacDonald, K. P.; Shlomchik, W. D.; Reddy, P. Biology of graftversus-host responses: recent insights. Biol. Blood Marrow Transplant. 2013, 19, S10−4. (15) Scott, L. J.; McKeage, K.; Keam, S. J.; Plosker, G. L. Tacrolimus: a further update of its use in the management of organ transplantation. Drugs 2003, 63, 1247−97. (16) Lei, H.; Luo, J.; Tong, L.; Peng, L. Q.; Qi, Y.; Jia, Z. G.; Wei, Q. Quercetin binds to calcineurin at a similar region to cyclosporin A and tacrolimus. Food Chem. 2011, 127, 1169−74. (17) Peng, L.; Qi, Y.; Wu, H.; Wei, Q. Interaction of glycyrol with calcineurin A studied by spectroscopic methods and docking. IUBMB Life 2011, 63, 14−20. (18) Cen, J.; Wang, M.; Jiang, G.; Yin, Y.; Su, Z.; Tong, L.; luo, J.; Ma, Y.; Gao, Y.; Wei, Q. The new immunosuppressant, isogarcinol, binds directly to its target enzyme calcineurin, unlike cyclosporin A and tacrolimus. Biochimie 2015, 111, 119−24. (19) Cen, J.; Shi, M.; Yang, Y.; Fu, Y.; Zhou, H.; Wang, M.; Su, Z.; Wei, Q. Isogarcinol is a new immunosuppressant. PLoS One 2013, 8, e66503. (20) Fu, Y.; Zhou, H.; Wang, M.; Cen, J.; Wei, Q. Immune regulation and anti-inflammatory effects of isogarcinol extracted from Garcinia mangostana L. against collagen-induced arthritis. J. Agric. Food Chem. 2014, 62, 4127−34. (21) Senuma, A.; Hagiwara, E.; Nagahama, K.; Okuda, K.; Nakamura, M.; Fukumoto, N.; Shirai, A.; Tani, K.; Ishigatsubo, Y. Therapeutic effect of CpG motifs on the development of chronic graft-versus-host disease in mice. Cytokine+ 2002, 20, 23−29. (22) Xiao, Z. Y.; Chen, S. H.; Zhou, W. X.; Zhang, Y. X.; Cheng, J. P.; Yang, R. F. H1521, a novel derivative of 4-hydroxyquinoline-3carboxamide, suppresses the development of lupus in mice by inducing Th1 cytokine profile in T cells. Int. Immunopharmacol. 2011, 11, 435− 43. (23) Chu, Y. W.; Gress, R. E. Murine models of chronic graft-versushost disease: insights and unresolved issues. Biol. Blood Marrow Transplant. 2008, 14, 365−78. (24) Slayback, D. L.; Dobkins, J. A.; Harper, J. M.; Allen, R. D. Genetic factors influencing the development of chronic graft-versushost disease in a murine model. Bone Marrow Transplant. 2000, 26, 931−8. (25) Gleichmann, E.; Pals, S. T.; Rolink, A. G.; Radaszkiewicz, T.; Gleichmann, H. Graft-versus-host reactions: clues to the etiopathology of a spectrum of immunological diseases. Immunol. Today 1984, 5, 324−32. (26) Sasaki, M.; Hasegawa, H.; Kohno, M.; Inoue, A.; Ito, M. R.; Fujita, S. Antagonist of secondary lymphoid-tissue chemokine (CCR ligand 21) prevents the development of chronic graft-versus-host disease in mice. J. Immunol. 2003, 170, 588−96. (27) Lang, T. J.; Nguyen, P.; Papadimitriou, J. C.; Via, C. S. Increased severity of murine lupus in female mice is due to enhanced expansion of pathogenic T cells. J. Immunol. 2003, 171, 5795−801. (28) Kupers, R. C.; Suiter, T.; Gleichmann, E.; Rose, N. R. The induction of organ-specific antibodies during the graft-vs.-host reaction. Eur. J. Immunol. 1988, 18, 161−166. (29) Sullivan, K. M.; Shulman, H. M.; Storb, R.; Weiden, P. L.; Witherspoon, R. P.; McDonald, G. B.; Schubert, M. M.; Atkinson, K.; Thomas, E. D. Chronic graft-versus-host disease in 52 patients: adverse natural course and successful treatment with combination immunosuppression. Blood 1981, 57, 267−276. (30) Lee, S. J. New approaches for preventing and treating chronic graft-versus-host disease. Blood 2005, 105, 4200−6. (31) Perry, D. J.; Yin, Y.; Telarico, T.; Baker, H. V.; Dozmorov, I.; Perl, A.; Morel, L. Murine lupus susceptibility locus Sle1c2 mediates CD4+ T cell activation and maps to estrogen-related receptor gamma. J. Immunol. 2012, 189, 793−803. (32) Yin, Y.; Choi, S. C.; Xu, Z.; Perry, D. J.; Seay, H.; Croker, B. P.; Sobel, E. S.; Brusko, T. M.; Morel, L. Normalization of CD4+ T cell metabolism reverses lupus. Sci. Transl. Med. 2015, 7, 274ra18. (33) Zhou, L.; Askew, D.; Wu, C.; Gilliam, A. C. Cutaneous gene expression by DNA microarray in murine sclerodermatous graft8459
DOI: 10.1021/acs.jafc.5b03425 J. Agric. Food Chem. 2015, 63, 8452−8459
