Just in Time-Selection: A Rapid Semiautomated SELEX of DNA

Article pubs.acs.org/ac

Just in Time-Selection: A Rapid Semiautomated SELEX of DNA Aptamers Using Magnetic Separation and BEAMing Tim Hünniger, Hauke Wessels, Christin Fischer, Angelika Paschke-Kratzin, and Markus Fischer* Hamburg School of Food Science, Institute of Food Chemistry, University of Hamburg, Grindelallee 117, 20146 Hamburg, Germany S Supporting Information *

ABSTRACT: A semiautomated two-step method for in vitro selection of DNA aptamers using magnetic separation and solidphase emulsion polymerase chain reaction has been developed. The application of a magnetic separator allows the simultaneous processing of up to 12 SELEXs (systematic evolution of ligands by exponential enrichment) with different targets or buffer conditions. Using a magnetic separator and covalent target immobilization on magnetic beads, the selection process was simplified and the substeps of aptamer/target incubation, washing, and elution of the aptamers were merged into one automated procedure called “FISHing”. Without further processing the resulting FISHing eluates are suitable for BEAMing (beads, emulsion, amplification, and magnetics), which includes the amplification by emPCR (emulsion polymerase chain reaction) and strand separation by the implementation of covalently immobilized reverse primers on magnetic beads. The novel selection process has been proved and validated by selecting and characterization of aptamers to the wine fining agent lysozyme.

A

rounds with more stringent washing conditions. Usually, it is necessary to perform up to 20 selection rounds to receive a subpool of sequences with the expected binding qualities. Different selection methods, particularly the combinations of varied techniques to generate aptamers more appropriate and more efficient, have been shown in the literature.15 These efforts are aimed to increase the quality of the SELEX process and thus of the resulting aptamers by using different techniques, such as FACS (fluorescence-activated cell sorting) for a higher stringency or CE (capillary electrophoresis) for an improved separation of nonbound and bound aptamers.16−19 One remarkable shortcoming of the conventional SELEX is that the efficiency of the whole selection process of the subpool is often biased due to the very high degree of diverse template sequences which influences the efficiency of the amplification. This is justified by three reasons: (i) the amplification of short DNA fragments is preferred, (ii) PCR artifacts are generated by recombination of homologous template regions, and (iii) highly diverse templates negatively influence formation of homoduplexes after denaturation.20 These effects could be minimized by implementation of emulsion PCR (emPCR) into the process which is used in many other applications, like nextgeneration sequencing techniques, which also have to contend with high template diversities.21,22 The utilization of a water-inoil emulsion offers the benefit of compartmentalization so that

ptamers are short synthetic single-stranded DNA or RNA oligonucleotides.1−4 Due to their distinct three-dimensional structures based on intramolecular Watson−Crick base pairing these sequences form defined pockets which enable binding of variable target molecules.5−8 Aptamers could be used as highly sensitive and selective artificial receptors with similar binding properties as antibodies and have a broad therapeutic, diagnostic, and analytical scope.9,10 Various studies showed that both aptamers and antibodies could reveal dissociation constants up to the low-nanomolar range. Furthermore, aptamers possess a variety of positive characteristics compared to antibodies, such as low production costs, in case of DNA aptamers a higher physical and chemical stability and an equal or superior affinity to the targets. All these advantages feature aptamers as well-suited receptor molecules for biosensor development.11,12 Nucleic acid sequences with the desired binding properties are selected from random combinatorial sequence libraries by an in vitro process called systematic evolution of ligands by exponential enrichment (SELEX).13,14 The evolutionary SELEX process is characterized by multiple rounds of alternating selection steps of sequences from a sequence pool and amplification of the selected subpool. Each selection round contains the substeps (i) incubation of the aptamer pool with the target, (ii) various washing steps for discarding nucleic acid sequences with little or no affinity to the target, (iii) amplification of the resulting sequence pool with target affinity by polymerase chain reaction (PCR), and (iv) a mandatory strand separation of the double-stranded PCR products to obtain again single-stranded sequences for further selection © XXXX American Chemical Society

Received: August 26, 2014 Accepted: October 6, 2014

A

dx.doi.org/10.1021/ac503261b | Anal. Chem. XXXX, XXX, XXX−XXX

Analytical Chemistry

Article

The validation of the application was performed by using the wine fining agent lysozyme as SELEX target and a defined selection buffer, which is in context of ion concentrations (sodium, potassium, magnesium, calcium, phosphate, and ethanol) comparable to white wine. The confirmation of the aptamers binding to the target is shown by the determination of the dissociation constants and specificity of selected aptamers. The presented selection method is not proposed as a targetspecific protocol but as a general strategy which can be customized for different applications.

the amplification of highly diverse templates, like aptamer pools, is practicable with a highly improved efficiency and with reduced PCR bias.23,24 The micelle formation induces an ideal static distribution, i.e., each micelle contains all necessary PCR ingredients and only a small number of different template types leading to a highly improved amplification of the selected aptamer pool.25,26 Magnetic particles or magnetic separators are used in different SELEX techniques.27−30 For example, the CaptureSELEX describes the immobilization of the aptamer pool on the magnetic particles or other surfaces for soluble targets.31 Also different applications include a magnetic separator for both partial automation of the aptamer selection process.27−29,32,33 BEAMing (beads, emulsion, amplification, and magnetics), which was first published in 2006 for the determination of specific DNA mutations in different populations, is a combination of magnetic particles techniques with emPCR and was implemented into the classical SELEX process recently.34,35 The main improvement of the SELEX process in this case is the combination of aptamer amplification with the subsequently crucial strand separation which is essential for process by immobilization of the reverse primer sequence on magnetic beads. The present work focuses on the development of a modified DNA aptamer selection system. The unique feature of this system is the combination of two existing approaches which are coordinated resulting in a more rapid aptamer selection with an easier semiautomatic handling and more reliable quality of the resulting aptamers. Due to the pronounced acceleration of the whole SELEX process we propose to name the novel protocol just in timeSelection of aptamers (see Figure 1).

■

MATERIAL AND METHODS Reagents. See the Supporting Information. FISHing. General Process. Generally, each SELEX cycle starts with the magnetic separator picking up the plastic shell (called comb, see Supporting Information Table S-1, row B) to prevent direct contact to the solutions in the following steps. The subsequent steps belong to the counterselection process which is performed during SELEX rounds 1−4, starting with the magnetic separator dipping into a suspension of counterselection beads (see Supporting Information Table S-1, row F), followed by consecutive washing step (see Supporting Information Table S-1, row G). The next step is the incubation of the counterselection beads and the aptamer pool in a corresponding selection buffer (see Supporting Information Table S-1, row D). In the terminal step of the counterselection process the counterselection beads with unspecific bound aptamers are discarded (see Supporting Information Table S-1, row H). The next regular steps belong to the incubation of target and aptamer pool, which follows the counterselection in rounds 1− 4, respectively, the picking of the comb in rounds 5−15. The magnetic separator dips into the suspension of target beads (see Supporting Information Table S-1, row A) and performs a consecutive washing step (see Supporting Information Table S1, row C). This step is then followed by the incubation of the target beads and the aptamer pool in the selection buffer (see Supporting Information Table S-1, row D). One (see Supporting Information Table S-1, row E) to three (see Supporting Information Table S-1, rows E−G) washing steps follow subsequently with different incubation times and volumes, depending on the desired stringency. The incubation times and washing volumes are stated in Table 1, which show an increasing stringency via the constant intensification of binding requirements. Finally, the target beads with bound aptamers are moved by the magnetic separator to the elution strip (see Supporting Information Table S-1, row I), heat eluted into ddH2O by 75 °C, and then the used target beads are discarded (see Supporting Information Table S-1, row H). The technical construction of the magnetic separator’s operation mode is shown schematically in Figure 2. Target Beads Preparation. The aptamer selection method of this study was developed by using SiMAG-Carboxyl beads (Chemicell GmbH, Berlin, Germany) with a diameter of 1.0 μm. The coupling of the target, like lysozyme, was carried out according to the following protocol given by the manufacturer (see Figure 3A): 10 mg of SiMAG-Carboxyl particles (50 mg/ mL) was washed twice with 1 mL of MES buffer; subsequently beads were resuspended in 250 μL of MES buffer containing 10 mg of freshly prepared EDC and agitated 10 min at room temperature for activation. Then 50 μg of lysozyme (SELEX target, containing approximately 0.5 nmol of surface-accessible

Figure 1. Summary workflow illustration of the just in time-Selection process in contrast to the traditional SELEX: starting with the aptamer pool in the first FISHing round followed by the subsequent BEAMing in a consecutive order. Each BEAMing eluate represents the aptamer pool for the following FISHing process. FISHing is the fully automated part and the BEAMing combines two steps into one.

The technical concept of the just in time-Selection is on the one hand based on the implementation of a robotic magnetic separator (substeps (i) and (ii)) to reduce manual sample handling and thus increase general reproducibility. On the other hand the nonautomatable substeps (iii) and (iv) were merged for easier and thus more efficient processing. B



Article

final concentration of particles was adjusted to 10 mg/mL, which corresponds according to the manufacturer’s instruction of 1.8 × 1010 beads/mL. Beads Preparation for Counterselection. To avoid unspecific binding of aptamers to the bead surface, a counterselection was accomplished in SELEX rounds 1−4. The implementation of a counterselection in SELEX rounds 1− 4 is advantageous to remove aptamers with unspecific binding properties and therefore to antagonize undesirable selection. The coupling was carried out according to the abovementioned protocol, merely without target immobilization to obtain just ethanolamine at the bead surface. General Conditions. Before each FISHing process the corresponding aptamer pools were heated (5 min, 95 °C) followed by immediately cooling (4 °C) to eliminate heteroduplexes. Due to the design of the magnetic separator the ingredients of the corresponding SELEX substeps (incubation, washing, and elution) are distributed in specific rows of the DeepWell plates (see Supporting Information Table S-1). To increase the stringency and thereby the efficiency of the SELEX process, washing volumes were increased and incubation times were decreased during the SELEX process (see Table 1). The final elution step was performed in ddH2O so that the FISHing eluate was utilizable without further preparation for the following BEAMing process. The FISHing eluate of the presented setup was not required for BEAMing in total, but remained as a retained sample. The SELEX conditions for the washing steps and incubation times are crucial parameters for the selection of suitable aptamers. The used conditions are summarized in Table 1 and the Supporting Information (see Table S-1). During the development of just in time-Selection aptamers for lysozyme were selected in white wine simulating buffer. BEAMing. Beads Preparation for BEAMing. For the coupling of reverse primer sequences to magnetic beads 5 nmol of 5′-NH2−C12-reverse-primer (5′-/5AmMC12/-rv-primer, Integrated DNA Technologies Inc., Leuven, Belgium) was used. The primer coupling was carried out according to the above-mentioned protocol (see target beads production), merely the 50 μg of SELEX target was substituted with the primer. Further, bovine serum albumin (BSA; 0.1%) was used as a blocking reagent in the blocking buffer (see Figure 3B). The resulting final concentration of particles was adjusted to 10 mg/mL, which corresponds according to the manufacturer’s instruction 1.8 × 1010 beads/mL. Setup of emPCR. The amplification of the aptamer pool during each SELEX round was carried out with a volume of 150 μL of aqueous phase in a 2 mL reaction tube as follows: 15 μL of 10× DreamTaq buffer, 9 μL of DreamTaq polymerase (0.5 U/μL), 6 μL of dNTPs, 4 μL of forward primer (100 μM), 4 μL of reverse primer (2.5 μM), 6 μL of 5′-/5AmMC12/-rvprimer beads, and the template varied between 2 and 200 amol. The yield of DNA was quantified after each FISHing round using Quanti-iT OliGreen ssDNA assay kit (Invitrogen, Life Technologies GmbH; Darmstadt, Germany) and set to 0.05− 0.5 ng per preparation as BEAMing template. After assembling the aqueous phase, the oil phase compounds were added subsequently to the reaction tube: 46 μL of ABIL WE09, 132 μL of mineral oil, and 438 μL of TEGOSOFT DEC. Aptamer Amplification. The tube was mixed 5 min at room temperature to create a homogeneous emulsion. Due to the volume of the reaction mixture, splitting into aliquots was

Table 1. Incubation Times, Washing Steps, Washing Volumes, and the Required Time Periods for the FISHing Processa SELEX round

incubation time (min)

washing steps

washing volume (μL)

required time

1−4 5−6 7 8 9 10 11 12 13 14−15

40 40 35 30 25 20 15 15 15 15

1 2 2 2 3 3 3 3 3 3

200 200 200 200 200 200 400 600 800 1000

2h 1 h 15 min 1 h 10 min 1 h 10 min 1 h 5 min 1 h 5 min 55 min 55 min 55 min 55 min

a

The required times arise from the wide range of incubation times (from 40 to 15 min) and washing steps (1−3) which increase during the SELEX process due to the rising stringency.

Figure 2. Operation mode (A is catch, B is move, C is release, and D is incubate) of the magnetic separator (KingFisher Duo, Thermo Fisher Scientific Oy, Vantaa, Finland). The magnetic dips are covered by a plastic comb and move into different wells containing suspended magnetic beads. After activation of the magnet, the beads are attached to the magnetic dips and could be transferred into different wells for various substeps (adapted with permission from Thermo Fisher Scientific Inc., Schwerte, Germany (2014)).

Figure 3. Schematic illustration of (A) the immobilization of amino group containing targets (e.g., proteins) on magnetic beads via carboxamide bonds and (B) the immobilization of a 5′-aminated primer containing a C12-spacer on magnetic beads via carboxamide bond.

amino groups) was added to activated particles and mixed for 2 h at room temperature by agitation. The beads were washed three times with 1 mL of PBS buffer, and afterward particles were blocked with 1 mL of blocking buffer. The target beads were washed with 100 μL of ddH2O prior to use. The resulting C



Article

Figure 4. Schematic illustration of solid-phase aptamer amplification with subsequent strand separation of PCR products during BEAMing without a detailed consideration of amplification kinetics and DNA input/output ratio.

denaturation at 95 °C for 30 s, a sequence-dependent annealing temperature (for primers of this study: 56 °C) for 30 s, and an elongation at 72 °C for 30 s. Thereafter, a final elongation at 72 °C for 5 min and finally a storage temperature of 4 °C followed. The Control-PCR products were analyzed by agarose gel electrophoresis and ethidium bromide/UV visualization. On observing DNA products with the expected length (according to the used aptamer pool: 76 bases), the resulting BEAMing eluate was applied for the subsequent SELEX round. It is also possible to assess the BEAMing eluate without any further amplification, but taking the indirect route via ControlPCR more reliable results could be obtained. Due to detection via intercalation of ethidium bromide after agarose gel electrophoresis and relatively low amounts of single-stranded DNA, a direct detection of BEAMing products is conceivably practicable but not recommended. Aptamer Cloning. The selected aptamer pool from round 15 of the just in time-Selection was ligated using TOPO TA cloning kit (Invitrogen Life Technologies GmbH, Darmstadt, Germany) and transformed into Escherichia coli XL1 cells. The resulting plasmids were prepared using QIAprep Spin miniprep kit (Qiagen GmbH, Hilden, Germany). Sequencing of the cloned aptamer sequences was performed using M13 forward primer (GATC-Biotech AG, Konstanz, Germany). Determination of Aptamer Dissociation Constants (KD) via SPR. The determination of aptamer dissociation constants (KD) was performed by surface plasmon resonance (SPR) spectroscopy experiments on a SPR-2 biosensor system (Sierra Sensors GmbH, Hamburg, Germany). All SPR experiments were carried out at 25 °C with a flow rate of 25 μL/min using degassed PBS (containing 0.01% Tween 20) as running buffer. The sensor chip (SPR-AS-AM, Sierra Sensors GmbH, Hamburg, Germany) was activated for 7 min by injecting a mixture (1/1, v/v) of NHS (100 mM) and EDC (400 mM). Lysozyme (1 mg/mL) was diluted in sodium acetate (10 mM, pH 6.0) and injected on spot 2 for 8 min. Following, an injection of BSA (100 μg/mL) diluted in PBS buffer for 4 min on spot 1 was performed for the detection of nonspecific aptamer interactions. The chip surface was blocked by injecting ethanolamine (1 M, pH 8.5) for 7 min. The sensor chip was regenerated by injecting a mixture (1/1, v/v) of sodium hydroxide (10 mM) and sodium chloride (1 M) for 1 min. The KD determinations were performed in white wine simulating buffer (containing 0.01% Tween 20) as running

necessary to perform a PCR under following conditions: an initial denaturation at 95 °C for 5 min and subsequently 30 thermal cycles of denaturation at 95 °C for 30 s, a sequencedependent annealing temperature (with the used primers: 56 °C) for 30 s, and an elongation at 72 °C for 30 s. Thereafter, a final elongation at 72 °C for 5 min and finally a storage temperature of 4 °C followed. Emulsion Break. For breaking the emulsion aliquots were pooled in a 2 mL reaction tube, 1.5 mL of isobutyl alcohol (storage at −21 °C) was added, and the solution was mixed until it was transparent. Subsequently the reaction mixture was centrifuged 5 min at 10 500g to precipitate the magnetic beads at the bottom of the tube. The supernatant was removed using a magnetic rack, and the beads were resuspended in 80 μL of ddH2O before the tube was incubated 10 min at 95 °C for heat denaturation of doublestranded amplification products. Straight thereafter, a centrifugation for 10 s at 10 500g and separation by placing the tube in a magnetic rack to agglomerate the magnetic beads at the bottom followed. The still hot supernatant contained the desired aptamers ready to be transferred into a new reaction tube. Due to the immobilization of reverse primers on the magnetic beads this solid-phase emulsion application combines the SELEX substeps amplification including the strand separation of the resulting PCR products (see Figure 4). The supernatant (80 μL) of the reaction mixture represents the BEAMing eluate which is ready to be used for the next FISHing step. The yield of DNA was quantified after each BEAMing using Quanti-iT OliGreen ssDNA assay kit (Invitrogen, Life Technologies GmbH; Darmstadt, Germany) to set up DNA concentration for further SELEX rounds. Hence, the whole volume of the BEAMing eluate was not required for FISHing, so the residual eluate volumes remained as a retained sample. Control-PCR. For the evaluation of each SELEX round it was recommendable to experimentally check the quality of each BEAMing cycle. A Control-PCR was performed as follows: 2.5 μL of 10× DreamTaq buffer, 0.5 μL of DreamTaq polymerase (0.5 U/μL), 2.0 μL of dNTPs, 0.25 μL of forward primer (100 μM), 0.25 μL of reverse primer (100 μM), 1 μL of BEAMing eluate, and filled up to 25 μL with ddH2O. The PCR was carried out applying an initial denaturation step at 95 °C for 5 min and subsequently 15 thermal cycles of D



Article

FISHing process. Furthermore, the FISHing preparation is standardized, requires neither highly qualified staff nor continuous observation, and it is applicable for various targets or selection buffers. Part 2: BEAMing. The second section of the modified SELEX process which is a further development of the known BEAMing strategy includes the other technical substeps which are the prerequisites to run the next trapping round under more stringent conditions. Currently the state-of-the-art method for aptamer amplification in the context of in vitro selection is a conventional PCR. In this scope the user has to face two serious problems, which are (i) an increased PCR bias caused by the intrinsic high template diversity in the aptamer pool and (ii) the unavoidable formation of double-stranded DNA products, which have to be separated for further applications. A state-of-the art solution to overcome the PCR bias and decrease artifact formation during the amplification of highly diverse aptamer sequences would be the implementation of an emPCR which has been recently shown by Schütze et al.22,36 Due to the fact that the complete SELEX performance is significantly dependent on the overall efficiency of the amplification step, the implementation of emPCR into SELEX process generally has a positive impact to the whole selection process. By utilization of a water-in-oil emulsion various separate reaction compartments are generated and they contain only a few different template sequences each. Thus, due to compartmentalization PCR template diversity is substantially reduced so that the formation of PCR artifacts is minimized (see Supporting Information Figure S-1).36,37 The ratio between aqueous and oil phase volume is crucial for the generation of arelated to the template concentrationideal number of micelles which include the corresponding PCR compounds in required concentrations.24 Ideal PCR conditions could be approached by the adjustment of an optimal templates/micelles ratio under consideration of the micelle diameter (3.0−9.0 μm). Furthermore, the other shortcoming is the inherent formation of double-stranded products by the PCR. The resulting PCR products have to be strand-separated to obtain the desired single-stranded aptamers for further SELEX rounds. The state-of-the-art method for strand separation is the biotinylation of the complementary strand through the implementation of biotinylated reverse primers during PCR. Using this approach the obtained double-stranded PCR products are biotinylated at 5′-end of the reverse strand and can be separated after denaturation by using streptavidincoated beads.38−40 In terms of costs the utilization of streptavidin-coated beads is a significant disadvantage. The novel strategy of BEAMing combines the aptamer amplification and strand separation using solid-phase emulsion PCR via direct coupling of the reverse primer to the magnetic beads. Diehl et al. used the strong interaction between biotin and streptavidin for the coupling of biotinylated primers and streptavidin beads for the application in solid-phase emulsion PCR.34 This approach does not overcome the disadvantage of streptavidin bead costs, so we established a covalent coupling of aminated reverse primers to carboxylated beads. In the present study, variable coupling strategies for the attachment of the reverse primer to the beads, blocking methods, BEAMing cycles, forward primer concentration, concentration of dNTPs, concentration of polymerase, and various magnetic particles were investigated in order to improve the BEAMing process. The evaluation was based on the

buffer by injecting four different aptamer concentrations (250, 500, 750, and 1000 nM) for 6 min of the purchased aptamers. The obtained data were calculated using AnalyserR2 (Sierra Sensors GmbH, Hamburg, Germany) and Scrubber (BioLogic Software Pty Ltd., Campbell, Australia) after subtraction of the reference spot signal from target spot signal.

■

RESULTS AND DISCUSSION Generally, the SELEX process is very elaborate and timeconsuming.16,17 Different selection methods particularly the combinations of varied techniques, such as FACS for a higher stringency or CE for an improved separation of nonbound and bound aptamers, to generate aptamers more appropriate and more efficient have been shown in the literature. The present work was aimed on the development of a modified and more efficient DNA aptamer selection system called just in time-Selection. The novelty of this system is the combination of two existing approaches which are coordinated resulting in a more rapid aptamer selection with an easier handling and more reliable quality of the resulting aptamers. Part 1: FISHing. The first section of the process we named FISHing, i.e., fishing up the best aptamers from a pool of sequences includes the substeps (i) incubation of the aptamer pool with the target, (ii) removing of aptamer sequences with low or no specificity for the target by washing steps with increasing stringency, and (iii) the elution of the resulting sequence subpool with target affinity. Generally, immobilization of the target (e.g., small chemical compounds, proteins, or cells) is indispensable for the SELEX process. The immobilization can be performed via a carboxamide bond with an amino or carboxyl group of the target and the corresponding groups of the magnetic beads (see Figure 3A). The immobilized targets are handled program-controlled using an automatic operator by a magnetic rod and are moved efficiently by the magnet between different wells of the 96-DeepWell plate (see Figure 2). Thus, the substeps of incubation (immobilized target with the sequence library), washing (removing sequences without affinity to the target), and elution of sequences with affinity to the target (resulting aptamer pool) can be easily performed in separate wells without any delay in the process (see Supporting Information Table S-1). Furthermore, the system allows for different setups in terms of volumes, incubation times, and washing frequencies; therefore, it is possible to continuously increase stringency during the SELEX process. Additionally, implementation of a counterselection (i.e., beads without immobilized target or a similar target) to eliminate aptamers with an undesired affinity is possible without considerable delay. Furthermore, the integration of the automatic operator obeys several positive timely relevant aspects. (i) On the one hand the setup of DeepWell plates requires for 12 parallel SELEXs approximately 5 min. (ii) The subsequent process is ranging over a time period between 55 min and 2 h, depending on the corresponding SELEX round (see Table 1). Even though 2 h for the first four SELEX rounds seems to be quite long, but this time interval includes already a counterselection against magnetic particles without bound target molecules. (iii) Obviously it seems reasonable that, besides a significantly better and faster handling, a lower risk of cross contamination could be expected by an automated procedure in the crucial steps for successful aptamer selection. The conventional SELEX includes a high demand of consumables, which could be reduced due to the integrated E



Article

In summary the slightly modified BEAMing strategy presented in this study offers a rapid technique for aptamer amplification and strand separation in context of SELEX in one single work routine. Furthermore, the solid-phase emulsion amplification of aptamers is faster than conventional PCR with subsequent strand separation via streptavidin-coated magnetic particles because of the elongated incubation of biotinylated PCR products. Applications. The novel just in time-Selection process was applied to the fining agent lysozyme as target molecule. The results of the just in time-Selections showed appropriate results without PCR artifacts but with satisfactory yields. After each SELEX round Control-PCR products (of the BEAMing eluates) with the expected size are detectable; thus, a successful selection and amplification could be concluded (exemplary shown in Figure 5). Furthermore, we monitored the aptamer/

distinctness of resulting bands by agarose gel electrophoresis and obtained yields measured by UV spectroscopy (260/280 nm ratio, NanoDrop 1000, Thermo Fisher Scientific Oy, Vantaa, Finland). The first approach compared the mentioned application of Diehl et al. with our directly covalently attached reverse primers. Furthermore, the implementation of spaced reverse primers and magnetic beads with different diameters were tested (Figure 3B). Moreover we examined the necessity of uncoupled reverse primers in aqueous phase to increase the yield of the BEAMing step. Finally the blocking reagent was varied (BSA; ethanolamine). The extensive screening and assessment of variable conditions showed that the usage of SiMAG-Carboxyl beads (diameter: 1.0 μm), aminated C12-reverse primer, and BSA as blocking reagent led to very satisfactory BEAMing products. In comparison Diehl et al. showed a typical BEAMing yield of approximately 15 ng/μL, whereas the optimized BEAMing conditions in this study lead to a yield up to 165 ng/μL (see Supporting Information Table S-2). Furthermore, adding uncoupled reverse primers to the aqueous phase supported the product formation at the initial amplification phase. By this the yield of BEAMing products could be strongly improved by a factor of 10 compared to the literature.34 Optimizing template concentration is also essential for BEAMing product quality because Schütze et al. demonstrated already that higher template concentrations lead to the formation of emPCR artifacts.22 A possible explanation for this could be the unbalanced relation between micelles and the amount of templates, because the reduction of template diversity by distribution is not yet given under these conditions. In this context we tested to what extent this appearance occurs during BEAMing and investigated a wide range of different concentrations to determine the optimal conditions. The validation of the template concentration showed that from a quantity of 2 fmol per preparation the formation of artifacts is clearly recognizable (see Supporting Information Figure S-2). Furthermore, the detection of BEAMing products is at least possible with a template amount of 2 amol per preparation. This is well in line with published approaches stating a template concentration of approximately 10 fmol per preparation in a relatively wide range.26,35 In addition to the less formed artifacts via BEAMing another intercessional aspect to implement the solid-phase emulsion for amplification of aptamers is that conventional PCR with subsequent strand separation using streptavidin-coated beads leads to fairly low yields. In contrast the method of BEAMing shown in this study yielding DNA concentrations in average 160 ng/μL (conservative method approximately up to 15 ng/ μL), which also provides the possibility to retain samples for further investigations. The higher yields of the BEAMing process allows applying in principle two different techniques for quality control as follows: (i) Control-PCR: the implementation of a Control-PCR serves as an easy, cheap, and fast technique to monitor the success of the process after each selection round. (ii) SPR: RU (response units) signals could be easily measured after each SELEX round via SPR, due to the relatively large yields of the BEAMing step (see Figure 6). The usage of more elaborate and time-consuming methods like SPR offer more detailed information (e.g., binding constants) of the obtained aptamer pools, but the used Control-PCR is sufficient for a rapid assessment (DNA: yes or no) of each selection round.

Figure 5. Agarose gel of Control-PCR products after each SELEX round for the selection of aptamers with an affinity to lysozyme. Control-PCR products with the expected size are visible (1−15 correspond to the SELEX rounds 1−15, 16 is the positive control, 17 and 18 are the negative control).

target affinity after each SELEX cycle by SPR measurements (see Figure 6). A rising aptamer affinity to the target during the selection process could be observed in course of the process; thus, the novel just in time-Selection method led to aptamers with improved binding properties after each SELEX cycle. The evidence of general aptamers presence during the developed selection process is shown in Figure 5. The bands of the Control-PCR show the expected fragment length of 76 bases, which would not exist after an unsuccessful aptamer selection. Thus, it can be concluded that aptamers with the expected length are results directly related to the developed aptamer selection method. After the SELEX it was necessary to separate the obtained aptamer pool by cloning for further characterization. Some of the obtained aptamers for lysozyme are listed in Table 2. Secondary structures are predicted using mfold V4.6 and shown of LysApt 1, LysApt 2, LysApt 3, LysApt 4, and LysApt 5 in Supporting Information data (Figure S-3).41 F



Article

the measured aptamers is comparable to traditional selection methods (data indirectly shown in the subtraction of the reference spot of the target spot).42 Next to further factors a valuation could be based on the obtained KD values of different aptamers to their targets. For the presented examples of aptamers with an affinity to lysozyme in white wine simulating buffer dissociation constants from approximately 4.0 to 21.7 nM were determined (see Table 2). Obtained KD values in this study are very similar to other published aptamers (range from 2.8 to 52.9 nM) for the same target.43 However, as mentioned above, the aptamer affinity to a target can be influenced by different buffer conditions like the pH value, temperature, etc. Because of this the different parameters are only comparable to a limited extent. Nevertheless, the determined dissociation constants demonstrate that the just in time-Selection could be used as a suitable alternative with different benefits toward the traditional SELEX method.

Figure 6. Overlay of SELEX round injections sensorgrams (aptamer pool is F, SELEX round 2 is E, SELEX round 5 is D, SELEX round 8 is C, SELEX round 10 is B, and SELEX round 15 is A) to check aptamer affinity to the target. The rising aptamer affinity to the target during the selection process is visible due to the increasing RU signals. The single referenced data without buffer subtraction are evaluated with AnalyserR2 (Sierra Sensors GmbH, Hamburg, Germany) and Scrubber (BioLogic Software Pty Ltd., Campbell, Australia).

■

CONCLUSION This workflow extremely reduces the total processing time, thus making the whole process more efficient and last but not least leading to aptamer sequences with higher quality due to the reduction of manual steps. An innovative semiautomated two step method called just in time-Selection of DNA aptamers using magnetic separation (FISHing) and solid-phase emulsion-PCR (BEAMing) is shown in this study. The consecutively performed FISHing and BEAMing process steps are appropriate for a rapid, semiautomated, advantageous, and concurrent selection of DNA aptamers for a wide range of targets and selection conditions. By using the established and detailed described strategy it would be theoretically possible to implement 12 different SELEXs under various conditions in 10 days. Due to the mentioned aptamer properties novel and rapid infield applications are conceivable like lateral flow dipsticks/ devices (LFDs) and comparable techniques.44 Regarding the huge potential of aptamers concerning the properties of selectivity, affinity, and in vitro manufacturing, it becomes more and more plausible that single-stranded nucleic acids could be a substitute for antibodies and their fields of application. Especially taking into account that the directive 2010/63/EU on the protection of animals used for scientific purposes is already entered into force since 2013, the manufacturing of aptamers has to be rapid and efficient to present a strong option instead of antibodies.45

Determination of Aptamer Dissociation Constants (KD) via SPR. The validation and evaluation of the novel just in time-Selection method presented in this study is shown in the following for the lysozyme aptamer selection. One parameter to compare aptamers are the dissociation constants (KD values) under selected SELEX conditions. The KD values could be influenced by different parameters, like ion concentration, temperature, and pH value. However, the calculated dissociation constants serve as a basis for the evaluation of the obtained aptamers and the used selection method. The applied SPR-2 biosensor system (Sierra Sensors GmbH, Hamburg, Germany) is a one-channel system that measures the mass changes over two individual addressable spots. One spot was used as active spot and contains the immobilized lysozyme, the other spot as a reference with immobilized BSA. The RU signals of the lysozyme spot were subtracted by the RU signals of the BSA spot (reference) to eliminate nonspecific aptamer interactions. Furthermore, the response of a blank sample represented by white wine simulating buffer (injection time: 6 min) was also subtracted. For KD determination of generated aptamers the sensorgrams were fitted with Langmuir 1:1 model including a mass transport limitation factor. Examples of the obtained sensorgram overlays of four different LysApt concentrations (250, 500, 750, and 1000 nM) including the corresponding fits are shown in the Supporting Information (see Figures S-4−S-7). Because of the lower response units of the BSA spot as reference it can therefore be concluded that the specificity of

■

ASSOCIATED CONTENT

S Supporting Information *

Reagents (used reagents with detailed information), Table S-1 (ingredients and corresponding volumes in DeepWell plates for the FISHing process), Table S-2 (summary of the BEAMing yields optimization data), Figure S-1 (agarose gel of PCR

Table 2. Sequences and Calculated Dissociation Constants of Aptamers for the Target Lysozymea aptamer LysApt LysApt LysApt LysApt LysApt a

1 2 3 4 5

aptamer sequence (5′−3′)

KD (nM)

CATCCGTCACACCTGCTCGGCAAGTCAGCTTTGGGGAGGGTTCTGGTAGGCGGTAACTGGTGTTCGGTCCCGTATC CATCCGTCACACCTGCTCTTCAACGATTCTTTTTTTTTTGTCACGTTCGCATTGTCTTGGTGTTCGGTCCCGTATC CATCCGTCACACCTGCTCTGTTGTCGTCCTTGTGGTGTTGGCTCCCGTATCACGGCTGGGTGTTCGGTCCCGTATC CATCCGTCACACCTGCTCTTGTTATTTTTTGTTGATGTAGGTTTGATGATGTATTTCCGGTGTTCGGTCCCGTATC CATCCGTCACACCTGCTCCCTGCTAGAATTTTTCATGATCTTGCTGTATTTCTATTATGGTGTTCGGTCCCGTATC

13.37 4.00 10.65 21.72 17.90

The just in time-Selection was carried out in white wine simulating buffer. G



Article

(18) Wang, J.; Gong, Q.; Maheshwari, N.; Eisenstein, M.; Arcila, M. L.; Kosik, K. S.; Soh, H. T. Angew. Chem., Int. Ed. 2014, 53, 4796− 4801. (19) Mayer, G.; Ahmed, M. S.; Dolf, A.; Endl, E.; Knolle, P. A.; Famulok, M. Nat. Protoc. 2010, 5, 1993−2004. (20) Eulberg, D.; Buchner, K.; Maasch, C.; Klussmann, S. Nucleic Acids Res. 2005, 33, e45. (21) Williams, R.; Peisajovich, S. G.; Miller, O. J.; Magdassi, S.; Tawfik, D. S.; Griffiths, A. D. Nat. Methods 2006, 3, 545−550. (22) Schütze, T.; Rubelt, F.; Repkow, J.; Greiner, N.; Erdmann, V. A.; Lehrach, H.; Konthur, Z.; Glokler, J. Anal. Biochem. 2011, 410, 155− 157. (23) Shi, X.; Tang, C.; Wang, W.; Zhou, D.; Lu, Z. Electrophoresis 2010, 31, 528−534. (24) Li, M.; Diehl, F.; Dressman, D.; Vogelstein, B.; Kinzler, K. W. Nat. Methods 2006, 3, 95−97. (25) Shao, K.; Ding, W.; Wang, F.; Li, H.; Ma, D.; Wang, H. PloS One 2011, 6, e24910. (26) Dressman, D.; Yan, H.; Traverso, G.; Kinzler, K. W.; Vogelstein, B. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 8817−8822. (27) Glökler, J.; Schütze, T.; Konthur, Z. Molecules 2010, 15, 2478. (28) Cox, J. C.; Rudolph, P.; Ellington, A. D. Biotechnol. Prog. 1998, 14, 845−850. (29) Wochner, A.; Cech, B.; Menger, M.; Erdmann, V. A.; Glokler, J. BioTechniques 2007, 43 (344), 346−348 passim. (30) Zhu, Z.; Song, Y.; Li, C.; Zou, Y.; Zhu, L.; An, Y.; Yang, C. J. Anal. Chem. 2014, 86, 5881−5888. (31) Stoltenburg, R.; Nikolaus, N.; Strehlitz, B. J. Anal. Methods Chem. 2012, 2012, 415697. (32) Cox, J. C.; Ellington, A. D. Bioorg. Med. Chem. 2001, 9, 2525− 2531. (33) Cox, J. C.; Rajendran, M.; Riedel, T.; Davidson, E. A.; Sooter, L. J.; Bayer, T. S.; Schmitz-Brown, M.; Ellington, A. D. Comb. Chem. High Throughput Screening 2002, 5, 289−299. (34) Diehl, F.; Li, M.; He, Y.; Kinzler, K. W.; Vogelstein, B.; Dressman, D. Nat. Methods 2006, 3, 551−559. (35) Kojima, T.; Takei, Y.; Ohtsuka, M.; Kawarasaki, Y.; Yamane, T.; Nakano, H. Nucleic Acids Res. 2005, 33, e150. (36) Swami, A.; Espinosa, G.; Guillot, S.; Raspaud, E.; Boue, F.; Langevin, D. Langmuir 2008, 24, 11828−11833. (37) Ge, Q.; Liu, Z.; Bai, Y.; Zhang, D.; Yu, P.; Lu, Z. Anal. Biochem. 2007, 367, 173−178. (38) Dwivedi, H. P.; Smiley, R. D.; Jaykus, L. A. Appl. Microbiol. Biotechnol. 2013, 97, 3677−3686. (39) Graham, J. C.; Zarbl, H. PloS One 2012, 7, e36103. (40) Sefah, K.; Shangguan, D.; Xiong, X.; O’Donoghue, M. B.; Tan, W. Nat. Protoc. 2010, 5, 1169−1185. (41) Zuker, M. Nucleic Acids Res. 2003, 31, 3406−3415. (42) Duan, N.; Wu, S.; Chen, X.; Huang, Y.; Xia, Y.; Ma, X.; Wang, Z. J. Agric. Food Chem. 2013, 61, 3229−3234. (43) Tran, D. T.; Janssen, K. P.; Pollet, J.; Lammertyn, E.; Anne, J.; Van Schepdael, A.; Lammertyn, J. Molecules 2010, 15, 1127−1140. (44) Tombelli, S.; Minunni, M.; Mascini, M. Biomol Eng. 2007, 24, 191−200. (45) Directive 2010/63/EU of the European Parliament and of the council of 22 September 2010 on the protection of animals used for scientific purposes, in the version of 20.10.2010.

products and BEAMing product with a subsequent ControlPCR to illustrate the advantages of BEAMing), Figure S-2 (agarose gel of Control-PCR of BEAMing eluates for evaluation with different BEAMing template amounts for the determination of an optimal range of template concentrations to obtain defined products), Figure S-3 (prediction of secondary structures of LysApt 1, LysApt 2, LysApt 3, LysApt 4, and LysApt 5 using mfold V4.6), Figure S-4 (overlay of LysApt 1 aptamer injection sensorgrams), Figure S-5 (overlay of LysApt 2 aptamer injection sensorgrams), Figure S-6 (overlay of LysApt 3 aptamer injection sensorgrams), Figure S-7 (overlay of LysApt 4 aptamer injection sensorgrams). This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Phone: +49-40-428384357. Fax: +49-40-428384342. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors gratefully acknowledge Daniel Schwark for his help in developing and validating the aptamer selection method. We also thank Sven Malik from Sierra Sensors GmbH, Hamburg, Germany for the support with the SPR evaluations. This research project was supported by the German Ministry of Economics and Technology (via AiF) and the FEI (Forschungskreis der Ernährungsindustrie e. V., Bonn), Project AiF 17245 N.

■

REFERENCES

(1) Tuerk, C.; Gold, L. Science 1990, 249, 505−510. (2) Hasegawa, H.; Taira, K. I.; Sode, K.; Ikebukuro, K. Sensors 2008, 8, 1090−1098. (3) Stoltenburg, R.; Reinemann, C.; Strehlitz, B. Anal. Bioanal. Chem. 2005, 383, 83−91. (4) Joshi, R.; Janagama, H.; Dwivedi, H. P.; Senthil Kumar, T. M.; Jaykus, L. A.; Schefers, J.; Sreevatsan, S. Mol. Cell. Probes 2009, 23, 20− 28. (5) Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818−822. (6) Freeman, R.; Girsh, J.; Jou, A. F.; Ho, J. A.; Hug, T.; Dernedde, J.; Willner, I. Anal. Chem. 2012, 84, 6192−6198. (7) Zheng, D.; Zou, R.; Lou, X. Anal. Chem. 2012, 84, 3554−3560. (8) Kunii, T.; Ogura, S.; Mie, M.; Kobatake, E. Analyst 2011, 136, 1310−1312. (9) Duan, N.; Wu, S.; Chen, X.; Huang, Y.; Xia, Y.; Ma, X.; Wang, Z. J. Agric. Food Chem. 2013, 61, 3229−3234. (10) Tuleuova, N.; Jones, C. N.; Yan, J.; Ramanculov, E.; Yokobayashi, Y.; Revzin, A. Anal. Chem. 2010, 82, 1851−1857. (11) McKeague, M.; Giamberardino, A.; DeRosa, M. C. Advances in Aptamer-Based Biosensors for Food Safety. In Environmental Biosensors; Somerset, V., Ed.; InTech: Rijeka, Croatia, 2011. http:// www.intechopen.com/books/environmental-biosensors/advances-inaptamer-based-biosensors-for-food-safety. (12) Kong, L.; Xu, J.; Xu, Y.; Xiang, Y.; Yuan, R.; Chai, Y. Biosens. Bioelectron. 2012, 42C, 193−197. (13) Wang, C.; Yang, G.; Luo, Z.; Ding, H. Acta Biochim. Biophys. Sin. 2009, 41, 335−340. (14) Avci-Adali, M.; Paul, A.; Wilhelm, N.; Ziemer, G.; Wendel, H. P. Molecules 2010, 15, 1−11. (15) Kulbachinskiy, A. V. Biochemistry (Moscow) 2007, 72, 1505− 1518. (16) Jing, M.; Bowser, M. T. Anal. Chem. 2013, 85, 10761−10770. (17) Gopinath, S. C. Anal. Bioanal. Chem. 2007, 387, 171−182.

■

NOTE ADDED AFTER ASAP PUBLICATION This paper was originally published ASAP on October 20, 2014. Corrections were made to the manufacturers of KingFisher Duo and NanoDrop 1000, and the paper was reposted on October 22, 2014.

H


Just in Time-Selection: A Rapid Semiautomated SELEX of DNA

Recommend Documents