Article pubs.acs.org/molecularpharmaceutics
Role of the Na+/K+‑ATPase Beta-Subunit in Peptide-Mediated Transdermal Drug Delivery Changli Wang,†,‡ Renquan Ruan,§,⊥ Li Zhang,¶ Yunjiao Zhang,†,‡ Wei Zhou,†,‡ Jun Lin,†,‡ Weiping Ding,*,§,⊥ and Longping Wen*,†,‡ †
School of Life Sciences, ‡Hefei National Laboratory for Physical Sciences at Microscale, §Center for Biomedical Engineering, and Department of Electronic Science and Technology, University of Science and Technology of China, Hefei, Anhui 230027, China ¶ Department of Urology, Anhui Medical University, Hefei, Anhui 230032, China ⊥
ABSTRACT: In this work, we discovered that the Na+/K+ATPase beta-subunit (ATP1B1) on epidermal cells plays a key role in the peptide-mediated transdermal delivery of macromolecular drugs. First, using a yeast two-hybrid assay, we screened candidate proteins that have specific affinity for the short peptide TD1 (ACSSSPSKHCG) identified in our previous work. Then, we verified the specific binding of TD1 to ATP1B1 in yeast and mammalian cells by a pull-down ELISA and an immunoprecipitation assay. Finally, we confirmed that TD1 mainly interacted with the C-terminus of ATP1B1. Our results showed that the interaction between TD1 and ATP1B1 affected not only the expression and localization of ATP1B1, but also the epidermal structure. In addition, this interaction could be antagonized by the exogenous competitor ATP1B1 or be inhibited by ouabain, which results in the decreased delivery of macromolecular drugs across the skin. The discovery of a critical role of ATP1B1 in the peptide-mediated transdermal drug delivery is of great significance for the future development of new transdermal peptide enhancers. KEYWORDS: transdermal drug delivery, Na, K-ATPase beta-subunit, peptide enhancer, macromolecular drug hormone (GH),34 siRNA,35 and human epidermal growth factor (hEGF).36 To date, although the peptide has been widely applied,31 the molecular mechanism through which the peptide mediates the transdermal macromolecular delivery remains unclear. Current studies have only indicated that the peptide exhibits a high sequence specificity,33,37 opens the skin barrier transiently,33 shows a saturating dose response curve,33 and enters the skin regardless of the presence of hair follicles.35 The latest work by our group showed that the peptide directs the permeation of drugs into skin in an energy-dependent fashion.38 All evidence suggests that the TD1 peptide may open the skin barrier by specific interactions between the peptide molecules and certain components rather than just by a cationic group-directed transmembrane delivery37,39,40 or electrostatic interactions by simply changing pH.41 However, the participating skin component in the TD1 peptide interaction remains unknown. In this study, our objective is to identify the protein partner that interacts with the TD1 peptide. By means of the yeast twohybrid assay, we reveal for the first time that the peptide is associated with the C-terminus of the Na+/K+-ATPase betasubunit, which results in the temporary junction change of corneocytes and thus the temporary permeation of the skin
1. INTRODUCTION The skin is the largest organ of the human body and provides a convenient interface for systemic drug delivery.1,2 However, it only permits the penetration of small and lipophilic drugs and uniformly prevents the entry of large hydrophilic agents because the stratum corneum of the skin functions as a tough barrier to protect the underlying tissue from external insults.3−5 In past decades, a variety of chemical permeation enhancers6,7 and physical enhancement techniques8−16 have been developed to overcome the skin barrier and facilitate the permeation of macromolecular drugs across skin.17−21 However, these approaches have limited applications in systemic drug delivery because of their disadvantages.22 Generally, the stratum corneum is considered as a dead tissue. However, the stratum corneum can still possess multiple types of catalytic activity23,24 because corneocytes are active.23,25 Therefore, it is possible for certain peptides to change the structure of the stratum corneum to facilitate the transdermal delivery of macromolecular drugs. Recently, biologically inspired peptide enhancers have emerged26−29 and represent a promising approach for the transdermal delivery of not only macromolecules (up to 100 kDa),29−32 but also phages.29,33 In our previous work, we reported for the first time the discovery of an 11-amino acid peptide, TD1 (ACSSSPSKHCG) that enhanced the delivery of insulin across rat skin via coadministration.33 Since then, the peptide has been found to facilitate the transdermal delivery of many macromolecules such as botulinum neurotoxin type A (BoNT-A),31 growth © 2015 American Chemical Society
Received: Revised: Accepted: Published: 1259
November 26, 2014 February 3, 2015 March 3, 2015 March 3, 2015 DOI: 10.1021/mp500789h Mol. Pharmaceutics 2015, 12, 1259−1267
Article
Molecular Pharmaceutics
tgtggtctgcaggtgagcaagggcgaggagc), and primerLS6 (atagaattccaaatgtggtatggctgattatgatc), incorporating Nde I and EcoR I restriction sites at the 5′ and 3′ ends, respectively. The PCR product was cloned into a pGBKT7 plasmid between the Nde I and EcoR I sites using T4 DNA ligase (NEB, USA) to generate a GAL4-TD1-eGFP fusion protein containing a cMYC tag for expression in the AH109 yeast strain. The plasmids pGBKT7-TD1-eGFP and pGBKT7-TD1 were both transformed into competent AH109 yeast cells using the LiAc/ PEG method.42 Transformed AH109 cells were mated with the Y187 strain that pretransformed an adult human liver cDNA library according to the manufacturer’s instructions. Positive interacting clones were selected at high stringency by growth on SD/-Ade/-His/-Leu/-Trp with colorimetric detection by Xα-gal and subsequently screened by PCR using primers (5′ and 3′ AD sequences) corresponding to the flanking regions of the library cDNA sequences with samples of the yeast cells added directly to the PCR mixture. Then, the amplified bands corresponding to the library cDNA clones with unique Alu I restriction digest ladders were sequenced by automated DNA sequencing and analyzed by the NCBI Basic Local Alignment Search Tool for homology with known human cDNA sequences. The pACT2 series prey plasmids encoding putative TD1-interacting proteins were isolated by yeast plasmid rescue, retested for interaction, and tested for prey self-activity. 2.5. Expression and Purification of GST Fusion Protein. The construction of the plasmid for expressing GST-ATP1B1 and GST-ATP1B1c protein using the GST system has been well described.36 The E. coli strain harboring the expression plasmid was cultured at 37 °C overnight in LB medium containing 100 μg/mL of ampicillin. The cultures were diluted 1:100 in TB medium containing 0.1 mM IPTG and then incubated at 16 °C for 24 h with rigorous shaking. After the cell pellet was harvested and resuspended in PBS buffer, the soluble protein was extracted from the bacterial cells using high-pressure crashing. The cell lysate (10 mL) was incubated with 1 mL of equilibrated GST resin at 4 °C overnight. The resin was washed with PBS (5 × the incubation volume) to reduce nonspecific binding. The GST fusion proteins were eluted by 20 mM GSH/PBS buffer (pH 8.0). The protein concentration was determined with a BCA assay (Beyotime, China). 2.6. Pull-Down ELISA. The recombinant plasmid of pGEXATP1B1 or pGEX-ATP1B1c (C terminus, 159−303 aa.) was transformed into E. coli (BL21) for soluble expression with 1 mM isopropyl-β-D-galactopyranoside (IPTG) to perform the in vitro pull-down assay. Enzyme-linked immunosorbent assay (ELISA) was used to quantify the amount of protein interaction. TD1 or ATP1B1 (100 μL) was incubated on the 96-well plates with 0.05 M NaHCO3 (pH 8.9) for 12 h at 4 °C. Cell lysate was incubated with the fixed TD1 at 37 °C for 2 h. After washing properly, the polyclonal antibody of GST or ATP1B1 was diluted 1:1000 and incubated with the plate at 37 °C for 2 h. After washing, the plate was incubated with Rhodamine red-X-conjugated donkey antirabbit secondary antibody (Jackson Immunoresearch, West Grove, PA) at a dilution of 1:200 for 1 h, washed, and read under a microplate reader (ELx800, Bio-TEK Ins, USA). 2.7. Immunoprecipitation. Immunoprecipitation was used to confirm the interaction between TD1 and ATP1B1 from HaCaT cells. Cell lysate was prepared using cell lysate buffer (Beyotime, Beijing, China). After preclearing with normal host IgG and protein A/G agarose (Pierce), the lysate
barrier. The work presented here not only helps to understand and optimize transdermal drug delivery mediated by the peptide, but also provides insight into the development of new transdermal enhancers.
2. MATERIALS AND METHODS 2.1. Ethics Statement. All samples were collected in accordance with the ethical guidelines mandated by the University of Science and Technology of China as approved by the Medical Ethics Committee. The Declaration of Helsinki Principles was followed. Sprague−Dawley (SD) rats and nude mice (BALB/c-nud) were obtained from Slaccas Company, Shanghai, China. All rats were bred and housed in specific pathogen-free conditions at the Association of Laboratory Care, an approved animal facility at the School of Life Sciences. Each rat was sedated with a dose of 1 mL of 20% urethane solution before experiments. All animal procedures were approved by the Medical Ethics Committee. 2.2. Materials. The restriction enzymes, including Alu I, BamH I, BglII, EcoR I, Hind III, Nde I, Not I, PstI, Xba I, and Xho I, were purchased from Fermentas Co., China. LA/EX-Tag DNA polymerase was purchased from Takara Co., Japan. T4 DNA ligase was purchased from New England Biolabs (Beverly, MA, USA). pGEX-6P-1 was obtained from Amersham Bioscience. pEGFP-C1 and pDsRed-N1 were obtained from Clontech, USA. E. coli strains DH5α and BL21 (DE3) were purchased from Tiangen, China. The antibody of the Na+/K+-ATPase beta-subunit (ATP1B1) was purchased from Santa Cruz Biotechnology, CA, USA. Glutathione Sepharose 4B Agarose (GST purification) was purchased from Amersham Pharmacia Biotech (Piscataway, NJ, USA). Protein A/G resin was purchased from Pierce (Merck, Germany). TD1 and analogous peptides were synthesized from GL Biochemicals (Shanghai, China). The fluorescent modifications FAM-TD1 and FAM-AP1 were synthesized from GenePharma (Shanghai, China). The yeast two-hybrid system and human liver matchmaker cDNA library were purchased from Clontech, USA. All related nucleotides were synthesized and sequenced in Sangon Biological Engineering Technology and Service Co., Ltd., Shanghai, China. 2.3. Cell Culture. Human keratinocyte (HaCaT), human epithelial carcinoma (HeLa), and human epithelial lung carcinoma (A549) (Cell Bank, Shanghai, China) cell lines were cultured continuously at 37 °C and 5% CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) and 1% penicillin− streptomycin. Cell culture dishes from MatTek Co. (Ashland, MA) were coated with 100 μg/mL of fibronectin (SigmaAldrich, USA) at room temperature for 2 h. The dishes were rinsed three times with phosphate buffered saline (PBS) before use. Approximately 5000−6000 cells/well were seeded in a 96well plate. After 12 h, cells were washed with PBS before drug treatment. 2.4. Yeast Two-Hybrid Assay. Yeast two-hybrid screens were performed according to Libraries User Manual of Matchmaker GAL4 Two-Hybrid System 3 (Clontech, USA) with four reporter genes (X-α-gal, Trp, Leu, and His), followed by the yeast reporter strain AH109 containing pGAL4-BD (binding domain)-fused TD1, and Y189 strain containing pGAL4-AD (active domain)-fused the human adult liver cDNA library. The full-length nucleotides of TD1 fused with eGFP (enhanced green fluorescent protein) were amplified using PCR primers, primerLS5 (atacatatggcttgttcttcttctccatctaagcac1260
DOI: 10.1021/mp500789h Mol. Pharmaceutics 2015, 12, 1259−1267
Article
Molecular Pharmaceutics
Figure 1. Peptide exhibits specific binding to keratinocytes in epidermal layers: (A) the percentage of cells with positive signals; (B) the comparison between epidermal and dermal cells; and (C) the positive cell percentage in FACS.
was incubated with 2 μg of monoclonal anti-ATP1B1 antibody (Santa Cruz) and 30 μL of protein A/G agarose overnight at 4 °C. Control samples were incubated with normal IgG from the same host as the primary antibody. FAM-TD1 or FAM-AP1 was incubated with the fixed ATP1B1 at 4 °C overnight (AP1: ACNATLPHQCG). The precipitated proteins were washed with PBS and eluted by resuspension in 2 × SDS sample buffer at 95 °C for 8 min. Samples containing fluorescent peptides were observed on a 15% Tris-glycine polyacrylamide gel. 2.8. Immunochemistry. Cells were cultured with TD1 for 6 or 24 h and fixed with 4% paraformaldehyde for 10 min. Skin tissues were buried with 0.5 mg of TD1 on a 1 cm × 1 cm area for 6 h. The rat skin was dissected and embedded in OCT. Tissue slices (15−20 μm) were incubated with anti-ATP1B1 polyclonal antibody (1:500; Millipore) overnight at 4 °C and then washed twice with PBS. Then, the slides were incubated with Rhodamine red-X-conjugated donkey antirabbit secondary antibody (Jackson Immunoresearch) at a dilution of 1:200 for 1 h. The slides were subsequently washed and observed under an Olympus IX70 fluorescence microscope. In negative control slices, PBS was used instead of TD1. 2.9. Western Blot. Cultured cells were lysed in cell lysis buffer (Beyotime). Samples containing β-mercaptoethanol were resolved on 10−12% Tris-glycine polyacrylamide gels. The gels
were transferred to PVDF membranes (Amersham) and blocked with 5% nonfat dry milk. Membranes were incubated overnight at 4 °C with the primary antibody in the blocking buffer. The primary antibodies used here included rabbit polyclonal anti-ATP1B1 (Millipore) and mouse monoclonal anti-ATP1B1 (Santa Cruz Biotech). Following incubation with the HRP-conjugated secondary antibody for 30 min, protein bands were detected by ECL using a commercial kit (Pierce). 2.10. Isolation of Epidermis and Dermis. Nude mice (1 week old) were used as a source of epidermis. To sterilize the skin, each mouse was dipped into 75% alcohol for 5 min; then, the skin was cut from the abdomen. The skin was placed into a rinse solution of PBS containing 20 μg/mL of gentamicin for approximately 1 h. The skin was cut into several pieces and transferred into a 25-caseinolytic units/mL solution of Dispase dissolved in PBS, supplemented with gentamicin at 5 μg/mL, and incubated for 18 h at 4 °C. After incubation with the Dispase, the keratinocytes in the epidermal layer were separated from the epidermis and placed into a 60 mm Petri dish. 2.11. Flow Cytometric Analysis. Ventral skin cells from an infant rat (1 × 106) were digested by 0.25% trypsin, washed with PBS, and resuspended in 500 μL of PBS. The cells were then incubated with 20 μg of TD1-eGFP and eGFP, respectively, for 1 h. After rinsing, the samples were analyzed 1261
DOI: 10.1021/mp500789h Mol. Pharmaceutics 2015, 12, 1259−1267
Article
Molecular Pharmaceutics
Figure 2. Yeast two-hybrid assay screens for proteins that interact with TD1. (A) Plasmids of bait proteins were constructed. (B) PCR amplification and restriction digests of Alu I identified the gene fragment of interactive partners. (C) Basic Local Alignment Search Tool determined eight interaction proteins that had 75% homology with candidate preys. (D) Positive interacting clones were screened at high stringency by growth on SD/-Ade/-His/-Leu/-Trp with colorimetric detection by X-α-gal.
by flow cytometry (FACS, Becton Dickinson). The data were analyzed using the WinMDI2.9 program. 2.12. Freezing Section. The isolated skin sample was fixed in 4% paraformaldehyde at 4 °C for 12 h. PBS was used to wash the fixed sample three times. Then, the OCT agent was used to embed skin, and the skin was rapidly frozen. A histocryotome (Leica 2035, Germany) was use to obtain skin sections approximately 10-μm thick. A fluorescent microscope (Olympus, Center Valley, PA) was used to observe the samples. 2.13. In Vitro Skin Permeation. The abdominal skin of SD rats (200 ± 10 g) was used in the skin permeation studies. Each rat was sedated with a dose of 1 mL of 20% urethane solution before experiments. Then, the hair on the abdominal skin was removed with a razor, the exposed skin was excised from the rat, and the subcutaneous fat of the isolated skin was carefully removed. The rat skin was immersed in saline at room temperature and carefully inspected for any defects before the permeation experiments. Franz diffusion cells (receptor compartment, 5 mL; diffusion area, 0.5 cm2; PermeGear, USA) were used in the permeation experiments. The skin was carefully mounted on the lower half of the diffusion cell with the epidermis facing upward. The upper and lower parts of the cell were fastened together with the epidermis acting as a seal between the donor and receptor compartments. The receptor compartment was equipped with a stirring magnet, filled with saline, and maintained at 37 °C. A freshly prepared drug solution (500 μL) containing the indicated protein was added to each donor compartment. The sample (200 μL) was taken from each receptor compartment at the indicated time, and the same volume of saline was replaced. The permeated protein in the receptor compartment was determined using ELISA. 2.14. In Vivo Skin Permeation. The adult male SD rats (200 ± 10 g) were housed in a fixed 12-h light−dark cycle with free access to food and water (60% relative humidity, 22 °C). The hair on the abdomen (∼3 cm × 3 cm) was carefully trimmed with scissors (rats with any visible sign of skin damage
were not used). The rats were randomly assigned to treatment groups (six rats per group). The indicated amount of drugs in 100 μL of saline was applied to the exposed skin. Blood was drawn from the tail vein and tested for the permeated protein by a hEGF ELISA using ELISA kits (Boster, Wuhan, China; sensitivity, 0.5 pg/mL). 2.15. Permeated Protein Determination. One-hundred microliters of the sample was added to the wells of an ELISA plate coated with the hEGF antibody; the plate was incubated at 37 °C for 2 h. Then, the plate was washed with 200 μL of PBS three times and subsequently incubated with the hEGF antibody (diluted 1:200 in PBS) at 37 °C for an additional 1 h. After being washed three times, HRP-conjugated antibody was added to each well at 37 °C for 30 min. Finally, 100 μL of TMB reagent was added for sufficient color development. The reaction was stopped with a stop solution (2 M H2SO4), and the absorbance of each well was read at 450 nm.
3. RESULTS 3.1. Specific Binding of the Peptide to Keratinocytes. In our previous work, we found that the peptide TD1 could bind to skin.38 Following this discovery, we sought to confirm that the peptide was binding to skin cells and if so, to what type of skin cells. In this study, a FACS assay was performed to confirm the affinity of the peptide with mixed cells that were isolated from infant rat ventral skin. First, we expressed and purified TD1-eGFP, a fusion protein composed of TD1 and eGFP. The binding of TD1-eGFP or eGFP to cells enables the detection of the cells via fluorescence signals in the FACS assay. Then, the mixed cells were treated with 20 μg of TD1-eGFP or eGFP (control group) for 30 min. The results showed that incubation with TD1-eGFP yields 34.2% cells with absolute positive signals, whereas incubation with eGFP only yields 16.5% (Figure 1A). A peptide competition assay was also performed to verify the association between TD1 and the mixed cells. The multiple skin cell mixture was simultaneously 1262
DOI: 10.1021/mp500789h Mol. Pharmaceutics 2015, 12, 1259−1267
Article
Molecular Pharmaceutics incubated with 20 μg of TD1-eGFP and 20 μg of synthetic peptide TD1 or a nonfunctional peptide AP1. The results showed that the peptide TD1 significantly attenuated the percentage of cells marked with TD1-eGFP, whereas the scramble peptide AP1 did not (Figure 1A). Therefore, specific binding of the peptide TD1 to the skin cells was shown. We examined the affinity of the peptide with cells from different skin layers in a similar manner. Infant rat skin was divided into epidermal and dermal layers. The layers were separately digested with 0.25% trypsin. The affinities of the peptide for the epidermal and dermal cells were examined by the FACS assay (Figure 1B). The results showed that after incubation, 31.5% of the epidermal cells were GFP positive compared with only 5.4% of the dermal cells. This indicated that the peptide mainly interacted with the epidermal cells. In addition, the fluorescence signal intensities for both the epidermal and dermal cells were barely distinguishable from those of the eGFP-treated cells (Figure 1C). These results provide further insight into the mechanisms of the specific affinity of the peptide for the epidermal cells. 3.2. Yeast Two-Hybrid Assay: Screening Proteins Interacting with TD1. In the previous section, we found that the peptide mainly interacted with epidermal cells. Next, we determined the specific proteins or counter-receptors on the cells with which the peptide interacts. First, we screened candidate proteins using a yeast two-hybrid assay. Then, we selected one or two proteins according to their properties. Next, we confirmed the interaction between the peptide and the protein. Finally, we determined the interaction mechanism between the peptide and the protein. In the process of screening candidate proteins, a DNA fragment coding for TD1-eGFP was obtained by PCR amplification. The PCR fragment was inserted into the pGBKT7 vector (Figure 2A). The recombinant pGBKT7TD1-eGFP plasmid was transformed into the AH109 yeast strain to generate bait protein. Additionally, two PstI restriction enzyme sites were designed at both ends of the eGFP. Therefore, the pGBKT7-TD1 plasmid was constructed by removing the eGFP fragment (Figure 2A). After the yeast twohybrid assay, approximately 107 clones were screened from 350 clones that were identified to interact with TD1 under highstringency conditions (Figure 2D). Subsequent PCR amplifications and restriction digests of Alu I were performed (Figure 2B). The identities of the positive clones were determined by sequencing and using the Basic Local Alignment Search Tool. We identified eight interactive proteins that had 75% homology with the candidate preys (Figure 2C). These proteins included the Na+/K+-ATPase beta-subunit (ATP1B1), which is a molecular enzyme that requires energy to execute its functions. In our latest work, we found that the peptide-mediated drug delivery across skin required energy.38 Recent reports have also shown that the function of Na+/K+-ATPase is not only to construct cell tight junctions, but also to maintain the function and structure of the tight junctions.43 Additionally, the structure and function of the beta-subunit plays a role in cell−cell adhesion.44,45 Therefore, we speculated that the interaction between TD1 and ATP1B1 affected the tight junctions of skin cells. 3.3. Confirmation of the Interaction between TD1 and ATP1B1. To confirm the interaction between TD1 and ATP1B1, a reverse transcriptase PCR assay was used to obtain the full-length cDNA of ATP1B1 from a human liver library. Then, the cDNA of the ATP1B1 was cloned into a pACT2
vector as prey (Figure 3I), and the interaction between ATP1B1 and TD1 was confirmed by yeast cotransformation
Figure 3. Interaction between TD1 and ATP1B1 was confirmed in yeast and mammalian cells. (I, II) Yeast cells were cotransformed with BD-TD1 as bait and AD-ATP1B1 as prey, and cells were then selected on supplemented minimal plates lacking uracil, tryptophan, leucine, and histidine. (III) TD1 and ATP1B1 were colocalized in mammalian cells. The plasmids of TD1-eGFP and mRFP-ATP1B1 were cotransformed into HeLa cells; green and red fluorescence in the cell reflect the position of TD1 and ATP1B1.
(Figure 3II, A−F, the blue dots indicate the interaction of TD1 and ATP1B1). We also performed the bait and prey autoactivation tests for the positive clones to ensure that they dependently activated the Y2H reporter genes (Figure 3II, G,H). In the mammalian cell experiments to confirm the interaction between TD1 and ATP1B1, the plasmids of pcDNA-TD1eGFP and pcDNA-mRFP-ATP1B1 were transfected into HeLa cells to verify the colocalization of the interaction. After the plasmids were individually transfected, a fluorescent microscope was used to detect the localization of the proteins in the cells. TD1-eGFP and mRFP-ATP1B1 localized at the same positions in HeLa cells (Figure 3III). An immunoprecipitation assay, a widely used method for in vivo interaction tests, was performed to confirm the interaction (Figure 4). SDS-PAGE showed that ATP1B1 immunoprecipitated from a mixture of the peptide FAM-modified TD1 and the lysate of HaCaT cells containing an abundant amount of ATP1B1 (Lane 3). No significant interaction was observed from the FAM-modified AP1 peptide (Lane 4). Additionally, the A/G resin (Lane 1) and the resin with ATP1B1 (Lane 2) exhibited no fluorescence. 3.4. C-Terminal Motif of ATP1B1. To further study how TD1 interacted with ATP1B1, we analyzed the nucleotide sequence of ATP1B1 and found that the interacting partner encoded the C-terminus (amino acids 159−303). The Cterminus of ATP1B1 (ATP1B1c) is an extracellular motif that is rich in cysteine and galactosylated modification sites. To 1263
DOI: 10.1021/mp500789h Mol. Pharmaceutics 2015, 12, 1259−1267
Article
Molecular Pharmaceutics
the interaction between the resultant analogues and ATP1B1c. The results showed that the peptide sequence significantly affected the interaction between analogues and ATP1B1c (Figure 5D). When two terminal amino acids in TD1 (Ala and Gly) were removed, the interaction was reduced by 80%. When the middle amino acid in TD1 (Pro or His) was replaced by the electrically neutral Ala, the binding ability was reduced by 30%. Pro is a cyclic amino acid without free α-amino. The replacement of Pro by Ala affected the secondary structure of the peptide and thus the specific binding ability. Therefore, the structure and charge of the peptide were crucial for its interaction with ATP1B1c. 3.5. Biological Effect of Interaction between TD1 and ATP1B1. After identification of the molecular interaction of TD1 with the C-terminus of ATP1B1, the biological effect of this interaction was explored. HaCaT and A549 cells were treated with TD1 to study the expression of ATP1B1. The results from the Western blot assay showed that the expression level of ATP1B1 first increased and then decreased over time. This indicates that the interaction affected the expression of ATP1B1 (Figure 6A). Additionally, TD1 also affected the localization of ATP1B1 in HaCaT cells. Fluorescent images showed that ATP1B1 was originally homogeneously distributed in cells, whereas upon treatment with TD1, it accumulated near the cell membrane (Figure 6B). To study the biological effect of the interaction on the skin structure, the epidermis was separated from nude mice and then treated with TD1 for 6 h. The results showed that at 6 h, the expression of ATP1B1 was increased, and ATP1B1 was distributed around the cell membrane (Figure 6C, II,IV).
Figure 4. ATP1B1 was immunoprecipitated with FAM-TD1. Twenty micrograms of synthetic FAM-modified TD1 or 20 μg of FAMmodified AP1 (control group) mixed with endogenous ATP1B1 from HaCaT cell lysate was immunoprecipitated with mouse monoclonal antibody against ATP1B1 and detected by fluorescence imaging. The silver staining showed the resins linked with equal amounts of endogenous ATP1B1.
show that TD1 directly binds to ATP1B1c, an ELISA was performed. The results showed that TD1 had a much higher affinity than GST with GST-ATP1B1 (full-length of ATP1B1) and GST-ATP1B1c (C-terminus of ATP1B1) (Figure 5A). The C-terminus of ATP1B1 had a stronger interaction than the fulllength of ATP1B1 (Figure 5A), and the interaction was dosedependent (Figure 5B). Therefore, TD1 indeed directly is bound to ATP1B1c. As we know, the peptide sequence is very important for the peptide function. In this study, we changed the amino acid sequence of the peptide (Figure 5C) and tested
Figure 5. TD1 directly interacted with the C-terminus of ATP1B1. (A) The ELISA tested the interaction between TD1 (0.5 mg/mL) and the fulllength of ATP1B1 or the C-terminus of ATP1B1 (0.5 mg/mL). (B) The interaction was dose-dependent. (C) Sequence of TD1 analogues. (D) The interaction of TD1 or TD1 analogues (0.5 mg/mL) with ATP1B1c (0.5 mg/mL). The results are depicted as the means ± SD (n = 3, *p < 0.05, **p < 0.01). 1264
DOI: 10.1021/mp500789h Mol. Pharmaceutics 2015, 12, 1259−1267
Article
Molecular Pharmaceutics
Figure 6. Interaction between TD1 and ATP1B1 affects the (A) expression of ATP1B1, (B) the localization of ATP1B1, and (C) the skin structure. In panel B, the concentration of TD1 was 20 μg/mL. In panel C, the concentration of TD1 was 0.25 mg/mL. I and III are the control group; II and IV are the experiment group treated with TD1; and III and IV are the enlarged images.
Figure 7. Inhibitor or competitor of ATP1B1 attenuates the TD1-mediated hEGF delivery across skin. (A) For in vitro skin permeation, 50 μg of TD1-hEGF was coadministered with 500 μg of ouabain, 50 μg of GST-ATP1B1, or 50 μg of GST (control group) in the upper donor compartment (500 μL) of the Franz diffusion system for 16 h. The concentration of TD1-hEGF in the lower receptor compartment was detected with ELISA. The results are depicted as the means ± SD (n = 3). (B) For in vivo skin permeation, 50 μg of TD1-hEGF was coadministered with 500 μg of ouabain, 50 μg of GST-ATP1B1, or 50 μg of GST (control group) on the abdomen of rats for 6 h. The concentration of TD1-hEGF in the rat serum was detected with ELISA. The results are depicted as the means ± SD (n = 6).
macromolecules. In this study, we discovered that the major component was ATP1B1 on epidermal cells. First, we screened candidate proteins using a yeast two-hybrid assay. Then, we confirmed the interaction between TD1 and ATP1B1 in yeast and mammalian cells. Finally, using a pull-down ELISA, we further determined that TD1 mainly interacted with the Cterminus of ATP1B1. In the presence of TD1, because of the specific binding of TD1 to ATP1B1, cells will upregulate the level of ATP1B1 to maintain function and structure; as a result, the expression of ATP1B1 increases. However, as time goes on, some TD1 molecules may be transported into cells by endocytosis; consequently, the expression of ATP1B1 then decreases. The interaction between TD1 and ATP1B1 changes not only the expression of ATP1B1, but also the localization of ATP1B1 and then the structure of the epidermal layer. This interaction can be attenuated by inhibitors or competitors, which would result in the reduced delivery of macromolecular drugs across the skin. As we know, the Na+/K+-ATPase is a plasma membrane enzyme that is responsible for maintaining the action potential by transporting K+ and Na+ in an ATP-dependent manner.46,47 The alpha subunit of the Na+/K+-ATPase is responsible for
Because of this interaction, the epidermal structure was altered, and the intercellular space was significantly enlarged. Therefore, we can conclude that the enhanced drug delivery across the skin may result from the peptide-induced skin structure change. 3.6. Effect of ATP1B1 on the TD1-Mediated Transdermal Protein Delivery. To further confirm the role of ATP1B1, we studied in vitro and in vivo transdermal protein deliveries mediated by TD1 in the presence of the inhibitor or competitor of ATP1B1. In this study, ouabain was used as an inhibitor to specifically block the activity of ATP1B1; additionally, exogenous ATP1B1 was added as a competitor. The results showed that when ouabain was coadministered, the transdermal delivery of TD1-hEGF, a fusion protein composed of TD1 and hEGF,36 was significantly reduced (Figure 7). The addition of the exogenous competitor can also cause a decrease in the transdermal delivery of TD1-hEGF. Therefore, ATP1B1 played a key role in the peptide-directed drug delivery across the skin.
4. DISCUSSION AND CONCLUSIONS In our previous studies, the results suggested that certain skin components known to interact with TD1 played key roles in opening the skin barrier for the transdermal delivery of 1265
DOI: 10.1021/mp500789h Mol. Pharmaceutics 2015, 12, 1259−1267
Article
Molecular Pharmaceutics
(7) Swaminathan, J.; Ehrhardt, C. Liposomal delivery of proteins and peptides. Expert Opin. Drug Delivery 2012, 9 (12), 1489−1503. (8) Chen, H. B.; Zhu, H. D.; Zheng, J. N.; Mou, D. S.; Wan, J. L.; Zhang, J. Y.; Shi, T. L.; Zhao, Y. J.; Xu, H. B.; Yang, X. L. Iontophoresis-driven penetration of nanovesicles through microneedle-induced skin microchannels for enhancing transdermal delivery of insulin. J. Controlled Release 2009, 139 (1), 63−72. (9) Gratieri, T.; Kalaria, D.; Kalia, Y. N. Noninvasive iontophoretic delivery of peptides and proteins across the skin. Expert Opin. Drug Delivery 2011, 8 (5), 645−663. (10) Badkar, A. V.; Smith, A. M.; Eppstein, J. A.; Banga, A. K. Transdermal delivery of interferon alpha-2B using microporation and iontophoresis in hairless rats. Pharm. Res. 2007, 24 (7), 1389−1395. (11) Park, E. J.; Werner, J.; Smith, N. B. Ultrasound mediated transdermal insulin delivery in pigs using a lightweight transducer. Pharm. Res. 2007, 24 (7), 1396−1401. (12) Smith, N. B.; Lee, S.; Shung, K. K. Ultrasound-mediated transdermal in vivo transport of insulin with low-profile cymbal arrays. Ultrasound Med. Biol. 2003, 29 (8), 1205−1210. (13) Pattani, A.; McKay, P. F.; Garland, M. J.; Curran, R. M.; Migalska, K.; Cassidy, C. M.; Malcolm, R. K.; Shattock, R. J.; McCarthy, H. O.; Donnelly, R. F. Microneedle mediated intradermal delivery of adjuvanted recombinant HIV-1 CN54gp140 effectively primes mucosal boost inoculations. J. Controlled Release 2012, 162 (3), 529−537. (14) van der Maaden, K.; Jiskoot, W.; Bouwstra, J. Microneedle technologies for (trans)dermal drug and vaccine delivery. J. Controlled Release 2012, 161 (2), 645−655. (15) Lee, J. W.; Gadiraju, P.; Park, J. H.; Allen, M. G.; Prausnitz, M. R. Microsecond thermal ablation of skin for transdermal drug delivery. J. Controlled Release 2011, 154 (1), 58−68. (16) Andrews, S.; Lee, J. W.; Prausnitz, M. Recovery of skin barrier after stratum corneum removal by microdermabrasion. AAPS PharmSciTech 2011, 12 (4), 1393−1400. (17) Purdon, C. H.; Azzi, C. G.; Zhang, J.; Smith, E. W.; Maibach, H. I. Penetration enhancement of transdermal deliveryCurrent permutations and limitations. Crit. Rev. Ther. Drug Carrier Syst. 2004, 21 (2), 97−132. (18) Williams, A. C.; Barry, B. W. Penetration enhancers. Adv. Drug Delivery Rev. 2004, 56 (5), 603−618. (19) Lavon, I.; Kost, J. Ultrasound and transdermal drug delivery. Drug Discovery Today 2004, 9 (15), 670−676. (20) Prausnitz, M. R. Microneedles for transdermal drug delivery. Adv. Drug Delivery Rev. 2004, 56 (5), 581−587. (21) Percutaneous Penetration Enhancers; Smith, E. M., Maibach, H. I., Eds.; Taylor & Francis: Boca Raton, FL, 2006. (22) Garland, M. J.; Caffarel-Salvador, E.; Migalska, K.; Woolfson, A. D.; Donnelly, R. F. Dissolving polymeric microneedle arrays for electrically assisted transdermal drug delivery. J. Controlled Release 2012, 159 (1), 52−59. (23) Proksch, E.; Brandner, J. M.; Jensen, J. M. The skin: An indispensable barrier. Exp. Dermatol. 2008, 17 (12), 1063−1072. (24) Elias, P. M. Stratum corneum architecture, metabolic activity, and interactivity with subjacent cell layers. Exp. Dermatol. 1996, 5 (4), 191−201. (25) Elias, P. M. The skin barrier as an innate immune element. Semin. Immunopathol. 2007, 29 (1), 3−14. (26) Kim, Y. C.; Ludovice, P. J.; Prausnitz, M. R. Optimization of transdermal delivery using magainin pore-forming peptide. J. Phys. Chem. Solids 2008, 69 (5−6), 1560−1563. (27) Desai, P.; Patlolla, R. R.; Singh, M. Interaction of nanoparticles and cell-penetrating peptides with skin for transdermal drug delivery. Mol. Membr. Biol. 2010, 27 (7), 247−259. (28) Nasrollahi, S. A.; Taghibiglou, C.; Azizi, E.; Farboud, E. S. Cellpenetrating peptides as a novel transdermal drug delivery system. Chem. Biol. Drug Des. 2012, 80 (5), 639−646. (29) Hsu, T.; Mitragotri, S. Delivery of siRNA and other macromolecules into skin and cells using a peptide enhancer. Proc. Natl. Acad. Sci. U. S. A. 2011, 108 (38), 15816−15821.
catalytic functions of the enzyme, whereas the beta-subunit contains a single transmembrane domain to deliver and stabilize the alpha subunit and to regulate the transport properties of the alpha subunit.48−50 The beta-subunit of the Na+/K+-ATPase participates in the regulation of cell phenotype, cell motility, cell polarity, cell junction, and blastocyst formation.29,30,51−56 It is necessary not only to form tight junctions, but also to maintain the function and structure of tight junctions.43 The reported results in the literature also indirectly show that our findings were reasonable. The results in this work imply that the specific binding of TD1 to ATP1B1 might change the regulatory role of ATP1B1 in signaling pathways related to cell adherence or cell osmoregulation. The activations of these pathways could open existing or unknown paracellular channels for the transdermal delivery of macromolecule drugs. In addition, it is still not clear whether the interaction between the peptide and other candidate proteins contributes to the peptidemediated transdermal drug delivery. These need to be further confirmed in intensive studies. The discovery of the critical role of ATP1B1 in the peptide-mediated transdermal drug delivery is of great significance for the future development of new transdermal peptide enhancers.
■
AUTHOR INFORMATION
Corresponding Authors
*E-mail:
[email protected]. *E-mail:
[email protected] Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS We thank Xu Song for providing the human liver cDNA library. This work was supported by grants from the Chinese Ministry of Sciences 973 Program (2007CB935800, 2010CB912804), the National Natural Science Foundation of China (#30721002, #31071211, #30830036, #31170966, and #31101020), the Knowledge Innovation Program of the Chinese Academy of Sciences (KSCX2-YW-R-139), the Fundamental Research Funds for the Central Universities (WK2070000008, WK2100000001), the Scientific and Technological Major Special Project (2009ZX09103-650), the Specialized Research Fund for the Doctoral Program of Higher Education of China (WJ2100230004), and the Natural Science Foundation of Anhui Province (BJ2100230008).
■
REFERENCES
(1) Prausnitz, M. R.; Mitragotri, S.; Langer, R. Current status and future potential of transdermal drug delivery. Nat. Rev. Drug Discovery 2004, 3 (2), 115−124. (2) Thomas, B. J.; Finnin, B. C. The transdermal revolution. Drug Discovery Today 2004, 9 (16), 697−703. (3) Kalluri, H.; Banga, A. K. Transdermal delivery of proteins. AAPS PharmSciTech 2011, 12 (1), 431−441. (4) Brown, M. B.; Martin, G. P.; Jones, S. A.; Akomeah, F. K. Dermal and transdermal drug delivery systems: Current and future prospects. Drug Delivery 2006, 13 (3), 175−187. (5) Sugino, M.; Todo, H.; Sugibayashi, K. Skin permeation and transdermal delivery systems of drugs: History to overcome barrier function in the stratum corneum. Yakugaku Zasshi 2009, 129 (12), 1453−1458. (6) Chen, Y.; Wang, M. L.; Fang, L. Biomaterials as novel penetration enhancers for transdermal and dermal drug delivery systems. Drug Delivery 2013, 20 (5), 199−209. 1266
DOI: 10.1021/mp500789h Mol. Pharmaceutics 2015, 12, 1259−1267
Article
Molecular Pharmaceutics (30) Chen, M.; Zakrewsky, M.; Gupta, V.; Anselmo, A. C.; Slee, D. H.; Muraski, J. A.; Mitragotri, S. Topical delivery of siRNA into skin using SPACE-peptide carriers. J. Controlled Release 2014, 179, 33−41. (31) Carmichael, N. M.; Dostrovsky, J. O.; Charlton, M. P. Peptidemediated transdermal delivery of botulinum neurotoxin type A reduces neurogenic inflammation in the skin. Pain 2010, 149 (2), 316−324. (32) Jain, A.; Gulbake, A.; Shilpi, S.; Hurkat, P.; Jain, S. K. Peptide and protein delivery using new drug delivery systems. Crit. Rev. Ther. Drug Carrier Syst. 2013, 30 (4), 293−329. (33) Chen, Y.; Shen, Y.; Guo, X.; Zhang, C.; Yang, W.; Ma, M.; Liu, S.; Zhang, M.; Wen, L. P. Transdermal protein delivery by a coadministered peptide identified via phage display. Nat. Biotechnol. 2006, 24 (4), 455−460. (34) Zhang, T.; Qu, H.; Li, X.; Zhao, B.; Zhou, J.; Li, Q.; Sun, M. Transmembrane delivery and biological effect of human growth hormone via a phage displayed peptide in vivo and in vitro. J. Pharm. Sci. 2010, 99 (12), 4880−4891. (35) Lin, C. M.; Huang, K.; Zeng, Y.; Chen, X. C.; Wang, S.; Li, Y. A simple, noninvasive, and efficient method for transdermal delivery of siRNA. Arch. Dermatol. Res. 2012, 304 (2), 139−144. (36) Ruan, R. Q.; Wang, S. S.; Wang, C. L.; Zhang, L.; Zhang, Y. J.; Zhou, W.; Ding, W. P.; Jin, P. P.; Wei, P. F.; Man, N.; Wen, L. P. Transdermal delivery of human epidermal growth factor facilitated by a peptide chaperon. Eur. J. Med. Chem. 2013, 62, 405−409. (37) Chang, M.; Li, X.; Sun, Y.; Cheng, F.; Wang, Q.; Xie, X.; Zhao, W.; Tian, X. Effect of cationic cyclopeptides on transdermal and transmembrane delivery of insulin. Mol. Pharmaceutics 2013, 10 (3), 951−957. (38) Ruan, R. Q.; Jin, P. P.; Zhang, L.; Wang, C. L.; Chen, C. J.; Ding, W. P.; Wen, L. P. Peptide-chaperone-directed transdermal protein delivery requires energy. Mol. Pharmaceutics 2014, 11 (11), 4015−4022. (39) Ohtake, K.; Natsume, H.; Ueda, H.; Morimoto, Y. Analysis of transient and reversible effects of poly-L-arginine on the in vivo nasal absorption of FITC-dextran in rats. J. Controlled Release 2003, 88 (3), 445−447. (40) Beerens, A. M.; Al Hadithy, A. F.; Rots, M. G.; Haisma, H. J. Protein transduction domains and their utility in gene therapy. Curr. Gene Ther. 2003, 3 (5), 486−494. (41) Kim, Y. C.; Late, S.; Banga, A. K.; Ludovice, P. J.; Prausnitz, M. R. Biochemical enhancement of transdermal delivery with magainin peptide: Modification of electrostatic interactions by changing pH. Int. J. Pharm. 2008, 362 (1−2), 20−28. (42) Miklenic, M.; Stafa, A.; Bajic, A.; Zunar, B.; Lisnic, B.; Svetec, I. K. Genetic transformation of the yeast Dekkera/Brettanomyces bruxellensis with non-homologous DNA. J. Microbiol. Biotechnol. 2013, 23 (5), 674−680. (43) Rajasekaran, S. A.; Rajasekaran, A. K. Na,K-ATPase and epithelial tight junctions. Front. Biosci., Landmark Ed. 2009, 14, 2130− 2148. (44) Barwe, S. P.; Kim, S.; Rajasekaran, S. A.; Bowie, J. U.; Rajasekaran, A. K. Janus model of the Na,K-ATPase beta-subunit transmembrane domain: Distinct faces mediate alpha/beta assembly and beta−beta homo-oligomerization. J. Mol. Biol. 2007, 365 (3), 706−714. (45) Ivanov, A. V.; Modyanov, N. N.; Askari, A. Role of the selfassociation of beta subunits in the oligomeric structure of Na+/K+ATPase. Biochem. J. 2002, 364 (Pt 1), 293−299. (46) Fambrough, D. M.; Wolitzky, B. A.; Tamkun, M. M.; Takeyasu, K. Regulation of the sodium pump in excitable cells. Kidney Int. Suppl. 1987, 23, 97−116. (47) Jorgensen, P. L. Structure, function, and regulation of Na,KATPase in the kidney. Kidney Int. 1986, 29 (1), 10−20. (48) Mercer, R. W. Structure of the Na,K-ATPase. Int. Rev. Cytol. 1993, 137C, 139−168. (49) Mercer, R. W.; Biemesderfer, D.; Bliss, D. P., Jr.; Collins, J. H.; Forbush, B., 3rd. Molecular cloning and immunological characterization of the gamma polypeptide, a small protein associated with the Na,K-ATPase. J. Cell Biol. 1993, 121 (3), 579−586.
(50) Mercer, R. W.; Schneider, J. W.; Savitz, A.; Emanuel, J.; Benz, E. J., Jr.; Levenson, R. Rat-brain Na,K-ATPase beta-chain gene: Primary structure, tissue-specific expression, and amplification in ouabainresistant HeLa C+ cells. Mol. Cell. Biol. 1986, 6 (11), 3884−3890. (51) Eckert, J. J.; Fleming, T. P. Tight junction biogenesis during early development. Biochim. Biophys. Acta 2008, 1778 (3), 717−728. (52) Geering, K. Functional roles of Na,K-ATPase subunits. Curr. Opin. Nephrol. Hypertens. 2008, 17 (5), 526−532. (53) Madan, P.; Rose, K.; Watson, A. J. Na/K-ATPase beta1 subunit expression is required for blastocyst formation and normal assembly of trophectoderm tight junction-associated proteins. J. Biol. Chem. 2007, 282 (16), 12127−12134. (54) Moriwaki, K.; Tsukita, S.; Furuse, M. Tight junctions containing claudin 4 and 6 are essential for blastocyst formation in preimplantation mouse embryos. Dev. Biol. 2007, 312 (2), 509−22. (55) Violette, M. I.; Madan, P.; Watson, A. J. Na+/K+ -ATPase regulates tight junction formation and function during mouse preimplantation development. Dev. Biol. 2006, 289 (2), 406−419. (56) Zamofing, D.; Rossier, B. C.; Geering, K. Role of the Na,KATPase beta-subunit in the cellular accumulation and maturation of the enzyme as assessed by glycosylation inhibitors. J. Membr. Biol. 1988, 104 (1), 69−79.
1267
DOI: 10.1021/mp500789h Mol. Pharmaceutics 2015, 12, 1259−1267
