Label-free DNA Assay by Metal Stable Isotope Detection

Article pubs.acs.org/ac

Cite This: Anal. Chem. 2017, 89, 13269−13274

Label-Free DNA Assay by Metal Stable Isotope Detection Rui Liu,† Chaoqun Wang,† Yuming Xu,‡ Jianyu Hu,† Dongyan Deng,† and Yi Lv*,† †

Key Laboratory of Green Chemistry & Technology, Ministry of Education, College of Chemistry, Sichuan University, Chengdu, Sichuan 610064, P. R. China ‡ College of Materials and Chemistry & Chemical Engineering, Chengdu University of Technology, Chengdu, Sichuan 610059, P. R. China S Supporting Information *

ABSTRACT: The interest in label-free bioassays is increasing rapidly because of their simple procedure and direct information on the interaction between the target molecule and the sensing unit. One of the major obstacles in the application of label-free biosensors is the difficulty to produce stable and reproducible optical, electric, electrochemical, or magnetic properties for the sensitive detection of the target molecules. In this work, we demonstrated a label-free DNA assay, by directly measuring the intrinsic 63Cu and 65Cu stable isotopes inside the double-strand DNA-templated Cu nanoparticles. The experimental conditions, including detection of copper by elemental mass spectrometry, the copper nanoparticles formation parameters, the hybrid chain reaction parameters, and analytical performance, were investigated in detail. The 63 Cu signal intensity possesses a linear relation with the concentration of target DNA over the range of 20−1000 pM with a detection limit of 4 pM (3σ). The detection limit of this method is among the most sensitive label-free techniques and also comparable to the lanthanides and Au nanoparticles labeled assays by elemental mass spectrometric detection. The proposed label-free bioassay is simple and sensitive and eliminated the need for optical, electric, electrochemical, or magnetic properties of the sensing unit. To our best knowledge, this is the first report of the label-free bioassay by metal stable isotope detection.

N

chemical, or magnetic property; (ii) low limits of detection at the pg mL−1 level for metal isotopes; (iii) wide dynamic ranges of 9 orders of magnitude; (iv) the excellent mass spectral resolution and low matrix effect for multiplex bioassay; (v) the high metrological value for absolute quantification. During the assay, nanoparticles (NPs) tags are usually employed for the high sensitivity, thanks to the great amount of detectable stable isotopes in each nanoparticle tag. However, the cumbersome labeling procedure and vulnerable nanoparticle−biomolecule conjugate often require sophisticated design and optimization. Herein, we describe the design and application of a label-free elemental mass spectrometry-based bioassay, eliminating the need for special sensing properties (optical, electric, electrochemical, etc.). The copper nanoparticles, used as the metal isotope sensing unit, can be templated formed on double-strand DNA,30−34 while much fewer nanoparticles are formed on single-strand DNA.35 Thus, the hybridization of target DNA and probe DNA could trigger a turn-on mass spectrometric response from templated formed Cu nanoparticles. The intrinsic 63Cu and 65Cu isotopes inside the Cu nanoparticle are directly and sensitively detected. The formation conditions

owadays, the interest in label-free bioassays is increasing rapidly because of their simple procedure and direct information on the interaction between the target molecule and sensing unit.1,2 For instance, in general label-free DNA assays, the sensing unit is attached noncovalently on DNA through interaction forces such as electrostatic interaction, intercalation, and groove binding, etc. They show enhanced luminescence after interaction with target DNA molecules because their excited states are protected by the oligonucleotide’s hydrophobic interior.3 Therefore, the target biomolecule caused structure-transformation of the oligonucleotide that can produce an optical signal. Thanks to the fast development of DNA-based detection platform (e.g., electrochemical platform4 and fluorescent platform5−7), the label-free DNA assays also provide great opportunity for applications in label-free immunologic, enzymatic, and other bioassays.1,3 However, one of the major obstacles in the application of label-free biosensors is the difficulty to produce stable and reproducible optical, electric, electrochemical, and magnetic properties for the sensitive detection of the target molecules. Via detecting metal stable isotopes, elemental mass spectrometry-based bioassay has demonstrated great potential and been proved successful for proteins,8−12 nucleic acids,13−18 and single cells19−23 analysis. The advantages of elemental mass spectrometry-based bioassay include24−29 (i) No need for a special feature such as radioactive, optical, electric, electro© 2017 American Chemical Society

Received: August 17, 2017 Accepted: November 22, 2017 Published: November 22, 2017 13269

DOI: 10.1021/acs.analchem.7b03327 Anal. Chem. 2017, 89, 13269−13274

Article

Analytical Chemistry

on microtiter plate and hybridization of capture DNAs with target DNAs were performed referring to the literature.36,37 After the localization of capture DNAs (200 μL, 0.25 μM) at 37 °C overnight, the wells were blocked by blocking buffer (5% BSA in PBS buffer) at 37 °C for 5 h and washed 3 times by PBS buffer (with 0.05% Tween 20) and twice by MOPS buffer. The DNA hybridization reaction was carried out in MOPS buffer. In the hybridization process, target DNAs (200 μL) were added in each well at 37 °C. After 2 h, the microplates were washed by MOPS buffer three times. Afterward, HCR was carried out by adding hairpin DNAs in the microtiter plates to a final concentration of 1 μM. After 60 min HCR and washing 3 times by MOPS buffer, 3 mM ascorbic acid and 300 μM copper sulfate were added into the microtiter plate, respectively. After 10 min incubation, the solutions in the microplates were poured out. The copper NPs formed at the bottom of microtiter plates were rinsed thrice by DIW. After reacting with 200 μL of nitric acid (20% v/v) for 30 min, the resulted copper solution was diluted to 4 mL.The target DNA concentration was calculated based on the 63Cu isotope signal of ICPMS.

of double-strand DNA templated copper nanoparticles are mild without any rigorous agitation, heating/cooling, and irradiation treatment, which result in a good repeatability. By employing the hybridization chain reaction (HCR) for signal amplification, the proposed mass spectrometric bioassay system shows a highly sensitive response to the target DNA.

■

EXPERIMENTAL SECTION Instruments. An inductively coupled plasma mass spectrometer (ICPMS, ELAN DRC-e, PerkinElmer, Inc.) was employed throughout the study. The ICPMS parameters were optimized according to the manual of the instrument manufacturer. The dead time of ICPMS instrument (50 ns) was acquired by testing the 204Pb/206Pb ratios in a series of standard solutions. The experimental conditions of ICPMS are summarized in Table 1. Single-channel and eight-channel Table 1. Operating Conditions of ICPMS Instrument conditions

settings

radiofrequency power coolant argon gas flow auxiliary argon gas flow carrier (nebulizer) argon gas flow resolution dwelling time dead time sweeps per reading isotope monitored

1300 W 13 L min−1 0.8 L min−1 1.0 L min−1 0.7 amu 30 ms 50 ns 5 63 Cu65Cu

■

RESULTS AND DISCUSSION Templated Formation of CuNPs on Double-Strand DNA. In this work, a label-free and sensitive DNA detection method was established by using HCR amplification and stable isotope signal of dsDNA-templated Cu NPs. As illustrated in Figure 1, each hairpin DNA has an 18 bp stem with a loop of 6 nucleotides. They also have another sticky end of 6 nucleotides. The target DNA reacted with the capture DNA on the microtiter plates and formed a hybridized dsDNA with a 15 nucleotide sticky end. The sticky end induced the HCR procedure and the formation of dsDNA polymers while two hairpin DNAs existed. Then the excessive hairpin DNAsH1/H2 were poured out from microtiter plates. After washing with MOPS buffer, Cu NPs were formed on the dsDNA polymers inside the microtiter plates. In the presence of hairpin DNA H1/H2 and absence of the target DNA, there were no dsDNA formed on the bottom of the microtiter plates, and thus no obvious mass spectrometric signal was observed (part A of Figure 2a). In the presence of target DNA without hairpin DNAs, low mass spectrometric signal was obtained (part B of Figure 2a). Hybridization products of capture DNA and target DNA are only 15 bp; thus, few Cu NPs were formed. With both hairpin DNAs and target DNAs, target DNAs hybridized together with the capture probe localized on the bottom of microtitor plates to form partial dsDNA with a sticky end of 15 nucleotide, which acted as the initiator for HCR. As shown in the figure (part C of Figure 2a), 1 nM target DNA was expected to induce the DNA hybridization and generated long dsDNA polymers, resulting in a significant increase of the mass spectrometric signal intensity of Cu.

pipettors (Dragon Laboratory Instruments, China) were used for the solution transfer. The morphology of the formed Cu NPs was recorded by JEM-2010 transmission electron microscopy (TEM). Reagents. Deionized water (DIW, 18.2 MΩ cm−1) was used throughout this study. Polystyrene 96-well microplates were employed for the DNA assay. All glassware was first washed by aquaregia solution, flushed with DIW, and dried by a vacuum oven. Table 2 lists the sequences of all oligonucleotides. The oligonucleotides were synthesized by Shanghai Sangon Inc. (Shanghai, China). 3-(N-Morpholino)propanesulfonic acid (MOPS), sodium ascorbate, and copper sulfate were obtained from Changzheng Chemical Reagent Inc. (Chengdu, China). MOPS buffer solution (20 mM MOPS, 300 mM NaCl, pH = 7.5) and PBS buffer (10 mM PB, 20 mM NaCl, pH = 7.4) were used in this study. All the chemical reagents were of analytical reagent grade. Assay Procedure. The hairpin DNAs H1/H2 were heated to 90 °C for 5 min and cooled at room temperature for 60 min. Capture DNAs were localized on microtiterplates at 5′-end amino via covalent binding. The localization of capture DNAs Table 2. Sequences of Oligonucleotides

a

name

sequence (5′−3′)

capture DNA target DNA SBMa DNA noncomplementary DNA hairpin probe H1 hairpin probe H2

NH2−(CH2)6−A10TATTAACTTTACTCC TCAGCGGGGAGGAAGGGAGTAAAGTTAATA TCAGCGGGGAGGAAGGGAGTAAAATTAATA GTGATCATACTTGGCAACTCGGTACCGCGC CTTCCTCCCCGCTGACAAAGTTCAGCGGGG GTTTCAAGTCGCCCCGAAGGAGGGGCGACT

SBM: single base mismatch. 13270

DOI: 10.1021/acs.analchem.7b03327 Anal. Chem. 2017, 89, 13269−13274

Article

Analytical Chemistry

Figure 1. Schematic diagram of the proposed label-free bioassay for target DNA.

Figure 2. Templated formation of Cu NPs by double-strand DNA. (a) ICPMS signal without target DNA and with hairpin DNAs (A), with target DNA and without hairpin DNAs (B), the target DNA and hairpin DNAs all present (C); (b) TEM; (c) ultraviolet−visible absorption spectrum; and (d) fluorescence spectrum of the formed Cu NPs.

and 65Cu, respectively. During the current bioassay, the sample matrix was very simple by using reagents of high purity and deionized water of 18.2 MΩ cm−1. Consequently, the polyatomic interference was found to be negligible. Both 63 Cu and 65Cu are suitable for the proposed bioassay. As shown in Figure 3a, 63Cu was chosen as analyte in further studies, due to the around twofold higher sensitivity over 65Cu. Cu standard solution of 10 ng mL−1 was used for the optimization of the 63 Cu signal. The influence of radiofrequency power on 63Cu signal was studied. The maximum intensity for 63Cu was acquired under the radio frequency power of 1300 W. Under the higher radio frequency power, doubly charged ions may produce and thus decrease the analyte signal. 63Cu signal intensity can be also greatly affected by nebulizer gas flow rate. The relationship between the nebulizer gas flow rate and 63Cu signal intensity was investigated. The maximum intensity for 63 Cu was obtained at 1.0 L min−1 nebulizer argon gas flow rate. After the optimization of experimental parameters, the

Without the immobilization of capture DNA on microtiter plates, the production of Cu NPs on the dsDNA polymer formed by HCR was observed by TEM. As shown in Figure 2b, several Cu NPs could be clearly observed, and the diameter was about 5−10 nm. Moreover, the formed Cu NPs were characterized by ultraviolet−visible absorption spectrophotometry and fluorescence spectroscopy. The results are shown in Figure 2c and Figure 2d. The maximum emission and absorption wavelengths of the Cu NPs are 614 and 335 nm, respectively, which are in good accordance with the literature values.30These results confirmed that dsDNA formed by HCR can work efficiently as template for CuNPs formation. Since Cu nanoparticles formed via hybridization between hairpins DNAs for multiple HCR cycles can be detected by elemental mass spectrometry, a label-free and sensitive bioassay is established. ICPMS Detection of Copper. Cu has two isotopes with abundances of 69.17% (63Cu) and 30.83% (65Cu), respectively. Polyatomic interferences38 are reported in complicated sample matrix (Table S1).They have the same mass number as 63Cu 13271

DOI: 10.1021/acs.analchem.7b03327 Anal. Chem. 2017, 89, 13269−13274

Article

Analytical Chemistry

Figure 3. ICPMS detection of Cu: (a) signal of 63Cu and 65Cu; (b) calibration curve of 63Cu.

Figure 4. Effect of the concentrations of copper sulfate (a) and sodium ascorbate (b).

calibration curves of 63Cu were established with standard copper solutions (Figure 3b). The linear equation of Y = 8484X + 264 for 63Cu isotope was obtained, with detection limit (3σ) of 0.0042 ng mL−1. Optimization of Experimental Conditions. The experimental parameters, including the concentration of copper sulfate, the concentration of sodium ascorbate, the hairpin DNAs concentration, and the HCR reaction time, were studied in detail to obtain high performance bioassay. Cu(I) was produced from the reduction of copper sulfate by sodium ascorbate, which disproportionated rapidly to Cu(II) and Cu. The Cu was concentrated on the major groove of dsDNA; thus, the CuNPs were formed.30 When the molar concentration of dsDNA is fixed, the formation of Cu NPs would be strongly influenced by the concentration of copper sulfate and sodium ascorbate. The effects of the concentration of copper sulfate and the concentration of sodium ascorbate are shown in Figure 4a and Figure 4b, respectively. Maximum signal-to-noise ratio was achieved with 300 μM copper sulfate and 3 mM sodium ascorbate, respectively, which were employed in the subsequent experiments. The effect of H1/H2 concentration from 100 nM to 2 μM was also examined. The best analytical performance was achieved when the concentration of hairpin probes was 1 μM, which was selected for further studies. The effect of HCR reaction time was also investigated. With increasing reaction time of HCR process, signal-to-noise ratio increased and then almost remained constant when the reaction time of amplification was higher than 60 min, which was selected for further studies.

Analytical Performance. Under optimal conditions, the relationship of the 63 Cu signal and the target DNA concentration was studied. As shown in the inset of Figure 5a, the dynamic range of the DNA concentration from 20 to 1000 pM was obtained using ICPMS 63Cu intensity. The linear equation was found to be Y = 1.22E2X + 1.4E4, with the correlation coefficient R = 0.9940. The detection limit was 4 pM (3σ). The reproducibility expressed as relative standard deviation (RSD) was 4.2% (n = 7) for target DNA of 200 pM. In Table 3, the proposed bioassay is compared with some other widely accepted label-free assays for DNA quantification. The detection limit of the proposed bioassay is among the most sensitive label-free techniques. It is also comparable to the lanthanides and Au NPs labeled assays reported by ICPMS detection. The specific recognition of target DNA by the proposed ICPMS label-free assay was also studied. Figure 5b shows the results. A relatively low signal intensity was acquired by DNA of completely mismatched based pair (10 nM). The signal of DNA of single base mismatched (10 nM) was also significantly lower than that of target DNA (1 nM), which validated a favorable specific recognition of the present bioassay. To validate the proposed DNA assay to real biological samples, five human serum samples spiked with different concentrations of target DNA were analyzed. As shown in Table S2, the spiked recoveries were in the range of 90−107% with a RSD lower than 6.6%. The results demonstrated the tolerance of the proposed method to the complicated sample matrix of serum. 13272

DOI: 10.1021/acs.analchem.7b03327 Anal. Chem. 2017, 89, 13269−13274

Article

Analytical Chemistry

amplification schemes, such as ligation-mediated amplification and rolling circle amplification, are potentially adoptable for the development of sensitive label-free ICPMS bioassays. The proposed method possesses great potential for sensitive and label-free immunoassay, enzymatic assay, etc.

■

ASSOCIATED CONTENT

* Supporting Information S

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.analchem.7b03327. Potential polyatomic interferences to 63Cu and 65Cu; detection of target DNA in spiked human serum samples (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail [email protected]. Tel. and fax +86-28-8541-2798. ORCID

Rui Liu: 0000-0001-9928-5373 Yi Lv: 0000-0002-7104-2414 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS Dr. Shanlin Wang of Sichuan University is thanked for TEM analysis. The National Natural Science Foundation of China is gratefully acknowledged (Nos. 21575093, 21505008, and 21505095). This work is also supported by the Fundamental Research Funds for the Central Universities.

Figure 5. Analytical performance of the current label-free DNA assay. (a) Calibration curve between target DNA concentration and 63Cu signal; (b) specific recognition of target DNA.

■

(1) Luo, X. L.; Davis, J. J. Chem. Soc. Rev. 2013, 42, 5944−5962. (2) Carrascosa, L. G.; Huertas, C. S.; Lechuga, L. M. TrAC, Trends Anal. Chem. 2016, 80, 177−189. (3) Ma, D. L.; He, H. Z.; Leung, K. H.; Zhong, H. J.; Chan, D. S. H.; Leung, C. H. Chem. Soc. Rev. 2013, 42, 3427−3440. (4) Li, H.; Arroyo-Curras, N.; Kang, D.; Ricci, F.; Plaxco, K. W. J. Am. Chem. Soc. 2016, 138, 15809−15812. (5) Kahveci, Z.; Martinez-Tome, M. J.; Mallavia, R.; Mateo, C. R. ACS Appl. Mater. Interfaces 2017, 9, 136−144. (6) Wang, M. D.; Mao, Z. F.; Kang, T. S.; Wong, C. Y.; Mergny, J. L.; Leung, C. H.; Ma, D. L. Chem. Sci. 2016, 7, 2516−2523. (7) Lin, S.; Lu, L. H.; Kang, T. S.; Mergny, J. L.; Leung, C. H.; Ma, D. L. Anal. Chem. 2016, 88, 10290−10295. (8) Zhang, C.; Zhang, Z. Y.; Yu, B. B.; Shi, J. J.; Zhang, X. R. Anal. Chem. 2002, 74, 96−99. (9) Baranov, V. I.; Quinn, Z.; Bandura, D. R.; Tanner, S. D. Anal. Chem. 2002, 74, 1629−1636. (10) Liu, R.; Liu, X.; Tang, Y. R.; Wu, L.; Hou, X. D.; Lv, Y. Anal. Chem. 2011, 83, 2330−2336. (11) Liu, R.; Lv, Y.; Hou, X. D.; Mester, Z.; Yang, L. Anal. Chem. 2012, 84, 2769−2775. (12) Liu, R.; Hou, X.; Lv, Y.; McCooeye, M.; Yang, L.; Mester, Z. Anal. Chem. 2013, 85, 4087−4093. (13) Brückner, K.; Schwarz, K.; Beck, S.; Linscheid, M. W. Anal. Chem. 2014, 86, 585−591. (14) Luo, Y.; Yan, X.; Huang, Y.; Wen, R.; Li, Z.; Yang, L.; Yang, C. J.; Wang, Q. Anal. Chem. 2013, 85, 9428−9432. (15) de Bang, T. C.; Shah, P.; Cho, S. K.; Yang, S. W.; Husted, S. Anal. Chem. 2014, 86, 6823−6826. (16) He, Y.; Chen, D.; Li, M.; Fang, L.; Yang, W.; Xu, L.; Fu, F. Biosens. Bioelectron. 2014, 58, 209−213.

Table 3. Comparison of Label-Free Methods for DNA Determination sensing unit Cu NPs Cu NPs Cu NPs Ag NPs deoxyadenosine monophosphates organic chromophore quantum dots lanthanides Au NPs

■

assay type labelfree labelfree labelfree labelfree labelfree labelfree labelfree labeled labeled

analytical method

LOD/pM

refs

ICPMS

4

fluorescence spectrometry fluorescence spectrometry surface-enhanced Raman spectroscopy liquid chromatography− mass spectrometry fluorescence spectrometry fluorescence spectrometry ICPMS ICPMS

98

this work 39

400

40

45

41

370

42

10

43

10

44

0.5−2 1

37 17

REFERENCES

CONCLUSIONS A sensitive label-free DNA assay has been demonstrated by the detection of Cu isotopes inside the Cu NPs. The special properties such as optical, electric, electrochemical, and magnetic features are not required for Cu NPs sensing unit by elemental mass spectrometric detection. The experimental procedure is simple, easy to operate, and low cost. Signal 13273

DOI: 10.1021/acs.analchem.7b03327 Anal. Chem. 2017, 89, 13269−13274

Article

Analytical Chemistry (17) Zhang, S.; Liu, R.; Xing, Z.; Zhang, S.; Zhang, X. Chem. Commun. 2016, 52, 14310−14313. (18) Han, G. J.; Xing, Z.; Dong, Y. H.; Zhang, S. C.; Zhang, X. R. Angew. Chem., Int. Ed. 2011, 50, 3462−3465. (19) Bandura, D. R.; Baranov, V. I.; Ornatsky, O. I.; Antonov, A.; Kinach, R.; Lou, X. D.; Pavlov, S.; Vorobiev, S.; Dick, J. E.; Tanner, S. D. Anal. Chem. 2009, 81, 6813−6822. (20) Bendall, S. C.; Simonds, E. F.; Qiu, P.; Amir, E. A. D.; Krutzik, P. O.; Finck, R.; Bruggner, R. V.; Melamed, R.; Trejo, A.; Ornatsky, O. I.; Balderas, R. S.; Plevritis, S. K.; Sachs, K.; Pe’er, D.; Tanner, S. D.; Nolan, G. P. Science 2011, 332, 687−696. (21) Angelo, M.; Bendall, S. C.; Finck, R.; Hale, M. B.; Hitzman, C.; Borowsky, A. D.; Levenson, R. M.; Lowe, J. B.; Liu, S. D.; Zhao, S.; Natkunam, Y.; Nolan, G. P. Nat. Med. 2014, 20, 436−442. (22) Giesen, C.; Wang, H. A. O.; Schapiro, D.; Zivanovic, N.; Jacobs, A.; Hattendorf, B.; Schuffler, P. J.; Grolimund, D.; Buhmann, J. M.; Brandt, S.; Varga, Z.; Wild, P. J.; Gunther, D.; Bodenmiller, B. Nat. Methods 2014, 11, 417−422. (23) Frei, A. P.; Bava, F.-A.; Zunder, E. R.; Hsieh, E. W. Y.; Chen, S.Y.; Nolan, G. P.; Gherardini, P. F. Nat. Methods 2016, 13, 269−275. (24) Liu, R.; Zhang, S.; Wei, C.; Xing, Z.; Zhang, S.; Zhang, X. Acc. Chem. Res. 2016, 49, 775−83. (25) Liu, R.; Wu, P.; Yang, L.; Hou, X.; Lv, Y. Mass Spectrom. Rev. 2014, 33, 373−93. (26) Liang, Y.; Yang, L. M.; Wang, Q. Q. Appl. Spectrosc. Rev. 2016, 51, 117−128. (27) Wang, H.; He, M.; Chen, B.; Hu, B. J. Anal. At. Spectrom. 2017, 32, 1650−1659. (28) Hann, S.; Dernovics, M.; Koellensperger, G. Curr. Opin. Biotechnol. 2015, 31, 93−100. (29) Sanz-Medel, A. Anal. Bioanal. Chem. 2016, 408, 5393−5395. (30) Rotaru, A.; Dutta, S.; Jentzsch, E.; Gothelf, K.; Mokhir, A. Angew. Chem., Int. Ed. 2010, 49, 5665−5667. (31) Zhou, Z. X.; Du, Y.; Dong, S. J. Anal. Chem. 2011, 83, 5122− 5127. (32) Zhang, L.; Zhao, J.; Duan, M.; Zhang, H.; Jiang, J.; Yu, R. Anal. Chem. 2013, 85, 3797−3801. (33) Wang, Z.; Si, L.; Bao, J.; Dai, Z. Chem. Commun. 2015, 51, 6305−6307. (34) Song, Q. W.; Shi, Y.; He, D. C.; Xu, S. H.; Ouyang, J. Chem. Eur. J. 2015, 21, 2417−2422. (35) Zhao, J.; Hu, S. S.; Cao, Y.; Zhang, B.; Li, G. X. Biosens. Bioelectron. 2015, 66, 327−331. (36) Zhang, S.; Han, G.; Xing, Z.; Zhang, S.; Zhang, X. Anal. Chem. 2014, 86, 3541−7. (37) Han, G. J.; Zhang, S. C.; Xing, Z.; Zhang, X. R. Angew. Chem., Int. Ed. 2013, 52, 1466−1471. (38) May, T. W.; Wiedmeyer, R. H. Atom. Spectrosc. 1998, 19, 150− 155. (39) Hu, W. W.; Ning, Y.; Kong, J. M.; Zhang, X. J. Analyst 2015, 140, 5678−5684. (40) Song, C. X.; Yang, X. H.; Wang, K. M.; Wang, Q.; Huang, J.; Liu, J. B.; Liu, W.; Liu, P. Anal. Chim. Acta 2014, 827, 74−79. (41) Gao, F. L.; Lei, J. P.; Ju, H. X. Anal. Chem. 2013, 85, 11788− 11793. (42) Zhao, W.; Qin, Z.; Zhang, C.; Zhao, M.; Luo, H. Chem. Commun. 2014, 50, 9846−9848. (43) Wang, H. B.; Zhang, H. D.; Chen, Y.; Huang, K. J.; Liu, Y. M. Sens. Actuators, B 2015, 220, 146−153. (44) He, X. W.; Ma, N. Anal. Chem. 2014, 86, 3676−3681.

13274

DOI: 10.1021/acs.analchem.7b03327 Anal. Chem. 2017, 89, 13269−13274