Isolation of Bactrian camel Single Domain Antibody for Parathion and

Subscriber access provided by UNIV OF LOUISIANA

Article

Isolation of Bactrian camel Single Domain Antibody for Parathion and Development of One-Step dc-FEIA Method Using VHH-Alkaline Phosphatase Fusion Protein Yu-Qi Zhang, Zhen-Lin Xu, Feng Wang, Jun Cai, Jie-Xian Dong, Jin-Ru Zhang, Rui Si, Cheng-Long Wang, Yu Wang, Yu-Dong Shen, Yuanming Sun, and Hong Wang Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b03509 • Publication Date (Web): 26 Sep 2018 Downloaded from http://pubs.acs.org on September 26, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Isolation of Bactrian camel Single Domain Antibody for Parathion and Development of One-Step dc-FEIA Method Using VHH-Alkaline Phosphatase Fusion Protein Yu-Qi Zhang1, Zhen-Lin Xu1, Feng Wang1, Jun Cai1, Jie-Xian Dong2, 3, Jin-Ru Zhang1, Rui Si1, Cheng-Long Wang4, Yu Wang4, Yu-Dong Shen1, Yuanming Sun1*, Hong Wang1*

1

Guangdong Provincial Key Laboratory of Food Quality and Safety, National-Local

Joint Engineering Research Center for Processing and Safety Control of Livestock and Poultry Products, College of Food Science, South China Agricultural University, Guangzhou 510642, P. R. China

2

Department of Entomology and Nematology and UCD Comprehensive Cancer

Center, University of California, Davis, California 95616, United States

3

Neurobiology, Physiology & Behavior, University of California, Davis, California

95616, United States

4

Guangzhou Institute of Food Inspection, Guangzhou 510080, P. R. China

Corresponding Author *E-mail: [email protected]. Phone: +86-20-85283448 *E-mail: [email protected]. Phone: +86-20-85283448 ORCID Hong Wang: 0000-0001-9136-8959

1

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 20

ABSTRACT A heavy chain variable fragment of heavy chain only antibodies derived from camelids termed VHH shows beneficial characteristics for immunoassay in terms of high sensitivity, outstanding stability and ease in expression. In the present study, we isolated six VHHs from phage display library against parathion which is a widely used organophosphorus pesticide with high toxicity and persistence. One of six selected

VHHs

named

VHH9,

showed

highest

specificity

and

superior

thermo-stability. A VHH9-alkaline phosphatase (AP) fusion was constructed and used to establish a one-step direct competitive fluorescence enzyme immunoassay (dc-FEIA) with a half maximal inhibitory concentration (IC50) of 1.6 ng/mL and a limit of detection of 0.2 ng/mL which was four-fold or three-fold higher sensitivity than direct competitive enzyme-linked immunoassay (dc-ELISA) and indirect competitive enzyme-linked immunoassay (ic-ELISA) for parathion. Furthermore, our assay indicated a 50% reduction on operation time compared with the ic-ELISA method. The presented immunoassay was validated with spiked Chinese cabbage, cucumber, and lettuce samples, and confirmed by UPLC-MS/MS. The results indicated that the VHH-AP-based dc-FEIA is a reproducible detection assay for parathion residues in vegetable samples.

2


Page 3 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION The extensive use of organophosphorus pesticides in agriculture has affected the environment and human health and persistent China

[1]

. Parathion (MW 291.3 Da), which is highly toxic

[2]

, is one of the most widely used organophosphorus pesticides in

[3, 4]

. In 2004, the European Union established the maximum residue limit

(MRL) of parathion in fruits, vegetables, and meat to < 20 ng/mL. China implemented a more conservative MRL for parathion of 10 ng/mL in 2016. Immunoassays for parathion based on conventional antibodies (polyclonal antiserum and monoclonal antibodies, pAbs and mAbs) or recombinant antibody fragments (single-chain fragment antibodies and fragment antibodies, scFvs and Fabs) have been reported [5-9]. However, development of novel candidate antibodies with superior performance has been a constant goal in immunoassay. Variable domain of heavy chain antibody (VHH) is a fragment derived from camelids antibody devoid of light chains. Due to its small size (only 15 kDa), high stability, ease of expression especially in Escherichia coli, VHHs have recently emerged as attractive reagents for immunodetection of chemical contaminants in food. VHH-based enzyme-linked immunosorbent assay (ELISA) for small molecules (haptens), such as 15-acetyldeoxynivalenol microcystins

[13]

, auxin

[10]

, ochratoxin A

[14]

[11]

, aflatoxin B1

, and 3-phenoxybenzoic acid (3-PBA)

[15]

[12]

,

have been

developed. Most of ELISAs have been established in the format of two-step incubation protocol including primary antibodies and secondary antibodies. A one-step immunoassay with the application of VHH-alkaline phosphatase (AP) fusion protein has additional advantages, which include simplicity, time-effectiveness, and high sensitivity. In addition, a fluorometric immunoassay based on scFv-AP fusion protein was determined to be more sensitive for smaller biomarkers compared to chemiluminescence assay [16]. In the present study, we isolated VHH antibodies with high specificity against parathion from an immunized Bactrian camel VHH phage display library. By the fusion of VHH with AP and the substrate substitution of a fluorescence substance 2'-[2-benzothiazoyl]-6'-hydroxybenzothiazole (BBTP) to the traditional p-nitrophenyl 3



phosphate (pNPP), a one-step direct competitive fluorescence enzyme immunoassay (dc-FEIA) was developed. This simple and sensitive immunoassay based on VHH-AP was validated with spiked vegetable samples and confirmed by UPLC-MS/MS analysis.

EXPERIMENTAL SECTION Materials Parathion and other O,O-diethyl organophosphorus pesticide (OPs) standards were obtained from Dr. Ehrenstorfer GmbH (Augsburg, Germany). Bovine serum albumin (BSA), ovalbumin (OVA) and keyhole limpet hemocyanin (KLH), and freund’s adjuvant were purchased from Sigma-Aldrich (St. Louis, MO, USA). Hapten 1 structure (Figure S1), H1-KLH conjugates (hapten 1 coupled with protein KLH, immunogen), H1-OVA conjugates (hapten 1 coupled with protein OVA, coating antigen) were previously synthesized by our laboratory [17]. The TRIzol reagent was obtained from Thermo Fisher Scientific (Thermo, USA). The 1st strand cDNA synthesis kit was purchased from TaKaRa (Dalian, China). Primers for cloning VHH repertoire were synthesized by Invitrogen Biotechnology Co. (Shanghai, China). The gel extraction and PCR purification kit were purchased from QIAGEN (Dusseldorf, Germany). Helper phage M13K07, SfiI restriction enzymes, and T4 DNA ligase were purchased from New England Biolabs (MA, USA). Anti-M13 phage conjugated with HRP antibody was from GE Healthcare Life Science (Boston, MA, USA). The pComb3xss vector, pLIP6/GN vector, E. coli TG1, and E. coli BL21(DE3) were stored in our laboratory. HA-tag antibody-HRP was obtained from NOVUS Biologicals (CO, USA). The colorimetric substrate p-nitrophenyl phosphate (pNPP) was from Aladdin Reagent Co. (Shanghai, China). The AttoPhos AP fluorescent substrate system (2'-[2-benzothiazoyl]-6'-hydroxybenzothiazole phosphate [BBTP]) was purchased from Promega (WI, USA). Primary-secondary amine (PSA), C18 sorbents, and PestiCarb (PC) were purchased from Agela Technologies Co. (Guangzhou, China). Instruments 4


Page 4 of 20

Page 5 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Ultraviolet-visible

spectrum

was

measured

on

a

NanoDrop

2000C

spectrophotometer (Thermo, USA). Phage preparation and bacteria centrifugation were obtained by SORVALL LYNX 4000 centrifuge (Thermo, USA). VHH antibodies were purified by Biologic LP (Bio-Rad, USA). Absorbance and fluorescence intensity values were measured by the SpectraMax i3x Multi-Mode Microplate Reader (USA). UPLC-MS/MS analysis was conducted by AB TRIPLE QUAD 4500 Mass Spectrometer (AB, USA). Library Construction A three-year-old male Bactrian camel was immunized with 500 µg of H1-KLH and freund's adjuvant mixture biweekly. Preimmune serum was collected as negative control. Seven days after the fifth immunization, 100 mL of fresh blood was collected and used for lymphocyte isolation, followed by RNA extraction and cDNA synthesis. The VHH genes were amplified by two-step nested PCR [18]. In the first PCR, primers CALL001

(5'-GTCCTGGCTGCTCTTCTACAAGG-3')

and

CALL002

(5'-GGTACGTGCTG TTGAACTGTTCC-3') were used to amplify the VH-CH1-CH2 and

VHH-CH2

regions.

In

the

second

PCR,

nested

primers

(5'-ACTGGCCCAGGCGGCCGAGGTGCAGCTGSWGSAKTCKG-3')

VHH-For and

VHH-Back (5'-ACTGGCCG GCCTGGCCTGAGGAGACGGTGACCWGGGTC-3') were used to amplify the VHH regions. After digestion with the SfiI enzyme separately, the PCR products of the VHH genes and the pComb3xss vector were ligated and then transformed into E. coli TG1 competent cells. All of the cells were scraped off from the LB-ampicillin agar plates and collected. With the infection of helper phage M13K07, a Bactrian camel-derived phage displayed VHHs library was obtained. The library size was estimated by plating on LB-ampicillin agar plates. Ten clones were selected from the LB-ampicillin agar plate to evaluate the insertion rate of the library and sequenced to evaluate library diversity. Library Panning and characterization analysis The library was subjected to four rounds of panning on 96-well microtiter plates. H1-OVA conjugates were coated with decreasing concentrations (1, 0.5, 0.1, and 0.01 5



Page 6 of 20

µg) in four rounds of panning, respectively. Then, 3% BSA in PBS (200 µL/well) was used as blocking buffer, and a series of increasing concentrations of PBST (0.25%, 0.4%, 0.75%, and 1%) were used as washing buffer in four rounds of panning. To eliminate nonspecific binding, 100 µL VHH phage library (1 × 1011 pfu/mL) was first incubated with 100 µg of KLH for 1 h at 37 °C. Then, the supernatant was transferred to the wells coated with H1-OVA and incubated for 1 h at 37 °C. The bound phage particles were eluted by 100 mM triethylamine (100 µL/well, pH 11.5) for 10 min and immediately neutralized with 1 M Tris-HCl (50 µL/well, pH 7.4). Then, 10 µL of the neutralized solution in each round was used to test the output titer, and the remainder was amplified for the following panning. After four rounds of panning, 40 clones were randomly picked from the fourth output titer plate and cultured with the infection of helper phage M13K07 in 5 mL of LB culture at 37 °C overnight. The culture supernatant containing phage particles was collected after centrifuge at 10,000 g for 20 min and tested by indirect competitive phage ELISA. The positive clones were selected and sequenced. For assessment of thermo-stability, purified VHH9 (1 mg/mL) was incubated at 20, 40, 60, 75 to 95 °C for 5 minutes, and was also tested at 85 °C for 5, 15, 25, 35, 45, and 60 minutes. And a series concentrations (10%, 20%, 40%, 60%, and 80%) of methanol (MeOH), acetone, acetonitrile and dimethylsulfoxide (DMSO) were used as the dilution reagents (v/v) for assessment of organic solvents tolerance. The binding activity of VHH9 was determined by indirect ELISA under varying temperatures or organic solvents. Expression and Purification of VHH9-AP fusion Protein The VHH9 clone was selected for further study because the superior performance. VHH9 gene was amplified from positive VHH9-pComb3xss vector by primers FR1-AP-SfiI (ACTATAGGCCCAGCCGGCCATGGAGGTGCAGCTGCTGCAGTCT),

and

FR4-AP-NotI (AATGCGGCCGCATGGTGATGGTGATGATGTGAGGAGACGGTGACCTGGGT ). After digestion with SfiI and NotI enzymes, respectively, the PCR products of the 6


Page 7 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


VHH9 gene and the pLIP6/GN vector

[19]

containing the AP gene were ligated and

transformed into E. coli BL21(DE)3 cells by heat shock (42 °C, 90 s). After sequencing for identification, positive E. coli BL21(DE)3 clones were selected and induced to express VHH9-AP fusion proteins at 37 °C with shaking at 250 rpm for 12 h after the addition of 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) in a total of 500 mL of LB culture. Cells were harvested by centrifugation at 10,000 g for 20 min. VHH9-AP fusion proteins were extracted from cells using sucrose osmotic pressure method according to the procedure

[20]

and purified by Ni-NTA affinity

chromatography. The purified VHH9-AP was identified by 12% SDS-PAGE and western blotting, and the concentration was measured using a NanoDrop 2000C system. VHH9-AP based dc-FEIA A dc-FEIA was developed based on VHH9-AP fusion protein. Briefly, a black opaque 96-well plate was coated with H1-OVA (0.125 µg/mL, 100 µL/well) at 37 °C overnight and blocked with 3% BSA in PBS (200 µL/well) at 37 °C for 3 h. Then, 50 µL/well of standard parathion at serial dilution concentrations, and 50 µL/well of VHH9-AP were added to the plate wells and incubated at 37 °C for 30 min. After washing five times with PBST (0.01M, pH 7.4), 100 µL/well of AttoPhos AP fluorescent substrate BBTP was added. Following incubation at 37 °C for 15 min, fluorescence signals were measured at an excitation wavelength of 435 nm and an emission wavelength of 575 nm. The fluorescence intensity value of F/F0 against parathion was measured as earlier described, where F and F0 represent the fluorescence intensity in the presence or absence of the parathion standard solution, respectively. To establish calibration curves, the four-parameter logistic function plotted by Origin 8.5 (Origin Lab Corp., Northampton, MA, USA) was fitted. Then, the half maximal inhibitory concentration (IC50) and a limit of detection (LOD) were defined as inhibitory concentrations at 50% and 10%, respectively. The percentage of cross reactivity was calculated as follows: CR (%) = IC50 (parathion, ng/mL)/IC50 (parathion analogues, ng/mL) × 100. Analysis of Spiked Samples 7



Chinese cabbage, cucumber, and lettuce samples were obtained from a local market and verified as parathion-free by UPLC-MS/MS analysis. Using the QuEChERS (Quick, Easy, Cheap, Effective, Rugged, and Safe) protocol, the vegetable samples were spiked with different concentrations of parathion and extracted following a clean-up procedure. Briefly, 15 g of a finely chopped vegetable sample was added into 50-mL tube and mixed with 6 g of anhydrous magnesium sulfate and 1.5 g of sodium acetate in 15 mL of acetonitrile containing 1% (v/v) acetic acid. The sample mixtures were stirred thoroughly, and then the organic phase was separated by centrifugation at 3,000 g for 5 min. Aliquots (4 mL) of the extract of each vegetable sample were transferred into 15 mL tubes containing 400 mg each of PSA, C18, and PC, and 1,200 mg of anhydrous MgSO4 for dispersive solid-phase extraction (dSPE) cleanup. After a second centrifugation, the clean extracts were evaporated with nitrogen gas at 40 °C, and then the dry residues were reconstituted with 1 mL of methanol. The samples were again evaporated with nitrogen gas at 40 °C. Finally, the sample residues were dissolved in 4 mL of PBS (0.02 mol/L, PH 7.4) containing 10% methanol. To eliminate the matrix effect, the extract samples were diluted (1:3, v/v) with PBS (0.02 mol/L, pH 7.4) containing 10% methanol and used for analysis. The VHH9-AP-based dc-FEIA was validated with UPLC-MS/MS by Guangzhou Institute for Food Control, China. The conditions were used as follows: mobile phase A consisted of 0.1% formic acid and 5 mmol/L ammonium formate in methanol, and mobile phase B consisted of 0.1% formic acid and 5 mmol/L ammonium formate in water. The gradient elution were 0-9 min, 90% B-50% B; 9-20 min, 50% B-35% B; 20-29 min, 35% B-0; and 30-34 min, 0-90% B. The flow rate of the mobile phase was 0.3 mL/min, and an aliquot of 10 µL of each sample was injected into the UPLC system. The mass spectra were obtained with AB TRIPLE QUAD 4500 mass spectrometer using the electrospray ionization technique. All of the parathion samples were analyzed in the positive ionization mode.

RESULTS AND DISCUSSION Isolation of Anti-Parathion VHHs 8


Page 8 of 20

Page 9 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


An immunized Bactrian camel-derived phage-display VHH library with 90% positive insertion rate (Figure S2) and complexity of 1.43 × 107 cfu/mL was obtained and used for biopanning against parathion. After four rounds of panning, the titer of output phages increased from 5 × 105 pfu/mL to 1 × 107 pfu/mL, indicating significant enrichment of specific phage clones with binding ability to H1-OVA antigen. Phage-ELISA results (Figure 1) showed that 6 clones, namely VHH9, VHH10, VHH16, VHH4, VHH15, and VHH5, were positive and exhibited significant inhibitory rates of 97.2%, 93.8%, 84.5%, 82.7%, 75.5%, and 70.1% for parathion (1 µg/mL), respectively. All of the positive clones were sequenced and aligned (Figure S3). Among these six clones, VHH9 with the highest inhibition rate was selected for further analysis. Characterization of anti-Parathion VHH From the results of thermo-stability study (Figure 2), it was showed that the antibody activity of VHH9 could maintain nearly 100% after being incubated at 85 °C for 60 minutes. And even at 95 °C for 5 minutes, it was still able to keep 75% of binding activity. This phenomenon may be due to disulfide shuffling [21-23], quantities of disulfide bond

[24, 25]

as well as reversible refolding

[26]

. Furthermore, VHH9

possessed strong resistance ability in high concentrations of organic solvents, such as MeOH, acetone, acetonitrile and DMSO (Figure 3). In relatively high-concentrations of 40% of MeOH, acetonitrile and DMSO, it could maintain nearly half of binding activity, and about 25% activity in 40% of acetone. VHH9 exhibited superior stability even though under the effect of extreme temperature and high concentrations of organic solvents. The strong stability of VHH9 could be attributed to the special structure of nanobody. Based on these findings, VHH9 was subsequently used for AP fusion. Identification of VHH-AP Fusion Protein and Establishment of dc-FEIA For the new immunoassay method, VHH9-AP fusion protein (63 kDa) was purified and assessed by 12% SDS-PAGE and western blotting (Figure 4). A dc-FEIA method based on VHH9-AP and BBTP fluorescent substrate was developed to assess the specificity and sensitivity for parathion. Under determination of the optimal 9



Page 10 of 20

concentrations of coating antigen (H1-OVA) and VHH9-AP antibody by checkerboard titration, the sensitivity and cross reactivity of dc-FEIA are shown in Table 1. VHH9-AP was highly specific and sensitive for parathion recognition. The IC50 and LOD of dc-FEIA against parathion was 1.6 ng/mL and 0.2 ng/mL (Figure 5). The cross reactivity of the assay corresponded to the reaction of eleven kinds of parathion analogues. The IC50 of the assay to triazophos, quinalphos, and coumaphos was 20.6, 25.3, and 33.4 ng/mL, with CRs of 8.0%, 6.5%, and 4.9%, respectively. Furthermore, the IC50 toward the other eight kinds of parathion analogues ranged from 279.9 ng/mL to 2443.7 ng/mL, with low CRs of < 1%. For the VHH9-AP-based dc-ELISA employing the pNPP substrate and VHH9-based ic-ELISA employing the HRP labeled anti-HA tag as tracer (Figure 5), the IC50 values were 6.5 ng/mL and 5.0 ng/mL, with LOD values of 1.5 ng/mL and 1.9 ng/mL, respectively. In addition, our novel dc-FEIA exhibited four-fold or three-fold higher sensitivity than dc-ELISA and ic-ELISA. Compared to previous studies, the dc-FEIA described in this study is more sensitive than the ic-ELISA developed by Yan

[27]

, the ic-phage ELISA by Hua

quartz-crystal microbalance-based immunosensor by Della

[28]

, and the

[29]

, and especially showed

superior features, including detection limit, specificity, and sample recovery than other anti-parathion reagents (pAbs, mAbs, scFv, and phage borne peptide) (Table 2) [7-9, 27-30]

. Furthermore, the application of the VHH-AP fusion protein apparently

shortened the 80-min ic-ELISA operation time

[28, 30]

by at least 50% (40 min).

Moreover, AP-labeled reagents may be utilized as an alternative to a second antibody [31]

for detection in the immunoassay.

Detection of Parathion in Vegetables by dc-FEIA and UPLC-MS/MS The ideal analytical method should be accurate and meet the requirements of detecting actual samples. The VHH9-AP-based dc-FEIA was employed to analyze Chinese cabbage, cucumber, and lettuce samples spiked with parathion at three concentrations (0, 5, 10, and 20 ng/g). The average recoveries were within the desirable range of 82.0%–102.0%, with the coefficient of variation of 3.9%–9.2% (Table 3). The samples spiked with parathion were also confirmed by UPLC-MS/MS to evaluate the accuracy of dc-FEIA. The average recoveries were within the desirable range of 92.0%–104.0%, with the coefficient of variation of 2.2%–8.3% (Table S1). 10


Page 11 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The relationship between the dc-FEIA and UPLC-MS/MS was shown in Figure 6. The correlation coefficient (R2) of dc-FEIA and UPLC-MS/MS was 0.9825. These results indicated that the VHH9-AP-based dc-FEIA could be utilized in the detection of parathion residues in vegetables with acceptable accuracy and reproducibility.

CONCLUSIONS Anti-parathion single-domain antibodies were screened from an immunized Bactrian camel-derived phage-displayed VHH library. The VHH9 antibody with the highest sensitivity and superior thermo-stability was identified from 6 positive clones after four rounds of panning. Similarly, previous report has shown that VHH-AP retained full binding activity after incubation in ambient temperature for 70 days

[32]

.

VHH antibodies determined by a single gene are more easily manipulated with the genetic engineering technology than conventional antibodies. Therefore, on the basis of the bifunctional VHH9-AP fusion protein, a one-step dc-FEIA assay was developed for the detection of parathion. Good recoveries in spiked vegetable samples were obtained by dc-FEIA analysis. Compared with dc-ELISA or ic-ELISA, the VHH9-AP fusion protein based dc-FEIA method is a rapid detection assay with a significantly higher sensitivity for parathion. This method also indicates that using AP makes this immunoassay highly efficient in signal enhancement, simple, and readily available. This novel assay allows the direct competitive immunodetection of small molecules in food samples using a single-domain antibody-AP fusion protein. Acknowledgments This work was supported by National Key R&D Program of China (2016YFE0106000), Science and Technology Planning Project of Guangzhou City (201804020077), National Natural Science Foundation of China (31271866), Science and Technology Planning Project of Guangdong Province （2014B070706001）, Project Supported by Guangdong Province Universities and Colleges Pearl River Scholar Funded Scheme (2017). We would like to thank LetPub (www.letpub.com) for providing linguistic assistance during the preparation of this manuscript. Notes 11



The authors declare no competing financial interest. ASSOCIATED CONTENT Supporting Information The supporting Information is available free of charge on the ACS Publication website. Additional information including procedures of ic-ELISA and dc-ELISA; hapten 1 structure (Figure S1); ten clones randomly picked from VHH library and evaluated by colony PCR (Figure S2); sequence analysis of six selected VHHs (Figure S3); recoveries of parathion in vegetables by UPLC-MS/MS (Table S1) (PDF). References (1) Salas, B. V.; Duran, E. I.; Wiener, M. S. Rev. Environ. Health. 2000, 15(4), 399-412. (2) Buratti, F. M.; Volpe, M. T.; Meneguz, A.; Vittozzi, L.; Testai, E. Toxicol. Appl. Pharmacol. 2003, 186(3), 143-154. (3) Bai, Y.; Zhou, L.; Wang, J. Food Chem. 2006, 98(2), 240-242. (4) Xu, Z.; Shen, Y.; Zheng, W.; Beier, R. C.; Xie, G.; Dong, J.; Yang, J.; Wang, H.; Lei, H.; She, Z.; Sun, Y. Anal. Chem. 2010, 82, 9314-9321. (5) Ercegovich, C. D.; Vallejo, R. P.; Gettig, R. R.; Woods, L.; Bogus, E. R.; Mumma, R. O. J. Agric. Food Chem. 1981, 29(3), 559-563. (6) Ibrahim, A. M.; Morsy, M. A.; Hewedi, M. M.; Smith, C. J. Food Agric. Immunol. 1994, 6(1), 23-30. (7) Zeng, K.; Yang, T.; Zhong, P.; Zhou, S.; Qu, L.; He, J.; Jiang, Z. Food Chem. 2007, 102(4), 1076-1082. (8) Wang, C.; Liu, Y.; Guo, Y.; Liang, C.; Li, X.; Zhu, G. Food Chem. 2009, 115(1), 365-370. (9) Garrett, S. D.; Appleford, D. J.; Wyatt, G. M.; Lee, H. A.; Morgan, M. R. J. Agric. Food Chem. 1997, 45(10), 4183-4189. (10) Doyle, P. J.; Arbabi-Ghahroudi, M.; Gaudette, N.; Furzer, G.; Savard, M. E.; Gleddie, S.; McLean, M. D.; Mackenzie, C. R.; Hall, J. C. Mol. Immunol. 2008, 45(14), 3703-3713. 12


Page 12 of 20

Page 13 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(11) van Houwelingen, A.; De Saeger, S.; Rusanova, T.; Waalwijk, C.; Beekwilder, J. World Mycotoxin J. 2008, 1(4), 407-417. (12) He, T.; Wang, Y.; Li, P.; Zhang, Q.; Lei, J.; Zhang, Z.; Ding, X.; Zhou, H.; Zhang, W. Anal. Chem. 2014, 86(17), 8873-8880. (13) Pirez-Schirmer, M.; Rossotti, M.; Badagian, N.; Leizagoyen, C.; Brena, B. M.; Gonzalez-Sapienza, G. Anal. Chem. 2017, 89(12), 6800-6806. (14) Sheedy, C.; Yau, K. Y.; Hirama, T.; MacKenzie, C. R.; Hall, J. C. J. Agric. Food Chem. 2006, 54(10), 3668-3678. (15) Kim, H. J.; McCoy, M. R.; Majkova, Z.; Dechant, J. E.; Gee, S. J.; Rosa, S. T.; Gonzalez-Sapienza, G.; Hammock, B. D. Anal. Chem. 2012, 84(2), 1165-1171. (16) Oyama, H.; Tanaka, E.; Kawanaka, T.; Morita, I.; Niwa, T.; Kobayashi, N. Anal. Chem. 2013, 85(23), 11553-11559. (17) Xu, Z.; Xie, G.; Li, Y.; Wang, B.; Beier, R. C.; Lei, H.; Wang, H.; Shen, Y.; Sun, Y. Anal. Chim. Acta. 2009, 647(1), 90-96. (18) Ebrahimizadeh, W.; Gargari, S. M.; Rajabibazl, M.; Ardekani, L. S.; Zare, H.; Bakherad, H. Appl. Microbiol. Biotechnol. 2013, 97(10), 4457-4466. (19) Xu, Z.; Dong, J.; Wang, H.; Li, Z.; Beier, R. C.; Jiang, Y.; Lei, H.; Shen, Y.; Yang, J.; Sun, Y. J. Agric. Food Chem. 2012, 60(20), 5076-5083. (20) Olichon, A.; Schweizer, D.; Muyldermans, S.; de Marco, A. BMC Biotechnol. 2007, 7(1): 7-7. (21) Turner, K. B.; Liu, J.; Zabetakis, D.; Lee, A. B.; Anderson, G. P.; Goldman, E. R. Biotechnol. Rep. (Amsterdam, Netherlands). 2015, 6(C), 27-35. (22) Saerens, D.; Conrath, K.; Govaert, J.; Muyldermans, S. J. Mol. Biol. 2008, 377(2), 478-488. (23) Zabetakis, D.; Olson, M. A.; Anderson, G. P.; Legler, P. M.; Goldman, E. R. Plos One. 2014, 9(12): e115405. (24) Akazawa-Ogawa, Y.; Uegaki, K.; Hagihara, Y. J. Biochem. 2016, 159(1), 111-121. (25) Turner, K. B.; Zabetakis, D.; Goldman, E. R.; Anderson, G. P. Protein Eng., Des. Sel. 2014, 27(3), 89-95. 13



(26) Perez, J. M.; Renisio, J. G.; Prompers, J. J.; van Platerink, C. J.; Cambillau, C.; Darbon, H.; Frenken, L. G. Biochemistry. 2001, 40(1), 74-83. (27) Yan, X.; Shi, H.; Wang, M. Anal. Methods. 2012, 4(12), 4053-4057. (28) Hua, X.; Liu, X.; Shi, H.; Wang, Y.; Kim, H. J.; Gee, S. J.; Wang, M.; Liu, F.; Hammock, B. D. RSC Adv. 2014, 4(80), 42445-42453. (29) Della Ventura, B.; Iannaccone, M.; Funari, R.; Ciamarra, M. P.; Altucci, C.; Capparelli, R.; Roperto, S.; Velotta, R. Plos One. 2017, 12(2): e0171754. (30) Liu, Y.; Jin, M.; Gui, W.; Cheng, J.; Guo, Y.; Zhu, G. Anal. Chim. Acta. 2007, 591(2), 173-182. (31) Rau, D.; Kramer, K.; Hock, B. J. Immunoassay Immunochem. 2002, 23(2), 129-143. (32) Wang, J.; Majkova, Z.; Bever, C. R.; Yang, J.; Gee, S. J.; Li, J.; Xu, T.; Hammock, B. D. Anal. Chem. 2015, 87(9), 4741-4748.

FIGURE LEGENDS Table 1. Sensitivity and cross reactivity of VHH9-AP for OPs. Table 2. Sensitivity and cross reactivity of reported anti-parathion reagents. Table 3. Recoveries of parathion in vegetables by VHH9-AP based dc-FEIA (n=3). Figure 1. Phage clones binding to parathion selected and identified by phage ELISA. Figure 2. Thermo-stability of VHH9 by indirect ELISA based on the antigen H1-OVA and anti-HA-HRP antibody. (A) VHH9 antibody (1 mg/mL) was incubated at 20, 40, 60, 75 to 95 °C for 5 minutes; (B) VHH9 antibody (1 mg/mL) was incubated at 85 °C for 5, 15, 25, 35, 45, and 60 minutes. Figure 3. Organic solvents tolerance of VHH9 by indirect ELISA based on the antigen H1-OVA and anti-HA-HRP antibody. A series concentrations (10%, 20%, 40%, 60%, and 80%) of (A) MeOH, (B) acetone, (C) acetonitrile, and (D) DMSO were as the dilution reagents (v/v) with VHH9. Figure 4. Characterization of VHH9-AP by SDS-PAGE and western blotting analysis based on anti-His antibody. (A) SDS-PAGE: lane 1, marker; lane 2, purified VHH9-AP. (B) Western blotting: lane 3, marker; lane 4, purified VHH9-AP. 14


Page 14 of 20

Page 15 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. (A) Dose-response curve of VHH9-AP based dc-FEIA for parathion. (B) Dose-response curve of VHH9-AP based dc-ELISA for parathion. (C) Dose-response curve of VHH9 based ic-ELISA for parathion. Figure 6. Correlations of analysis of samples spiked with parathion between VHH9-AP based dc-FEIA and UPLC-MS/MS. Table 1. Sensitivity and cross reactivity of VHH9-AP for OPs VHH9-AP Pesticides

Structure

IC50

LOD

CR

(ng/mL)

(ng/mL)

（%）

parathion

1.6

0.2

100

triazophos

20.6

3.2

8.0

quinalphos

25.3

5.7

6.5

coumaphos

33.4

7.5

4.9

279.9

110.1

0.6

330.3

59.9

0.5

368.0

77.6

0.4

497.2

183.4

0.3

521.1

160.0

0.3

633.7

100.4

0.3

683.1

154.4

0.2

dichlofenthion

azinphos-ethyl

phorate

terbufos

disulfoton

phoxim

bromophos ethyl 15



2443.7

phosalone

Page 16 of 20

965.1

0.1

Table 2. Sensitivity and cross reactivity of reported anti-parathion reagents Antib

Detecti

IC50

LOD

Cross-

Referen

ody

on

(ng/

(ng/

reactivity

ces

method

mL)

mL)

ic-ELISA

360

26

No mention

reference

Mab

[7]

Mab

ic-ELISA

2.94

0.70

Parathion-m

reference

ethyl

[8]

(8.69%), fenitrothion (0.72%) scFv

ic-ELISA

11.6

2.3

Parathion-m

reference

ng/w

ng/w

ethyl (6%),

[9]

ell

ell

fenitrothion (4%)

PAb

ic-ELISA

52

0.5

Imidaclopri

reference

d (23.9%),

[27]

acetamiprid (6.17%) phage-

Parathion-m

reference

borne

ethyl

[28]

peptide

(300%),

ic-ELISA

4.2

1.6

Fenitrothion (156%, Cyanophos (41%), EPN (20%) 16


Page 17 of 20 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


PAb

-

immunos

0.8

No mention

reference [29]

ensor

Antise

4.79

ic-ELISA

0.31

rum

Parathion-m

reference

ethyl

[30]

(7.8%) VHH9

1.6

dc-FEIA

0.2

-AP

Triazophos

present

(8%),

work

quinalphos (6.5%), coumaphos (4.9%)

Table 3. Recoveries of parathion in vegetables by VHH9-AP based dc-FEIA (n=3) analyte

parathion

Ad

Chinese

ded

cabbage

(ng /g)

0

5

10

20

a

b

cucumber

lettuce

Found±

Found±

Found±

SDa

SD %R±

SD

%CVb

%CV

%CV

(ng/g)

(ng/g)

-

-

-

-

-

-

5.1±0.3

4.7±0.3

4.1±0.3

102.0±5.6

94.0±6.3

82.0±6.9

9.9±0.4

9.6±0.9

8.9±0.5

99.0±4.3

96.0±9.2

89.0±5.1

20.1±0.8

18.5±1.2

18.9±1.1

100.5±3.9

92.5±6.7

94.5±5.9

%R±

%R±

(ng/g)

SD: standard deviation.

CV: coefficient of variation.

17



without presence of parathion with presence of parathion (1 µg/mL)

Absorbance 450 nm

4

3

2

1

0 VHH1 VHH2 VHH3 VHH4 VHH5 VHH6 VHH7 VHH8 VHH9 VHH10 VHH11 VHH12 VHH13 VHH14 VHH15 VHH16 VHH17 VHH18 VHH19 VHH20 VHH21 VHH22 VHH23 VHH24Negative Blank

Phage clones

Figure 1. Phage clones binding to parathion selected and identified by phage ELISA. Inhibition rate = (absorbance at 450 nm without presence of parathion - absorbance at 450 nm with presence of parathion) / absorbance at 450 nm without presence of

（A）

VHH9

percent binding activity (%)


parathion. VHH9 showed the highest inhibition rate for parathion.

100

50

0 -10 0 10 20 30 40 50 60 70 80 90 100

（B）

VHH9

100

50

0

0

Temperature (5 min)

10

20

30

40

50

60

Time at 85 °C (min)

Figure 2. Thermo-stability of VHH9 by indirect ELISA based on the antigen H1-OVA and anti-HA-HRP antibody. (A) VHH9 antibody (1 mg/mL) was incubated at 20, 40, 60, 75 to 95 °C for 5 minutes; (B) VHH9 antibody (1 mg/mL) was incubated at 85 °C

（A） VHH9

100

50

0

0

20

40

60



for 5, 15, 25, 35, 45, and 60 minutes.

（B）

50

0

0

80

VHH9

100

50

0

0

20

40

60

concentration of acetonitrile

20

40

60

80

concentration of acetone

80


（C）

VHH9

100

concentration of MeOH percent binding activity (%)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 20

（D ）

VHH9

100

50

0

0

20

40

60

80

concentration of DMSO

Figure 3. Organic solvents tolerance of VHH9 by indirect ELISA based on the antigen H1-OVA and anti-HA-HRP antibody. A series concentrations (10%, 20%, 40%, 18


Page 19 of 20

60%, and 80%) of (A) MeOH, (B) acetone, (C) acetonitrile, and (D) DMSO were as the dilution reagents (v/v) with VHH9.

Figure 4. Characterization of VHH9-AP by SDS-PAGE and Western blotting analysis based on anti-His antibody. (A) SDS-PAGE: lane 1, marker; lane 2, purified VHH9-AP. (B) Western blotting: lane 3, marker; lane 4, purified VHH9-AP.

1.0

(A) VHH9-AP based dc-FEIA (B) VHH9-AP based dc-ELISA (C) VHH9 based ic-ELISA

0.8

F/F0 (B/B0)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


0.6 0.4 0.2 0.0 1E-3

0.01

0.1

1

10

100

1000 10000

concentration of parathion (ng/mL)

Figure 5. (A) Dose-response curve of VHH9-AP based dc-FEIA for parathion, with IC50 of 1.6 ng/mL. (B) Dose-response curve of VHH9-AP based dc-ELISA for parathion, with IC50 of 6.5 ng/mL. (C) Dose-response curve of VHH9 based ic-ELISA for parathion, with IC50 of 5.0 ng/mL.

19



parathion 20

dc-FEIA (ng/g)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

R2=0.9825

15

10

5

0 0

5

10

15

20

UPLC-MS/MS（ ng/g）

Figure 6. Correlations of analysis of samples spiked with parathion between VHH9-AP based dc-FEIA and UPLC-MS/MS.

Graphic for Table of Contents

20


Page 20 of 20

Isolation of Bactrian camel Single Domain Antibody for Parathion and

Recommend Documents