Note pubs.acs.org/jnp
Kohamamides A, B, and C, Cyclic Depsipeptides from an Okeania sp. Marine Cyanobacterium Arihiro Iwasaki,† Ikuma Shiota,† Shimpei Sumimoto,† Teruhiko Matsubara,‡ Toshinori Sato,‡ and Kiyotake Suenaga*,† †
Department of Chemistry and ‡Department of Biosciences and Informatics, Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama, Kanagawa 223-8522, Japan S Supporting Information *
ABSTRACT: Kohamamides A, B, and C (1−3), new cyclic depsipeptides that belong to the kulolide superfamily, were isolated from an Okeania sp. marine cyanobacterium. Their structures were elucidated by spectroscopic analyses and degradation reactions. Kohamamide B (2) exhibited moderate cytotoxicity against HL60 cells. Although many natural products in the kulolide superfamily have been isolated from cyanobacteria collected in various parts of the world, kohamamides 1−3 are the first members to be isolated from the East Asian marine environment. In addition, unlike other members of this superfamily, kohamamides 1−3 contain a Leu residue adjacent to the Pro residue, rather than another lipophilic amino acid.
M
structure determination, and biological activities of kohamamides 1−3.
arine organisms produce a variety of secondary metabolites with interesting structures, and numerous marine natural products have been reported to date.1 Some of these compounds are structurally similar to each other and therefore form a superfamily. For example, more than 10 dolastatin 132 analogues, such as lyngbyastatins 4−10,3 molassamide,4 and kurahamide,5 have been discovered so far; they possess a common ring structure and exhibit potent serine protease-inhibitory activity.6 In 1996, Scheuer et al. discovered the cyclic depsipeptide kulolide in the marine mollusk Philinopsis speciosa.7 Since this first report, several compounds with a related structure have been reported, and, in 2012, Gerwick et al. designated these compounds as the kulolide superfamily.8 According to their report, the kulolide superfamily is characterized by the presence of a β-hydroxy octanoic acid derivative along with a well-defined sequence of amino acid or hydroxy acid residues in a cyclic structure.8 Additionally, the superfamily is subdivided into two groups: one possessing a 2,2dimethyl-3-hydroxy-7-octynoic acid (Dhoya) derivative and the other containing a 3-hydroxy-2-methyl-7-octynoic acid (Hmoya) derivative. Although the original compound, kulolide, was isolated from an invertebrate, most of the other members were discovered in filamentous cyanobacteria, indicating that the biosynthetic origin of the members of the superfamily is likely marine cyanobacteria.8 In our continuing search for new bioactive substances from marine cyanobacteria,9 we investigated the constituents of an Okeania sp. marine cyanobacterium collected at Okinawa, Japan, and discovered three new cyclic depsipeptides belonging to the kulolide superfamily, kohamamides A, B, and C (1−3). Here, we report the isolation, © 2017 American Chemical Society and American Society of Pharmacognosy
An Okeania sp. marine cyanobacterium (4800 g, wet weight) was collected at Kohama Island, Okinawa, Japan, and extracted with MeOH. The extract was filtered, concentrated, and partitioned between EtOAc and H2O. The EtOAc-soluble material was further partitioned between 90% aqueous MeOH and hexane to give an aqueous MeOH portion. This portion was subjected to fractionation with reversed-phase column chromatography (ODS silica gel, MeOH−H2O) and repeated reversed-phase HPLC to give kohamamides A (1, 33.4 mg), B (2, 14.9 mg), and C (3, 6.8 mg). Kohamamide A (1) was obtained as a colorless oil. In CDCl3, 1 existed as a 1:1 mixture of rotamers. The NMR data for 1 are summarized in Table 1. The molecular formula of 1 was found to be C41H67N5O9 by high-resolution electrospray ionization Received: March 23, 2017 Published: May 25, 2017 1948
DOI: 10.1021/acs.jnatprod.7b00256 J. Nat. Prod. 2017, 80, 1948−1952
Journal of Natural Products
Note
Table 1. NMR Data for Kohamamide A (1) in CDCl3 data Aa position Dhoya 1 2 3 4a 4b 5 6 7 8 9 10 Val 1 2 3 4 5 NH N-Me-Val 1 2 3 4 5 6 Hmpa 1 2 3 4a 4b 5 6 Pro 1 2 3a 3b 4 5a 5b Leu 1 2 3a 3b 4 5 6 NH Ala 1 2 3 NH
δC, type b
175.4, C 46.29, C 79.5, CH 20.6, CH2 24.7, CH2 18.0,d CH2 83.5,e C 69.38,f CH 16.9, CH3 24.9, CH3 171.7, C 53.3, CH 30.26, CH 21.50, CH3 15.9, CH3
169.6, C 64.8, CH 30.25, CH 19.7, CH3 21.1, CH3 30.4, CH3 174.1, 78.5, 37.3, 23.8,
C CH CH CH2
11.7, CH3 15.4, CH3 170.4, C 61.2, CH 31.1, CH2 21.8, CH2 46.32, CH2
168.7, C 55.3, CH 39.4, CH2 21.4, CH 25.5, CH3 23.07, CH3
171.4, C 48.4, CH 16.9, CH3
data Ba δH (J in Hz) c
5.14, 1.74, 1.56, 1.38, 2.20,
dd (11.2, 2.0) m m m m
1.97,g t (2.5) 1.23, s 1.16, s
4.90, 2.05, 0.96, 0.79, 6.03,
dd (9.1, 2.2) m d (6.3) d (6.7) d (9.1)
4.38, 2.30, 1.43, 1.01, 3.01,
d (10.3) m d (6.5) d (6.5) s
5.07, 1.86, 1.68, 1.58, 0.88, 1.14,
d (4.7) m m m t (7.4) d (7.2)
4.58, 2.63, 1.88, 1.73, 3.65, 3.48,
d (7.4) m m m m m
4.25, m 1.83, m 1.71, m 1.68, m 0.89,h d (6.8) 0.94,i d (6.7) 8.12, d (7.0)
4.63, dq (7.6, 7.0) 1.57, d (7.0) 6.55, d (7.6)
δC, type b
175.3, 45.6, 77.4, 27.3,
C C CH CH2
24.4, CH2 18.2,d CH2 83.6,e C 69.36,f CH 19.7, CH3 23.12, CH3 172.58, C 53.4, CH 32.5, CH 20.4, CH3 17.5, CH3
172.1, C 69.9, CH 27.6, CH 21.45, CH3 19.2, CH3 40.1, CH3 172.1, 77.7, 36.9, 25.4,
C CH CH CH2
11.7, CH3 14.5, CH3 170.3, C 61.0, CH 31.4, CH2 21.7, CH2 46.6, CH2
171.6, C 54.5, CH 40.4, CH2 25.2, CH 29.2, CH3 23.13, CH3
172.2, C 47.9, CH 18.3, CH3
δHc (J in Hz)
4.97, 1.80, 1.59, 1.38, 2.20,
dd (9.9, 2.9) m m m m
1.96,g t (2.5) 1.30, s 1.17, s
4.73, 1.98, 0.94, 0.86, 6.25,
dd (8.4, 6.3) m m m d (8.4)
3.17, 2.50, 1.06, 0.85, 3.27,
d (9.4) m d (6.5) d (7.4) s
4.92, 1.81, 1.68, 1.60, 1.17, 0.92,
d (7.9) m m m t (7.2) d (7.0)
4.49, 2.57, 1.98, 1.70, 3.62, 3.55,
d (7.4) m m m m m
4.23, m 1.71, m 1.57, m 1.83, m 0.88,h d (7.8) 0.95,i d (6.7) 7.18, d (7.0)
4.39, dq (6.7, 7.1) 1.28, d (7.1) 6.76, d (6.7)
a
Kohamamide A (1) was observed as a 1:1 mixture of rotamers. Therefore, the signals of each unit due to rotamers are shown. bMeasured at 100 MHz. cMeasured at 400 MHz. d−iThese signals are interchangeable. 1949
DOI: 10.1021/acs.jnatprod.7b00256 J. Nat. Prod. 2017, 80, 1948−1952
Journal of Natural Products
Note
mass spectroscopy (HRESIMS). The 1H and 13C NMR data suggested that 1 was a peptidic compound, with several deshielded methine protons (δH 4.1−5.2) and carbonyl carbons (δC 165−175). In addition, two pairs of deshielded carbons (δC 83.6, 83.5, 69.38, and 69.36) and one pair of methine protons with a small coupling constant, δH 1.97 (t, J = 2.5) and 1.96 (t, J = 2.5), suggested the presence of a terminal alkyne. Further analyses of COSY, HMBC, HMQC, and DEPT data revealed that 1 was composed of Dhoya, 2-hydroxy-3-methylpentanoic acid (Hmpa), and five amino acid residues, including alanine, leucine, proline, valine, and N-Me-valine. If we consider the difference between the molecular formula and the summation of these partial structures, 1 must be cyclic. In addition, based on the HMBC correlations, H-2 (Val)/C-1 (Dhoya), NH (Val)/C-1 (Dhoya), H-2 (Leu)/C-1 (Pro), and NH (Leu)/C-1 (Pro), two partial sequences were clarified: Dhoya-Val and LeuPro (Figure 1). However, it was difficult to determine the
structures in 2 and 3 were consistent with that of 1 and carried out derivatization reactions as follows. Catalytic hydrogenation of 1 and 2 gave a common reduced product possessing a saturated fatty acid moiety derived from 2,2-dimethyl-3hydroxyoctanoic acid (Dhoaa), and its spectroscopic data, including the specific rotation, matched those of kohamamide C (3) (Figure S25). In addition, the MS/MS fragmentation patterns of hydrogenated 1 and 2 were consistent with that of 3 (Figures S26−S30). Therefore, the gross structures of kohamamides B (2) and C (3) were determined. In addition, we also clarified that the relative configurations of kohamamides A, B, and C (1−3) were consistent with each other. The absolute configurations of the amino acid and Hmpa moieties in kohamamides 1−3 were determined by acid hydrolysis of 1 followed by a combination of chiral-phase HPLC analyses. The results clarified that the absolute configurations of Hmpa and all of the amino acid moieties in 1 were the L-form, indicating that every amino acid moiety in 1−3 was the L-form. Meanwhile, we elucidated the absolute configuration of the C-3 position in the fatty acid as follows. Acid hydrolysis of 3 followed by HPLC purification gave Dhoaa, the specific rotation of which was consistent with that of (S)-Dhoaa.10 Therefore, the C-3 positon of the fatty acid moiety in 3 was determined to be S. Because the relative configurations of kohamamides A, B, and C (1−3) matched with each other as described above, we concluded that the absolute configuration of the C-3 position in the fatty acid moiety in 1 and 2 was the same as for 3. To evaluate the growth-inhibitory activities of kohamamides 1−3 against human cancer cells, MTT assays were performed with HeLa and HL60 cells. The cells were placed in 96-well plates and treated with various concentrations of the compounds for 72 h. The data from these assays revealed that only kohamamide B (2) showed growth-inhibitory activity against HL60 cells, but was inactive against HeLa cells (Table 2).
Figure 1. Gross structure of kohamamide A (1).
remaining sequence solely on the basis of NMR data due to the significant overlap of NMR signals. Therefore, we carried out a fragmentation study of 1 by ESI-ion trap MS (ESI-ITMS). The complete sequence of kohamamide A (1) (m/z 796.5 [M + Na]+) was identified as cyclo-[Dhoya-Ala-Leu-Pro-Hmpa-NMe-Val-Val] based on five fragments with m/z 725.4 [M + Na]+, m/z 612.4 [M + Na]+, m/z 515.3 [M + Na]+, m/z 401.2 [M + Na]+, and m/z 288.1 [M + Na]+ from MS2 and MS3 spectra (Figures 1, S8, and S9). The molecular formulas of kohamamide B (2) and C (3) were found to be C41H69N5O9 and C41H71N5O9, respectively, by HRESIMS, indicating that 2 and 3 had one and two fewer degrees of unsaturation, respectively, than 1. Kohamamides B (2) and C (3) also existed as 1:1 mixtures of rotamers in CDCl3 (Tables S2 and S3). The 1H and 13C NMR features of 2 and 3 were similar to those of 1. However, the signals assigned to the terminal alkyne disappeared, and new signals corresponding to a terminal alkene (δH 5.01, 4.97 and δC 138.2, 115.5) and an aliphatic methyl (δH 0.95 and δC 11.6) were observed for 2 and 3, respectively. Detailed analyses of the spectroscopic data revealed that 2 and 3 had the same partial structure as 1 except for the degree of unsaturation of the Dhoya moiety. However, due to the complexity of the HMBC data, we could not elucidate the gross structures of 2 and 3 based solely on the NMR data. Therefore, we carried out fragmentation studies of 2 and 3 by ESI-ITMS, and the results clarified that the fragmentation patterns of 2 and 3 were similar to that of 1 (Figures S15, S16, S22−S24). On the basis of these results, we hypothesized that the sequences of the partial
Table 2. Cell Growth-Inhibitory Activities of Kohamamides 1−3 IC50 values (μM) sample
HeLa cells
HL60 cells
kohamamide A (1) kohamamide B (2) kohamamide C (3)
29 ± 3 23 ± 2 18 ± 3
19 ± 3 6.0 ± 2.1 11 ± 5
In conclusion, kohamamides A, B, and C (1−3), new cyclic depsipeptides in the kulolide superfamily, were isolated from an Okeania sp. marine cyanobacterium collected at Okinawa, Japan. Kohamamides 1−3 differ from the other members of the superfamily with regard to the presence of a Leu residue attached to the carbonyl of the Pro residue. Their structures were elucidated by spectroscopic analyses, degradation reactions, and chemical interconversions. Kohamamide B (2) exhibited moderate cytotoxicity against HL60 cells. As we described in the introduction, a variety of compounds belonging to the kulolide superfamily have been discovered to date. They have been isolated from cyanobacteria collected in various parts of the world, such as Hawaii,7,11 Thailand,12 Madagascar,13 and Puerto Rico.8 Kohamamides 1−3 are the first members of this superfamily to be found in the East Asian marine environment. 1950
DOI: 10.1021/acs.jnatprod.7b00256 J. Nat. Prod. 2017, 80, 1948−1952
Journal of Natural Products
■
Note
cm−1; 1H NMR, 13C NMR, COSY, and HMBC data, Table S3; HRMS (ESI-TOF) m/z 778.5331 [M + H]+ (calcd for C41H71N5O9, 778.5330). Hydrogenation of Kohamamide A (1). To a mixture of kohamamide A (1, 9.1 mg, 11 μmol) in MeOH (2 mL) at room temperature (rt) was added Pd/C (0.3 mg). After the reaction mixture was stirred under a H2 atmosphere for 6 h, the catalyst was removed by filtration and the filtrate was concentrated in vacuo to give kohamamide C (3, 8.3 mg, 11 μmol, 91%) as a colorless oil: 1H NMR and 13C NMR, Table S3; HRMS (ESI-TOF) m/z 778.5330 [M + H]+ (calcd for C41H71N5O9, 778.5330); IR (neat) 3402, 2934, 2874, 1734, 1653, 1507, 1308, 1209, 1160, 1031, 753 cm−1; [α]30D −46 (c 0.05, MeOH). Hydrogenation of Kohamamide B (2). To a mixture of kohamamide B (2, 0.9 mg, 1.2 μmol) in MeOH (2 mL) at rt was added Pd/C (0.2 mg). After the reaction mixture was stirred under a H2 atmosphere for 4 h, the catalyst was removed by filtration and the filtrate was concentrated in vacuo to give kohamamide C (3, 1.0 mg, 1.3 μmol, quant.) as a colorless oil: 1H NMR and 13C NMR, Table S3; HRMS (ESI-TOF) m/z 778.5330 [M + H]+ (calcd for C41H71N5O9, 778.5330); IR (neat) 3405, 2961, 2875, 1734, 1653, 1507, 1308, 1209, 1161, 1031, 755 cm−1; [α]22D −24 (c 0.05, MeOH). Determination of the Configuration of Kohamamide A (1). Kohamamide A (1, 0.8 mg) was treated with 9 M HCl (200 μL) for 24 h at 110 °C. The mixture was evaporated to dryness and separated into its respective components by HPLC. The retention times of the components were as follows: Ala (tR = 2.8 min), Pro (tR = 3.2 min), Val (tR = 3.5 min), N-Me-Val (tR = 3.7 min), Leu (tR = 4.8 min) [Cosmosil 5C18-PAQ (ϕ 4.6 mm × 250 mm); solvent H2O; flow rate 1 mL/min; detection UV 215 nm] and Hmpa (isoleucic acid) (tR = 12.0 min) [Develosil ODS-HG-5 (ϕ 4.6 mm × 250 mm); solvent 15% MeCN, 0.1% TFA; flow rate 1 mL/min; detection UV 215 nm]. Each fraction was dissolved in H2O (50 μL) and analyzed by chiral-phase HPLC, and the retention times were compared to those of authentic standards [column, DAICEL CHIRALPAK MA(+) (ϕ 4.6 × 50 mm); flow rate, 1.0 mL/min; detection at 254 nm; solvent, several conditions]. With 2 mM CuSO4 as a solvent, the retention times for authentic standards were 3.3 min (D-Pro), 6.3 min (L-Pro), 1.6 min (DAla), 2.0 min (L-Ala), 3.9 min (D-Val), 7.3 min (L-Val), 4.1 min (NMe-D-Val), 6.6 min (N-Me-L-Val), 10.0 min (D-Leu), and 18.8 min (LLeu). The retention times of the amino acids in the hydrolysate were 6.3, 2.0, 7.3, 6.6, and 18.8 min, indicating the presence of L-Pro, L-Ala, L-Val, N-Me-L-Val, and L-Leu in the hydrolysate. With 15% MeCN, 85% 2 mM CuSO4 as a solvent, the retention times for authentic standards were 14.7 min (D-allo-isoleucic acid), 16.7 min (D-isoleucic acid), 22.1 min (L-allo-isoleucic acid), and 26.0 min (L-isoleucic acid). The retention time of isoleucic acid (Hmpa) in the hydrolysate was 26.0 min, indicating the presence of L-isoleucic acid in the hydrolysate. Preparation of 2,2-Dimethyl-3-hydroxyoctanoic Acid from Kohamamide C (4). Kohamamide C (3, 8.3 mg, 11 μmol) was treated with 6 M HCl for 24 h at 110 °C. The mixture was evaporated to dryness and partitioned between EtOAc (10 mL × 4) and 1 M HCl (10 mL). The organic extract was separated by HPLC [Cosmosil 5C18-MS-II (ϕ 20 mm × 250 mm; solvent 70% MeOH, 0.1% TFA; flow rate 5 mL/min; detection UV 215 nm] to give (S)-2,2-dimethyl3-hydroxyoctanoic acid (4, 0.4 mg, 2.1 μmol, 19%, tR = 27.0 min): 1H NMR (CDCl3, 400 MHz) δ 3.63 (m, 1H), 1.57 (m, 1H), 1.50 (m, 1H), 1.27−1.37 (m, 6H), 1.24 (s, 3H), 1.18 (s, 3H), 0.89 (t, J = 6.4 Hz, 3H); HRESIMS m/z [M − H]− 187.1334 (calcd for C10H19O3 187.1334); [α]24D −24 (c 0.03, MeOH). Cell Growth-Inhibitory Assay. HeLa cells were cultured at 37 °C with 5% CO2 in DMEM (Nissui) supplemented with 10% heatinactivated fetal bovine serum (FBS), 100 units/mL penicillin, 100 μg/ mL streptomycin, 0.25 μg/mL amphotericin, 300 μg/mL L-glutamine, and 2.25 mg/mL NaHCO3. HL60 cells were cultured at 37 °C with 5% CO2 in RPMI (Nissui) supplemented with 10% heat-inactivated FBS, 100 units/mL penicillin, 100 μg/mL streptomycin, 0.25 μg/mL amphotericin, 300 μg/mL L-glutamine, and 2.25 mg/mL NaHCO3. HeLa cells were seeded at 4 × 103 cells/well in 96-well plates (Iwaki) and cultured overnight. HL60 cells were seeded at 2 × 104 cells/well in
EXPERIMENTAL SECTION
General Experimental Procedures. Optical rotations were measured with a JASCO DIP-1000 polarimeter. IR spectra were recorded on a JASCO FT/IR-4200 instrument. All NMR data were recorded on a JEOL JNM-ECX400 spectrometer for 1H (400 MHz) and 13C (100 MHz). 1H NMR chemical shifts (referenced to residual CHCl3 observed at δH 7.26) were assigned using a combination of data from COSY and HMQC experiments. Similarly, 13C NMR chemical shifts (referenced to CHCl3 observed at δC 77.16) were assigned based on HMBC and HMQC experiments. HRESIMS spectra were obtained on an LCT Premier XE time-of-flight (TOF) mass spectrometer (LCT Premier XE, Waters). ESI-ITMS spectra were recorded with an amaZone SL mass spectrometer (Bruker Daltonics). Chromatographic analyses were performed using an HPLC system consisting of a pump (model PU-2080, JASCO) and a UV detector (model UV-2075, JASCO). All chemicals and solvents used in this study were the best grade available (special grade) from a commercial source. Identification of the Marine Cyanobacterium. A cyanobacterial filament was isolated under a microscope and crushed with a glass rod. The 16S rRNA genes were PCR-amplified from isolated DNA using primer CYA106F (cyanobacterial-specific) and CYA781R (cyanobacterial-specific). The PCR reaction contained DNA derived from a filament of cyanobacteria, 0.125 μL of KOD-Multi & Epi (TOYOBO), and 1.0 μL of each primer (10 pmol/μL), CYA106F (CGGACGGGTGAGTAACGCGTGA) and CYA781R (GACTACAGGGGTATCTAATCCCTTT). The PCR reaction was performed as follows: initial denaturation for 10 min at 94 °C, amplification by 40 cycles of 10 s at 98 °C, 10 s at 60 °C, and 1 min at 68 °C, and final elongation for 7 min at 68 °C. PCR products were analyzed on agarose gel (1%) in TBE buffer, visualized with ethidium bromide staining, and purified with a PCR Advanced PCR clean up system (VIOGENE). Sequences (accession no. LC223611) were determined with CYA106F and CYA781R primers by a commercial firm (Macrogen Japan Corp). A voucher specimen of this sample, 1603-6, has been deposited at Keio University. Collection, Extraction, and Isolation. The cyanobacterium Okeania sp. (sample 1603-6) was collected at Kohama Island, Okinawa Prefecture, Japan, at a depth of 0−1 m in March 2016. The collected cyanobacterium (4800 g, wet weight) was extracted with MeOH (5 L) for one month. The extract was filtered and concentrated. The residue was partitioned between EtOAc (3 × 300 mL) and H2O (300 mL). The material obtained from the organic layer was partitioned between 90% aqueous MeOH (300 mL) and hexane (3 × 300 mL) to give an aqueous MeOH fraction (2.66 g). An aliquot (0.9 g) of this fraction was separated by column chromatography on ODS gel (Cosmosil 75C18-OPN 9.0 g) eluting with 40% aqueous MeOH, 60% aqueous MeOH, 80% aqueous MeOH, MeOH, and CHCl3−MeOH (1:1). The fraction that eluted with 80% MeOH weighed 359 mg, and a portion of this fraction (100 mg) was subjected to HPLC [conditions for HPLC separation, Cosmosil 5C18-MS-II (ϕ 20 mm × 250 mm); solvent 85% MeOH; flow rate 5 mL/min; detection UV 215 nm] in four batches to give kohamamide B (2, 14.9 mg, tR = 35.2 min), kohamamide C (3, 6.8 mg, tR = 43.7 min), and a fraction containing kohamamide A (39.1 mg, 24.7 min). The fraction containing kohamamide A was further separated by HPLC [Cosmosil 5PE-MS (ϕ 20 mm × 250 mm); solvent 90% MeOH; flow rate 5 mL/ min; detection UV 215 nm] in two batches to give kohamamide A (1, 33.4 mg, tR = 20.3 min). Kohamamide A (1): colorless oil; [α]22D −50 (c 0.30, MeOH); IR (neat) νmax 3404, 2963, 2875, 2116, 1734, 1653, 1506, 1308, 1208, 1034, 754 cm−1; 1H NMR, 13C NMR, COSY, and HMBC data, Tables 1 and S1; HRMS (ESI-TOF) m/z 774.5013 [M + H]+ (calcd for C41H67N5O9, 774.5017). Kohamamide B (2): colorless oil; [α]22D −44 (c 0.15, MeOH); IR (neat) νmax 3402, 2963, 2875, 1734, 1653, 1506, 1457, 1020, 754 cm−1; 1 H NMR, 13C NMR, COSY, and HMBC data, Table S2; HRMS (ESITOF) m/z 776.5173 [M + H]+ (calcd for C41H69N5O9, 776.5174). Kohamamide C (3): colorless oil; [α]22D −41 (c 0.33, MeOH); IR (neat) νmax 3403, 2961, 2875, 1734, 1653, 1507, 1209, 1162, 1017, 755 1951
DOI: 10.1021/acs.jnatprod.7b00256 J. Nat. Prod. 2017, 80, 1948−1952
Journal of Natural Products
Note
96-well plates. Various concentrations of compounds were then added, and cells were incubated for 72 h. Cell proliferation was measured by the MTT assay.
■
ASSOCIATED CONTENT
* Supporting Information S
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jnatprod.7b00256. NMR spectra for kohamamides 1−3 and the derivative 4; HPLC chromatograms for determination of the absolute configurations; MS2 and MS3 spectra of 1; a phylogenetic tree for taxonomic analysis (PDF)
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. ORCID
Arihiro Iwasaki: 0000-0002-3775-5066 Teruhiko Matsubara: 0000-0002-8006-4324 Toshinori Sato: 0000-0002-4429-6101 Kiyotake Suenaga: 0000-0001-5343-5890 Notes
The authors declare no competing financial interest.
■ ■
ACKNOWLEDGMENTS This work was supported by JSPS KAKENHI Grant Number 16K13091 REFERENCES
(1) Blunt, J. W.; Copp, B. R.; Keyzers, R. A.; Munro, M. H. G.; Prinsep, M. R. Nat. Prod. Rep. 2016, 33, 382−431. (2) Pettit, G. R.; Kamano, Y.; Herald, C. L.; Dufresne, C.; Cerny, R. L.; Herald, D. L.; Schmidt, J. M.; Kizu, H. J. Am. Chem. Soc. 1989, 111, 5015−5017. (3) (a) Matthew, S.; Ross, C.; Rocca, J. R.; Paul, V. J.; Luesch, H. J. Nat. Prod. 2007, 70, 124−127. (b) Taori, K.; Matthew, S.; Rocca, J. R.; Paul, V. J.; Luesch, H. J. Nat. Prod. 2007, 70, 1593−1600. (c) Kwan, J. C.; Taori, K.; Paul, V. J.; Luesch, H. Mar. Drugs 2009, 7, 528−538. (4) Gunasekera, S. P.; Miller, M. W.; Kwan, J. C.; Luesch, H.; Paul, V. J. J. Nat. Prod. 2010, 73, 459−462. (5) Iwasaki, A.; Sumimoto, S.; Ohno, O.; Suda, S.; Suenaga, K. Bull. Chem. Soc. Jpn. 2014, 87, 609−613. (6) Salvador, L. A.; Taori, K.; Biggs, J. S.; Jakoncic, J.; Ostrov, D. A.; Paul, V. J.; Luesch, H. J. Med. Chem. 2013, 56, 1276−1290. (7) Reese, M. T.; Gulavita, N. K.; Nakao, Y.; Hamann, M. T.; Yoshida, W. Y.; Coval, S. J.; Scheuer, P. J. J. Am. Chem. Soc. 1996, 118, 11081−11084. (8) Boudreau, P. D.; Byrum, T.; Liu, W. T.; Dorrestein, P. C.; Gerwick, W. H. J. Nat. Prod. 2012, 75, 1560−1570. (9) (a) Iwasaki, A.; Ohno, O.; Sumimoto, S.; Suda, S.; Suenaga, K. Tetrahedron Lett. 2014, 55, 4126−4128. (b) Okamoto, S.; Iwasaki, A.; Ohno, O.; Suenaga, K. J. Nat. Prod. 2015, 78, 2719−2725. (c) Ogawa, H.; Iwasaki, A.; Sumimoto, S.; Iwatsuki, M.; Ishiyama, A.; Hokari, R.; Otoguro, K.; O̅ mura, S.; Suenaga, K. Org. Lett. 2017, 19, 890−893. (10) Luesch, H.; Pangilinan, R.; Yoshida, W. Y.; Moore, R. E.; Paul, V. J. J. Nat. Prod. 2001, 64, 304−307. (11) Nakao, Y.; Yoshida, W. Y.; Szabo, C. M.; Baker, B. J.; Scheuer, P. J. J. Org. Chem. 1998, 63, 3272−3280. (12) Bunyajetpong, S.; Yoshida, W. Y.; Sitachitta, N.; Kaya, K. J. Nat. Prod. 2006, 69, 1539−1542. (13) Nogle, L. M.; Gerwick, W. H. J. Nat. Prod. 2002, 65, 21−24.
1952
DOI: 10.1021/acs.jnatprod.7b00256 J. Nat. Prod. 2017, 80, 1948−1952
