iTRAQ-Based Membrane Proteomics Reveals ... - ACS Publications

Subscriber access provided by CORNELL UNIVERSITY LIBRARY

Article

iTRAQ-based Membrane Proteomics Reveals Plasma Membrane Proteins Change During HepaRG Cell Differentiation Mingzhi Zhao, Feng Xu, Feilin Wu, Debin Yu, Na Su, Yao Zhang, Long Cheng, and Ping Xu J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/acs.jproteome.6b00305 • Publication Date (Web): 28 Oct 2016 Downloaded from http://pubs.acs.org on October 30, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Proteome Research is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

iTRAQ-based Membrane Proteomics Reveals Plasma Membrane Proteins Change During HepaRG Cell Differentiation Mingzhi Zhao1#, Feng Xu1#, Feilin Wu1, 2, Debin Yu3, Na Su1, Yao Zhang1,4, Long Cheng5, Ping Xu1, 6, 7* 1

State Key Laboratory of Proteomics, Beijing Proteome Research Center, National Center for Protein Sciences

Beijing, Beijing Institute of Radiation Medicine, Beijing 102206, P. R. China 2

3

Life Science College, Southwest Forestry University, Kunming, 650224, P. R. China

National Engineering Laboratory for AIDS Vaccine, Key Laboratory for Molecular Enzymology and

Engineering of the Ministry of Education, School of Life Sciences, Jilin University, Changchun, 130012, P. R.

China 4

Institute of Microbiology, Chinese Academy of Science, Beijing 100101, P. R. China

5

Department of Medical Molecular Biology, Beijing Institute of Biotechnology, Beijing 100850, P. R. China.

6

Key Laboratory of Combinatorial Biosynthesis and Drug Discovery (Wuhan University), Ministry of Education,

and Wuhan University School of Pharmaceutical Sciences, Wuhan, 430071, P. R. China 7

Anhui Medical University, Hefei 230032, P. R. China

#These authors contribute equally to this work.

*Corresponding authors:

Ping Xu, Beijing Proteome Research Center & National Center for Protein Sciences Beijing, 38 Science Park

Road, Changping District, Beijing, 102206, P. R. China; Tel: 8610-61777113; Fax: 8610-61777113; E-mail:

[email protected]

ABSTRACT: HepaRG cell, a stabilized bipotent liver progenitor cell line, exhibits hepatocyte functions only after differentiation. However, the mechanism of transition from non-differentiated to 1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

differentiated states, accompanied by proliferation migration and differentiation, remains poorly understood, particularly those proteins residing in the plasma membrane. In this study, the membrane protein expression change of HepaRG cell during differentiation were systematically analyzed using an iTRAQ labeled quantitative membrane proteomics approach. A total of 70 membrane proteins were identified to be differentially expressed among 849 quantified membrane proteins. Function and disease clustering analysis proved that 11 of these proteins are involved in proliferation, migration and differentiation. Two key factors (MMP-14 and OCLN) were validated by qRT-PCR and western blot. Blockade of MMP-14 further demonstrated its important function during tumor cell migration. The dataset have been uploaded to ProteomeXchange with the identifier PXD004752.

KEYWORDS HPCs, HepaRG, membrane protein, iTRAQ, migration, MMP-14

INTRODUCTION During Hepatocellular carcinoma (HCC), the liver tissue always contains mature hepatocytes and undifferentiated liver progenitor cells (LPCs), which share morphological and immunological features with liver stem cell but with some differences

1, 2 3

. These cells can differentiate into

cancer-associated fibroblasts and hepatic stellate cells in HCC, though lineage relationships are poorly understood4-6. Most human liver tumor derived hepatoma cell lines, including HepG2 7, proliferate adequately. However, little or no differentiation is observed. In addition, the metabolic functions of these cells show substantial differences from primary human hepatocytes (PHHs) and human liver tissues. 2


Page 2 of 38

Page 3 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Epithelial colony-forming cells (ECFCs) immortalized from mouse and human fetal liver demonstrated extensive proliferative and differentiation capacity, however, these functions decrease quickly during in vitro culturing 2, 8 9. As a stabilized bipotent liver progenitor cell line, HepaRG cell can be induced to proliferate and differentiate adequately. After differentiation, HepaRG exhibits hepatocyte-like and epithelium-like cell morphologies and metabolic functions. These cells can also support HBV and HCV infection 10-12, Specifically, these cells have the same expression profile of cytochrome P450-related enzymes (CYP3A4, CYP3A5 and CYP1A2) 13

10, 12,

, phase 2 enzymes (UGT1A1, GSTA1, GSTA4 and GSTM1), phase I and phase II drug

metabolism enzymes 14, although karyotype abnormalities and no α-fetoprotein (AFP) expression are observed. In addition, whole genome expression profiling studies demonstrated closer resemblance to primary human hepatocytes (PHHs) and human liver tissues of differentiated HepaRG cells than HepG2 cells

15, 16

. These proprieties make HepaRG an ideal system in liver

pharmacology and toxicology research13, 15-17. Although the inducible proliferation, differentiation and migration properties of HepaRG by DMSO are important aspects in this model

18, 19

, the proteins involved in this process remains

poorly understood. Limited information at proteome level is provided20-23. For example, using label free membrane proteomic strategy, Branza-Nichita, et al reported the possible involvement of Cathepsin D, Cathepsin K, and Cyclophilin A in HepaRG differentiation and early HBV-cell interactions. However, the number of identified membrane proteins (MBPs) was relatively small. In this study, we employed an iTRAQ labeled quantitative membrane proteomic methodology to systematically analyze the MBPs involved in HepaRG proliferation, differentiation, and migration. 2874 proteins and 1161 MBPs were identified, 849 of which had two or more unique 3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 38

identified peptides. Stringent protein expression difference cutoff criteria narrowed this number to 70. Ingenuity pathway analysis (IPA) placed these proteins in migration, in addition to drug and lipid metabolism pathway. Of particular interests are eleven ECM and composition proteins in the cell migration pathway. Among the key expression change factors, MMP-14 and OCLN were validated by quantitative real-time RT-PCR (qRT-PCR) and western blot. The importance of ECM metalloprotease MMP-14 was confirmed by transwell cell migration assay and the correlation between MMP-14 expression and HCC was further confirmed by HCC cell lines and tissue samples.

MATERIALS AND METHODS Materials Cryopreserved HepaRG, GlutaMAX, William’E medium, DMEM medium and unstained protein ladder were purchased from Life technologies (Waltham, MA, USA). MHCC97L, MHCC97H, and HCCLM6 cell lines are gifts of Professor Yinkun Liu of Fudan University. RapiGest was purchased from Waters (Milford, MA, USA). Dithiothretiol (DTT), iodoacetamide (IAA), sucrose, tetrasodium EGTA, sodium orthovanadate, and sodium fluoride were purchased from Amresco (Solon, OH, USA). Hydrocortisone hemisuccinate was purchased from Sigma (Darmstadt, Germany). 2-D-quant kit was purchased from GE Healthcare (Pittsburgh, PA, USA). Protease inhibitor cocktail was purchased from Roche (Mannheim, Germany). R-Ac-trypsin

24

and Lys C25 were expressed and purified in our lab. iTRAQ reagent was purchased from AB Sciex (AB Sciex, Foster City, CA, USA). Anti-Occludin antibody, anti-E-cadherin antibody, and antibody-MMP-14 antibody were purchased from Abcam (Cambridge, MA, USA). Anti-CD44 antibody and anti-β-Actin antibody were purchased from Santa Cruz Biotechnology (Dallas, TX, 4


Page 5 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


USA). Mem-PER

®

Kit was purchased from Pierce (Waltham, MA, USA). GM6001 was

purchased from Selleck Chemicals (Houston, TX, USA)

Cell Culture and Differentiation Induction The undifferentiated HepaRG was seeded at 1×105 /cm2 (7.5 cm flask) in William’E medium supplemented with 10% fetal bovine serum (FBS; Hyclone), 100 units/µL penicillin, 100 µg/mL streptomycin, 5 µg/mL insulin, 2 mM GlutaMAX, and 5×10-5 M hydrocortisone hemisuccinate. The cells were incubated at 37 °C with 5 % CO2, media was refreshed every 3 days. After 6 days of culturing, three plates of cells were harvested as HepaRG cell (-DMSO). After 2 weeks of culturing, dimethyl sulfoxide (DMSO) was added to the medium (2 %) to induce differentiation. The differentiated cells were harvested at day 15 and 30 after induction (DMSO15d and DMSO30d)10. The cell morphologies were monitored under microscope. MHCC97L, MHCC97L and HCCLM6 cell lines were cultured as described previously26.

Membrane Protein Sample Preparation The cells were first washed with ice-cold PBS then scraped with PBS containing protease inhibitor cocktail and centrifuge at 60 g for 2 min at 4 ℃. The cell pellets were collected and frozen at -80℃ for further usage. -DMSO, DMSO15d, and DMSO30d were re-suspended with cell lysis buffer (0.25M sucrose 5 mM Tris, 1 mM tetrasodium EGTA, 1 mM sodium orthovanadate, 2 mM sodium fluoride, and protease inhibitor cocktail pH 7.4)

27

and disrupted by a Soniprep sonicator (Scientz, Ningbo,

Zhengjiang, China) at a power setting of 1 s/5 s, 20 % for 8 min on ice. The cell debris was eliminated by centrifugation at 9,600 g for 15 min at 4 ℃ and the protein concentrations of three conditions were normalized to the same concentration, centrifuged at 120,000 g for 80 min at 4 ℃ 5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(Optima

MAX-XP,

MLA-150

rotor,

Beckman,

San

Page 6 of 38

Francisco,

CA,

USA).

After

ultra-centrifugation, the supernatant was removed and the pellet was suspended with ice-cold 0.1 M Na2CO3 solution, mixed softly at 4 ℃ for 1 h. The crude membrane protein fraction was collected by ultra-centrifugation again at the same condition. The crude membrane protein fraction was then solubilized with Mem-PER ® Reagent A supplies in Mem-PER ® Kit following the protocol described by the manufacturer. After removal of the upper phase, the lower phase and the solid phase were

cleared by mixing with ice-cold buffer

containing methanol

:

trichloromethane:ddH2O (4:3:1volume ratio) 28. The mixture was incubated on ice for 5 min, and centrifuge at 8, 000 g for 10 min to remove the detergent. The pellet was washed again with ice-cold methanol following centrifugation at 8,000 g for 10 min to get the final polished MBPs.

Protein Quantitation Analysis and Western Blot The protein concentrations of cell lysate supernatant and enriched MBPs were measured by 2-D-quant kit. The same aliquot of the total cell lysate (TCL, 20 µg each sample), the supernatant after ultra-centrifugation (Super, 18 µg each sample), and the solubilized MBPs (20 µg each sample, solubilized with 20 mM Tris, 20 mM DTT, 4 % SDS, pH 8.0) were ran on a 12 % SDS-PAGE gel followed by Coomassie staining. The same amount of the supernatant after ultra-centrifugation and the solubilized MBPs (20 µg each sample) were ran on 12 % SDS-PAGE gel, transferred to PVDF membrane, and incubated with anti-β-Actin antibody (dilution at volume ratio 1:5000) or anti-E-cadherin antibody (dilution at volume ratio 1:200), overnight at 4 ℃ after 5 % BSA blockage. The membrane was incubated with horseradish peroxidase-conjugated secondary antibody (Santa Cruz, Dallas, TX, USA), followed by chemiluminescent detection with ECL detection reagent. 6


Page 7 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Protein Digestion, iTRAQ label, and LC/MS/MS Sample Preparation The MBPs were mixed with solubilization buffer (50mM NH4HCO3, 0.1 % RG, and 5 mM DTT) to a final concentration of 1 mg/mL. Solubilization was achieved by sonication in a water bath for 20 min and heated at 100 ℃ for another 10 min. IAA was added to 15 mM and incubated at RT in dark for 30 min. A total of 5 µg of the solubilized MBPs was used for solublization efficiency evaluation by SDS-PAGE. Recombinant Lys C was added at 1:100 ratio (weight ratio of enzyme: protein) and incubated at 37 ℃ overnight. r-Ac-trypsin was then added at 1: 50 ratio (weight ratio of enzyme: protein) and incubated at 37 ℃ for another 4 h. Part of the digested sample (5 µg) was used for digestion efficiency evaluation by SDS-PAGE. After digestion, enzyme activity was blocked by acidification with TFA to final concentration of 0.5 %, incubated at 37 ℃ for 45 min, and centrifuged at 9,600 g for 10 min at RT to remove the pellet. The supernatant was vacuum dried and dissolved in 0.1 M tetraethylammonium bicarbonate (TEAB), pH 8.5, labeled with iTRAQ reagents (4-plex system) separately. The 114 and 115 iTRAQ tags were used for the -DMSO samples, the 116 for DMSO30d and 117 for DMSO15d samples respectively. After incubation at RT for 2 h, the reactions were quenched by adding an equal volume of water. Differentially labeled peptides were mixed and dried with a vacuum dryer after digestion and label efficiency confirmation. The mixed peptide samples with four labels were fractioned using a HPLC system [(Rigol L-3120, Beijing, China) with a C18 column (Kinetex 2.6 µm C18, 50×4.6 mm, Phenomenex, Torrance, CA,USA). The mobile phase consisted of (A) 2 % ACN and 98 % H2O (pH 10.0); (B) 98 % ACN and 2 % H2O (pH 10.0), the pH was adjusted with 300 µL NH3.H2O in 1 L ddH2O. The peptide samples were separated at a flow rate of 0.8 mL/min with the following gradients; 0 % 7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

B for 9 min, 0-12 %B in 16 min, 12-17 % B in 5 min, 17-30 % B for 10 min, 30-100 % B in 5 min, 100 % B for 1 min, and 100-0 % B for 4min. The samples were collected every 1 min from 4 min to 50 min and then pooled into 16 fractions for LC-MS/MS analysis after vacuum drying (Figure S-1).

LC/MS/MS Data Acquisition The pooled fractions were analyzed by a nano-UPLC coupled LTQ-Orbitrap Velos (Thermo, Waltham, MA, USA). The peptide samples were loaded onto a fused-silica capillary column [75 µm i.d. × 15 cm with C18 resins (100 Å, 3 µm, MichromBioresources, Auburn, CA, USA)] at 1 µL/min (Buffer A, 0.1% FA and 2% ACN; Buffer B, 0.1% FA and 100% ACN) and eluted with a gradient of 0-5 % B for 6 min at 1 µL/min, 5-8 % B for 2 min at 0.5 µL/min, 8-10 % B for 2 min at 0.3 µL/min, 10-25 % B for 55 min at 0.3 µL/min, 25-36 % B for 30 min at 0.3 µL/min, 36-80 % B for 3 min at 0.8 µL/min, and finally 80 % B for 2 min at 0.8 µL/min. Eluted peptides were ionized under high voltage (1.5 kV) and analyzed in a survey scan (400−1800 m/z). The MS1 precursors were detected in the centroid mode, and the resolution was set to 30,000 at 400 m/z with accumulation of automatic gain control (AGC) target reaching up to 1 × 106 under the limitation of 150 ms maximum ion injection time (MIT). The ten most intense ions (single charged ions were neglected) were selected for further fragmentation in the data-dependent mode via higher energy collision induced dissociation (HCD) with 40 % collision energy. The MS2 fractions were detected in Orbitrap using the profile mode with the lowest recorded mass fixed at 100 m/z, and at a resolution of 7,500 at 400 m/z, to detect the reporter ions (114, 115, 116, and 117 tags). The isolation window was operated at 3.0 m/z, and AGC was set as 50,000 accumulated in the linear ion trap. The dynamic exclusion was set as 45 s to avoid the redundancy detections. 8


Page 8 of 38

Page 9 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


LC/MS/MS Data Processing, Protein Identification, and Quantification The raw files were submitted to the MaxQuant searching engine (1.5.3.28) for peptide and protein identification and quantification. The MS/MS spectra were searched against uniprot human database (human Swiss-Prot database contains 20207 proteins released at 2015-06 ) along with 245 common contaminant protein sequences (http://www.maxquant.org/contaminants.zip). The search parameters were described as follows: precursor ion spectra were searched with a first search tolerance of 20 ppm and main search tolerance of 6 ppm in the MS mode, and the MS2 ions with 20 ppm in the HCD mode. Full-tryptic restriction and ≤2 missed cleavages were allowed. Peptide with minimal length of 7 amino acids were filtered. Carbamidomethylated cysteine (+57.02 Da), iTRAQ modified N-terminal residue, and iTRAQ modified lysine (+144.11 Da, 115.11 Da, 116.11 Da) were set as fixed modifications, while oxidation (+15.99 Da) of methionine was set as a variable modification. The cut off of max 25 % precursor interference for peptide spectrum matches (PSMs) was used for quantification. The peptides and proteins were filtered to a FDR of < 1 %, estimated using the target-decoy search strategy. Protein quantification was based on the reporter intensity generated from MaxQuant results, and only unique and razor peptides of the identified proteins were selected for reporter ion quantification. The corrected reporter ion intensity is based on the "correction factor" for isotopic impurity iTRAQ4plex lot table

in

Configuration

(http://greproteomics.lifesci.dundee.ac.uk/webpage%20front%20page/dreamweaver%20webpa ge/maxquant%20how%20to.pdf). The differentially expressed proteins were derived using “significant B”method

29

, which selecting outlier proteins in comparison to the distribution of

protein ratios of two similar proteomics. The significant B value of all comparisons were 9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

calculated by an in-house R script with following arguments: erfc function from NORMT3 package were used, the bin width of protein intensity were 300. Then the protein ratio (ratio=reporter intensity1/reporter intensity 2) with Benjamini-Hochberg corrected significant B value less than 0.05 were picked out as differentially expressed proteins. Biological variability was calculated by the intensity ratio of the DMSO30d or DMSO15d sample /-DMSO sample labeled with 115 tag, their R2 value and SD. For protein expression comparison before and after differentiation, two comparisons were made: DMSO15d compared with –DMSO was termed as Comparison I and DMSO30d compared with –DMSO was termed as Comparison II.

Membrane Protein Prediction and Expression Comparison The MBPs were predicated by 3 different online tools (Phobius: http://phobius.sbc.su.se/, SOSUI: http://bp.nuap.nagoya-u.ac.jp/sosui/ and TMHMM: http://www.cbs.dtu.dk/services/TMHMM/)30. A protein was annotated as a membrane protein only if it was predicated by at least two of the predication methods. The up- and down-regulated MBPs were used for further bio-functional and IPA analysis only when expression difference criteria (log2ratio > 3SD or < -3SD, p-value < 0.05) were satisfied in both Comparison I and Comparison II, where SD is the standard deviation of technical repeats of 114-labelled and 115-labelled of -DMSO samples. The over-represented disease and function correlations and protein-protein networks were generated based on information contained in IPA.

Validation of Representative Proteins’ gene and protein Expression of by qRT-PCR and Western Blot The gene expression level of MMP-14 and OCLN were quantitatively compared by qRT-PCR. 10


Page 10 of 38

Page 11 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Total RNA of -DMSO, DMSO15d, and DMSO30d were isolated by Trizol (Thermo, Waltham, MA, USA). Reverse transcription was performed using the PrimeScript RT Kit (Takara, Kyoto, Japan). qRT-PCR was performed using the SYBR Premix Ex Taq II kit (RR820W, Takara, Kyoto, Japan) on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The primer sequences of MMP14 were: MMP14-U-F (5′-ACCGCCGGGGCATCCAGCAACT-3′) and MMP-14-D-R (5′-CAGGAACAG AAGGCCGGGAGGTAG-3′). The primer sequences of OCLN

were ： OCLN-U-F

(5′-TGCCTTCACCCCCATCTG-3′)

and

OCLN-D-R

(5′-ACCACCGCTGCTGTAA CGA-3′). Expression of target genes were normalized to the housekeeping gene GAPDH in the same sample. The primer sequences of GAPDH were: GAPDH-U-F

(5′-

GAAGGCTGGGGCTCATTT-3′)

and

GAPDH-D-R

(5′-

CAGGAGGCATTGCTGATGAT -3′). Data were quantified using the 2−∆∆C(t) method. DMSO15d and DMSO30d expression level were expressed as fold changes relative to -DMSO. Three independent experiments were performed for each sample. Protein expression of OCLN, MMP-14, and CD44 were compared by western blot. Briefly, aliquot of the total cell lysate of each sample (40 µg) were ran on 12 % SDS-PAGE gel, transferred to PVDF membrane, and incubated with primary antibodies overnight at 4 ℃ after 5 % BSA in TBST blockage for 2 h at room temperature. The primary antibody dilution ratios were 1:10,000, 1:2,000 and 1:200 for anti-occludin, anti-MMP-14, and anti-CD44 respectively. After primary antibody incubation, membranes were washed with TBST for 3 times and subsequently incubated with respective HRP-conjugated secondary antibodies followed by chemiluminescent detection with ECL detection reagents. Images were captured and analyzed using the Tanon-5200 Chemiluminescent imaging system (Tanon, Shanghai, China). 11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Transwell Cell Migration Assay of HepaRG Migration with and without MMP Inhibitor For the transwell migration assay, cells were resuspended in serum-free medium with or without MMP inhibitor GM6001 (final 10 µM) and seeded into the insert well of a 24-well plate (8-mm pores, BD biosciences, Beijing, China) for 24 h. The culture medium containing 10% fetal bovine serum was used as a chemoattractant and placed in the bottom chamber. Cells were fixed in paraformaldehyde (4%) and stained in crystal violet (0.5% in 20% methanol). Remaining cells in the upper chamber (non-migratory cells) were washed with a cotton swab and the membrane was removed. Adherent cells to the bottom of the membrane (migratory cells) were counted under an Olympus microscope (Olympus USA).

MMP-14 Expression Comparison at Protein and Gene Levels in HCC Cell Lines and HCC Tissue Samples The anti-MMP-14 western blot based on 40 µg of the total cell lysate of HCC cell lines (MHCC97L, MHCC97H, and HCCLM6) was performed following the same method described above. The mRNA expression of MMP14 in HCC tumor tissue (TP) and non-tumor control (NT) were compared of 50 HCC clinical samples collected in TCGA dataset (The cancer genome atlas) (http://cancergenome.nih.gov/) 31.

RESULTS Morphological Changes With and Without DMSO The HepaRG cells cultured without DMSO, representing non-differentiated states, were morphologically evaluated at day 1, 6, and 15. The HepaRG cells cultured with DMSO, representing differentiation induction, were evaluated at days 3, 15, and 30 (Figure 2A). At day 6 12


Page 12 of 38

Page 13 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


after seeding without DMSO, the cells maintained the undifferentiated morphology. After DMSO induction, small hepatocyte-like cells (h) and epithelium-like cells (e) were observed at days 15 and 30. The number of hepatocyte-like cells increase with time under DMSO induction.

The Overall Scheme for MBPs Preparation and Analysis In order to identify the MBPs with significant expression changes upon differentiation, data from day 6 harvest without DMSO (-DMSO), day 15 harvest with DMSO (DMSO15d), and day 30 harvest with DMSO (DMSO30d) were used to represent non-differentiated and different differentiated states. Samples underwent membrane protein extraction, consecutive in-solution digestion by Lys C and trypsin, iTRAQ labelling, LC-MS-MS, expression analysis, and target validation. To evaluate technical variations, technical duplicates of -DMSO sample were split into two portions at a ratio of 2:1 and labelled with 114 and 115 tags respectively. Samples were combined at a mass ratio of 2:1:1:1 (-DMSO labelled with 114 tag: -DMSO labelled with 115 tag: DMSO30d labelled with 116 tag: DMSO15d labelled with 117 tag) (Figure 1). In this way both representation and comparability were obtained.

Validation of Sample Qualities Validation of MBPs extraction step was achieved by SDS-PAGE (Figure 2C). The patterns of each MBPs lines were quite similar while the MBPs of DMSO30d showed fewer bands at the high MW range (>120 kD). Western blot were also performed for the same samples (Figure 2D). E-cadherin and β-Actin were evaluated as representative of membrane and cytoplasmic proteins respectively. As expected, the relative intensity of E-cadherin in membrane protein fraction was much higher than the supernatant, while the relative intensity of β-Actin in membrane protein fraction was much lower than the supernatant. 13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Quantitative Proteomics Reveals the Differentially Expressed MBPs During Differentiation At peptide identification level, among the 13,019 characterized peptides, 5,642 peptides belong to MBPs (43.95 %); among the 12,140 unique peptides, 5,335 unique peptides belong to MBPs (43.34 %). At protein identification level, among the 2,874 characterized proteins, 1,161 proteins were MBPs (40.40 %). At protein quantification level, among the 11,810 characterized peptides, 5,235 peptides belong to MBPs (43.95 %); among the 11,276 unique peptides, 5,025 unique peptides belong to MBPs (44.56 %); and among the 2,007 quantified proteins with all four labeled tags and ≥2 unique peptides, 849 proteins were MBPs (42.30 %) (Figure 3A, Table 1, Table S-1, 2, and 3). To our knowledge, this membrane protein dataset was the largest one for HepaRG cell line. Prediction by TMHMM shows that the majority of these 849 MBPs are single-pass transmembrane proteins (Figure S-2A). Uniprot annotation showed that 328 and 344 MBPs are located on plasma membrane and endoplasmic reticulum, respectively, confirming the membrane nature of this protein dataset (Figure S-2B). The quality of the quantitative comparisons were first evaluated by the technical repeats of – DMSO with 114 tag and –DMSO with 115 tag. The mean of the log2 (114/115) was 1.055, and the SD was 0.175. This result implied a highly reproducible and well-controlled experimental procedure (Figure 3B). Comparison I was made between 117 and 115 labelled tags, termed DMSO30d/-DMSO. Comparison II was made between 116 and 115 labelled tags, termed DMSO15d/-DMSO. The distributions of log2 (DMSO15d /-DMSO) and log2 (DMSO30d/-DMSO) were all symmetrically fit to Gaussian curves. The SD values of the curves were 0.57 and 0.40 14


Page 14 of 38

Page 15 of 38

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


respectively (Figure S-3B). These results indicated that the high quality proteomic dataset can be used to discover expression change of MBPs during HepaRG differentiation. A stringent criteria of log2ratio> 3 SD or

iTRAQ-Based Membrane Proteomics Reveals ... - ACS Publications

Recommend Documents