Label-free Ratiometric Electrochemiluminescence Aptasensor

Subscriber access provided by Nottingham Trent University

Article

Label-free Ratiometric Electrochemiluminescence Aptasensor Based on Nano-Graphene Oxide Wrapped Titanium Dioxide nanoparticles with Potential-resolved Electrochemiluminescence Zhili Han, Jiangnan Shu, Xu Liang, and Hua Cui Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.9b02318 • Publication Date (Web): 03 Sep 2019 Downloaded from pubs.acs.org on September 4, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Label-free Ratiometric Electrochemiluminescence Aptasensor Based on Nano-Graphene Oxide Wrapped Titanium Dioxide nanoparticles with Potential-resolved Electrochemiluminescence Zhili Han,⊥ Jiangnan Shu,⊥ Xu Liang and Hua Cui* CAS Key Laboratory of Soft Matter Chemistry, iChEM (Collaborative Innovation Center of Chemistry for Energy Materials), Department of Chemistry, University of Science and Technology of China, Hefei, Anhui 230026, China * Hua Cui, Fax: +86-551-63600730, E-mail: [email protected] ABSTRACT: A new ‘one-pot’ hydrothermal method was developed for the preparation of electrochemiluminescence (ECL) nanoluminophores nano-graphene oxide wrapping titanium dioxide (nGO@TiO2 NLPs). The characterization demonstrated that nGO@TiO2 NLPs possessed a core–shell like shape. The nGO@TiO2 NLPs exhibited potential-resolved ECL property in neutral aqueous solution using K2S2O8 as a coreactant. On this basis, a label-free ratiometric ECL aptasensor was designed. nGO@TiO2 NLPs were used to fabricate the ECL interface for target recognition, potential-resolved ECL signal generation and amplification. In the presence of cardiac troponin I (cTnI), the aptamer reside from the electrode surface owing to its rigidity, resulting in a reduce in charge transfer resistance of modified working electrode and a ratio enhancement of two ECL signals of nGO@TiO2 NLPs. According to the increased ECL ratio, cTnI could be determined by the ratiometric ECL aptasensor, with a linear dynamic range of 1.0×10-13 ~ 1.0×10-10 mol/L and a detection limit of 4.0×10-14 mol/L, which is superior to most reported electrochemical methods. This label-free ratiometric ECL strategy with self-calibrating ability and accurate, ultrasensitive, rapid, specific analytical performance showed great promise in biosensing and clinical diagnosis. The developed strategy might extend for the sensing of other protein biomarkers by using corresponding antibodies or aptamers as recognition elements.

Electrochemiluminescence (ECL) has become an important detection technology in bioassays due to its inherent advantages such as high sensitivity, wide linear range and simple instrumentation.1 To date, various ECL bioassays based on organic molecules and nanomaterials as ECL luminophores have been developed for the determination of DNA,2 miRNA,3 proteins,4 cancer cells5 and so on. However, false positive or negative errors cannot be completely avoided in the detection of targets at trace level, because incidental changes in analyte loading density, conductive electrode area and non-targetinduced reagent degradation/dissociation during detection can affect the accuracy of the analysis results.6 Thus, it is very crucial to develop new analytical strategies or principles to improve analytical accuracy of ECL bioassays. In 1998, potential-resolved ECL was proposed by our group, which could generate multiple-channel ECL emissions by applying different voltages in a cyclic voltammetry scan.7 Afterwards, Chen’s group successfully used potential-resolved ECL to develop ECL ratiometric sensor for the detection of nucleic acid to improve the reliability of analytical results.8 This approach was based on measurement of the ratio of ECLluminol/ECLCdS, since the ECL emission of luminol occurred in the positive potential range and the ECL of CdS quantum dots appeared in the negative range using H2O2 as a coreactant. Subsequently, potential-resolved ECL ratiometric

strategies have attracted growing attentions in bioassays. For example, Lei’s group proposed a dual-potential ECL ratiometric approach based on sandwich immunoassay for the detection of carcinoembryonic antigen.9 The two ECL luminophores, CdS quantum dots and luminol/palladiumna noclusters@graphene oxide, were used. Han’s group fabricated a ratiometric ECL aptasensor through layer-by-layer construction based on the ECL energy transfer between CdTe quantum dots and gold nanoparticles/graphene oxide nanocomposites for the detection of thrombin.10 However, the reported potential-resolved ECL ratiometries usually required two ECL luminophores, including organic molecules (luminol, ruthenium (II) complexs) and nanomaterials (quantum dots, metal nanoclusters, semiconductor nanocrystal). These methods involved in multi-step assembling and labeling processes, matched donor/acceptor pairs and wide potential window. Potential-resolved nanoluminophores have rarely been reported for simple, fast and sensitive ratiometric ECL bioassays. Herein, a novel ECL nanoluminophores nano-graphene oxide wrapping titanium dioxide (nGO@TiO2 NLPs) was prepared via ‘one-pot’ hydrothermal method. The as-prepared nGO@TiO2 NLPs were characterized by high-resolution transmission electron microscope (HRTEM), energy dispersive spectroscopy (EDS)-mapping, fluorescence spectra,

1 ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fourier transform infrared spectroscopy (FT-IR), Raman spectra and X-ray photoelectron spectroscopy (XPS). The ECL behavior of nGO@TiO2 NLPs was studied by cyclic voltammetry (CV). It was found that nGO@TiO2 NLPs exhibited potential-resolved dual ECL emissions at -1.27 V and -1.85 V in a negative potential scan in neutral aqueous solution using K2S2O8 as a coreactant. The mechanism of the potential-resolved ECL emissions for nGO@TiO2 NLPs is proposed. Based on the intensity ratio of two ECL peaks at different potential, a label-free ratiometric ECL aptasensor was constructed for the detection of cardiac troponin I (cTnI), which is the gold standard biomarker of acute myocardial infarction (AMI). In the presence of cTnI, the ratio of the two ECL signals increased, which was used for quantitative detection of cTnI. The constructive process of ECL aptasensor was investigated via electrochemical impedance spectra (EIS) and ECL. After condition optimization, the analytical performance of the label-free ratiometric ECL aptasensor was explored. Finally, the aptasensor was used to detect the amount of cTnI in AMI patient serum samples to investigate its practicality.

EXPERIMENTAL SECTION Chemicals and materials. Stock solution of ethanolamine (MEA) (1.0 M) was obtained via dissolving MEA (Sinopharm Chemical Reagent Co., Ltd, China) in ultrapure water and adjusted the pH to 8.5 with hydrochloric acid, and stored at 4 °C in dark. A 0.25 mol/L stock solution of 2-(NMorpholino)ethanesulfonic acid (MES) was obtained by dissolving MES (Sigma, St. Louis, MO) in ultrapure water (pH=5.0). N-hydroxysuccinimide (NHS) and 1-(3(Dimethylamino)propyl)-3-ethylcarbodiimidehy-drochloride (EDC) were purchased from Aladdin Reagent (China). K2S2O8 was purchased from Shanghai Reagent (China). Copeptin was obtained from Genscript (Nanjing, China). Streptavidin (SA), bovine serum albumins (BSA) and human immunoglobulin G (IgG) were purchased from Solarbio (Beijing, China). Human serum albumin (HSA) were obtained from Sigma (St. Louis, MO). Biotinylated cTnI aptamer (biotin-apta) was selected by University of Science and Technology of China, the sequence of biotin-apta was as follows: 5’TTCAGCACTCCACGCATAGCTCAGCCGGCAATGAA CAACCTCCATTCTAACGCAGTGTTACCTATGCGTGCT ACCGTGAA3’. Fatty acid binding proteins (FABP) and cTnI were supplied from the First Affiliated Hospital of Nanjing Medical University. The AMI patient serum samples were supplied from the First Affiliated Hospital of Anhui Medical University. The healthy human serum samples were got from the Hospital of University of Science and Technology of China. The working buffer used for ECL detection was 0.05 mol/L K2S2O8 dissolved in phosphate buffered saline (PBS) (pH = 7.5, containing 0.01 mol/L Na2HPO4/NaH2PO4 and 0.02 mol/L NaCl). The washing buffer used for ECL aptasensor was Dulbecco's phosphate buffered saline solution (DPBST) (pH = 7.4, containing 0.3 ‰ Tween 20). Ultrapure water prepared by a MilliQ system (Milli-pore, France) was used throughout the experiment. All of the reagents were analytical grade.

Page 2 of 9

Apparatus. The apparatus used in the study of ECL property were similar with our previous work and the information of characterization instruments were all presented in the Supporting Information section S1.12 Preparation and ECL property of nGO, TiO2 and nGO@TiO2 NLPs. Firstly, nGO was synthesized according to our previous work with some modification, as shown in SI, section S2).11 Then, nGO@TiO2 NLPs were obtained by a ‘one-pot’ hydrothermal method. In brief, 20 μL of TiCl4 was firstly added to nGO solution and reacted in ice-water bath for an hour. Then the mixture was transferred to a reaction kettle and reacted at 180 °C for 8 h. After cooling to room temperature, the mixture was centrifugated and washed with water and ethanol successively to remove unreacted small molecules and free TiO2. The precipitate was dispersed in aqueous solution to obtain nGO@TiO2 NLPs suspension and then stored in dark. As a comparison, TiO2 was synthesized with similar process without nGO. For the electrode modification, 40 μL of nGO, TiO2 and nGO@TiO2 NLPs were dropped into the reservoir of the F-doped tin oxide (FTO) electrode, respectively and dried under air condition naturally. Then, the ECL behavior of nGO, TiO2 and nGO@TiO2 NLPs modified electrode was investigated by CV under air atmosphere, respectively. Fabrication of ECL aptasensor. The pretreatment of the FTO electrode referred to our previous work.12 The assemble processes are as follows. Firstly, 40 μL of nGO@TiO2 NLPs suspension was dropped onto the conductive surface of an FTO electrode and dried in dark under air condition naturally. Then, 40 μL of the mixture of EDC (5 mg/mL) and NHS (5 mg/mL) dissolving in 0.025 mol/L MES solution was dropped on the nGO@TiO2 NLPs/FTO electrode and incubated at 25 ℃ for 0.5 h to activate the carboxyl group of nGO@TiO2 NLPs. Next, 40 μL of SA (1.0×10-7 mol/L) solution in PBS buffer was added to the modified FTO electrode and reacted with the activated carboxyl group of nGO@TiO2 NLPs for 2 h. After that, 40 μL MEA (1.0 mol/L) solution was used to block non-reacted activated carboxyl groups for 30 minutes at 25 ℃ . Subsequently, 40 μL of biotin-apta (1.0×10-7 mol/L) solution in Dulbecco's phosphate buffered saline (DPBS) buffer was dropped to the above modified electrode and reacted for 20 min. Then, 40 μL of 1% (w/w) polyvinylpyrrolidone (PVP) solution in DPBS buffer was used to block non-specific binding sites for 40 minutes at 25 ℃. At the end of each step, the modified electrode was washed by DPBST buffer. Finally, the obtained PVP/biotinapta/MEA/SA/nGO@TiO2 NLPs/FTO electrode could be directly used for the determination of cTnI. cTnI detection. 40 μL of cTnI solution in DPBS buffer with different concentrations was added to the surface of the above modified electrode. After incubation at 25 ℃ for 40 minutes, the electrode was washed by DPBST buffer. Meanwhile, 40 μL of DPBS buffer was used in the blank experiment instead of cTnI. ECL experiment was conducted in the ECL instruments (SI, section S4). The difference value of the ECL intensity ratio Δ(I1/I2) in the presence and absence of cTnI under CV condition was used for quantitative analysis of cTnI.


Page 3 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. (A) HRTEM image of nGO@TiO2 NLPs. (B) HAADF image of nGO@TiO2 NLPs, scale bar: 50 nm. (C, D and E and F) EDSmapping of C, O, Ti elements and their overlay corresponded to the area of image (B), scale bar: 20 nm.

RESULTS AND DISCUSSION Synthesis and Characterization of nGO@TiO2 NLPs. nGO@TiO2 NLPs were prepared via a ‘one-pot’ hydrothermal method as depicted in Scheme 1. First, nGO was obtained as described previously with some modification (SI, section S2). Second, TiCl4 was quickly added to nGO solution and reacted in ice-water bath for an hour. Finally, the mixture reacted under high temperature for 8 h to obtain nGO@TiO2 NLPs. As a comparison, TiO2 was also synthesized with similar process without nGO.

Scheme 1. Schematic illustration of preparation of nGO@TiO2 NLPs. The morphologies of the prepared nGO, TiO2 and nGO@TiO2 NLPs were characterized by TEM. Figure S1A shows the TEM image of nGO with an average size about 25 nm. The morphology of the obtained TiO2 was quasi-spherical with an average size about 6 nm as shown in Figure S1B. The HRTEM image of nGO@TiO2 NLPs (Figure 1A) revealed that the average diameter of TiO2 in nGO@TiO2 NLPs was about 6 nm, which was similar to that of TiO2. And the observed fringe spacing was 0.35 nm, indicating that TiO2 was pure anatase crystalline phase.13 Furthermore, the high-resolution transmission electron microscope (HRTEM) image showed a blurred region (blue dot circle in Figure 1A) on the surface of TiO2 nanoparticle, which was considered to be the trace of nGO layer. The results demonstrated that nGO@TiO2 NLPs exhibited a core–shell like shape since the ultrathin graphene shells could effectively enwrap TiO2 nanoparticles. Figure 1B shows the high angle annular dark (HAADF) image of nGO@TiO2 NLPs. In HAADF image, the elements with higher atomic number have brighter contrast compared to the

light elements with lower atomic number. Therefore, it was reasonable to assume that, the brighter spots in Figure 1B were corresponding to TiO2 nanoparticles and the darker spots were corresponding to nGO, since C had a lower atomic number than Ti. In order to confirm the elements of the brighter spots and the darker spots, EDS-mapping was carried out as shown in Figure 1C, D, E and F. The results indicated that the main elements of nGO@TiO2 NLPs were C, O and Ti, and TiO2 distributed uniformly internal of nGO. Furthermore, fluorescence spectra showed the characteristic emission of TiO2 at 366 nm and a broad peak ranging from 420 to 520 nm (Figure S2b) in nGO@TiO2 NLPs composites.15 FT-IR spectra exhibited a broad band below 1000 cm−1 (Figure S3c), corresponding to the bending and stretching vibrational modes of Ti−O−Ti bond.15 Raman spectra showed additional raman shift 1348 cm−1 and 1604 cm−1, which was attributed to the Dand G-bands of nGO (Figure S4c).15,16 These results further supported that TiO2 and nGO existed in nGO@TiO2 NLPs composites. The chemical states of the element presented in the prepared TiO2 and nGO@TiO2 NLPs were characterized by XPS. The fully scanned spectra (Figure 2A) confirmed the existence of Ti, C and O elements in nGO@TiO2 NLPs, which was consistent with the result of EDS-mapping. Figure 2B are the Ti core level XPS spectra of TiO2 and nGO@TiO2 NLPs. Two peaks centered at 458.6 eV and 464.3 eV were observed in the Ti core-level XPS spectrum of TiO2, corresponding to the Ti 2p1/2 and Ti 2p3/2 spin-orbital splitting photoelectrons in the Ti4+ state, respectively.15 The positions of Ti 2p1/2 (464.7 eV) and Ti 2p3/2 (459.0 eV) peaks of nGO@TiO2 NLPs were found to be shifted by 0.4 eV compared with that of TiO2. These results implied that the normal state of Ti4+ existed in the nGO@TiO2 NLPs. The 0.4 eV binding energy difference be-

Figure 2. (A) Survey XPS data of nGO, TiO2 and nGO@TiO2 NLPs. (B) Ti 2p spectra of TiO2 and nGO@TiO2 NLPs.



tween the Ti peak positions in the obtained TiO2 and nGO@TiO2 NLPs might be related to the coordination between Ti and oxygen centers of nGO.15,17 Since oxygen, as a highly electronegative element, can withdraw the electron density of Ti in nGO@TiO2 NLPs nanocomposites.15 Therefore, compared with the Ti in the obtained TiO2 nanoparticles, the binding energy of Ti in nGO@TiO2 NLPs nanocomposites increased. ECL Property of nGO@TiO2 NLPs. The ECL property of nGO@TiO2 NLPs was explored by cyclic voltammetry with coreactant K2S2O8. The black curve in Figure 3A shows the IECL-E curve of nGO@TiO2 NLPs. Two ECL peaks (ECL-1 and ECL-2) were found in negative potential range. ECL-1 appeared from -1.0 V and achieved the maximum intensity at 1.27 V. ECL-2 started at -1.42 V and achieved the maximum intensity at -1.85 V. The results revealed that nGO@TiO2 NLPs exhibited two potential-resolved ECL peaks by using K2S2O8 as a coreactant in neutral aqueous solution.

Figure 3. (A) IECL–E curves of FTO electrode (red line), TiO2 (green line), nGO (blue line) and nGO@TiO2 NLPs (black line) in 0.02 mol/L PBS buffer with 0.05 mol/L K2S2O8. Inset in Figure A shows enlarged IECL–E curves of FTO electrode. (B) CV of nGO@TiO2 NLPs. ECL spectra of (C) ECL-1 in IECL–E curve (Figure 2A, black line) and TiO2, (D) ECL-2 in IECL–E curve (Figure 2A, black line) and nGO obtained with filters of different wavelengths. Scan rate: 0.1 V/s, scan range: 0 ~ -2.1 ~ 0 V, PMT: -500 V.

To investigate the association of ECL-1 and ECL-2 generated by nGO@TiO2 NLPs, the ECL properties of TiO2 and nGO were studied. As shown in Figure 3A, both of TiO2 (green line) and nGO (blue line) have only one ECL peak in the same conditions. By comparing ECL potential values of TiO2 and nGO with that of nGO@TiO2 NLPs, respectively, it was found that the potential values of ECL peaks of TiO2 and nGO were closed to that of ECL-1 and ECL-2, respectively. The results implied that ECL-1 and ECL-2 in Figure 3A (black curve) originated from TiO2 and nGO moieties of nGO@TiO2 NLPs, respectively. In addition, these assignments of ECL-1 and ECL-2 were further explored by the ECL spectra of nGO@TiO2 NLPs. The maximum ECL emission wavelength of ECL-1 and ECL-2 were 510 nm and 535 nm (Figure 3C, 3D), respectively, which were consistent with that of TiO2 and nGO. All the above results demonstrated that ECL-1 and ECL-

Page 4 of 9

2 derived from the TiO2 and nGO moiety in nGO@TiO2 NLPs, respectively. The effects of air-saturated, O2 and N2 atmosphere on the ECL intensity of nGO@TiO2 NLPs were examined (Figure S5). ECL-1 intensity enhanced in O2 atmosphere and weakened in N2 atmosphere compared with the ECL intensity in air atmosphere, which was opposite for ECL-2. To explain the phenomenon, the effects of air-saturated, O2 and N2 atmosphere on the ECL intensity of TiO2 and nGO were also studied. For the ECL emission of TiO2, it enhanced in O2 atmosphere and weakened in N2 atmosphere, which was consistent with that of ECL-1 in nGO@TiO2 NLPs, indicating that O2 participated in the ECL reaction of TiO2. For the ECL emission of nGO, no obvious change was observed in three gas atmospheres, indicating that O2 did not participate in the ECL reaction of nGO. Moreover, ECL-1 and ECL-2 of nGO@TiO2 NLPs were disappeared without K2S2O8 (Figure S6A) and enhanced with the concentration of K2S2O8 increased (Figure S6B), demonstrating that S2O82- participated in the reaction processes of ECL-1 and ECL-2. It was reported that O2 could be reduced to peroxide anion (OOH–) at a negative potential, corresponding to ECL-1.18 Thus, ECL-1 was related to TiO2, S2O82- and OOH–. ECL-2 resulted from the reaction between nGO and S2O82-. When the S2O82- was partially consumed during the ECL-1 process of nGO@TiO2 NLPs, the ECL-2 signal would be decreased. According to the above results, the reaction process of ECL-1 and ECL-2 is depicted as shown in eqs(1)-(11). For ECL-1, on the one hand, O2 was firstly reduced to OOH–, which could react with S2O82- to generate SO4 •–.18 On the other hand, S2O82- could be directly electro-reduced to SO4•– (Figure 3B). Finally, a hole (h+) generated by SO4•– was injected into the valence band of TiO2, which could recombine with electrons from the conduction band of TiO2, accompanying the light emission.13 For ECL-2 process, nGO•– electro-reduced from nGO could react with SO4•– to form the excited state product nGO* with light emission.13 ECL-1: O2 + H2O + 2e– → OH– + OOH– (1) – 2– – •– OOH + S2O8 → HSO4 + SO4 + O2 (2) S2O82– + e–→SO42– + SO4•– (3) (4) SO4•– → SO42– + h+ TiO2 + h+ → TiO2+ (5) + – * TiO2 + e → TiO2 (6) TiO2* → TiO2 + hν (7) ECL-2: nGO + ne–→ nGO•– (8) 2– – 2•– S2O8 + e → SO4 + SO4 (9) nGO•– + SO4•–→ SO42– + nGO* (10) nGO* → nGO + hν (11) The stability of nGO@TiO2 NLPs was further investigated by ECL emission. As shown in Figure S7, the relative standard deviations (R.S.D.) of ECL-1 and ECL-2 intensity of nGO@TiO2 NLPs in 30 days (n = 7) were 5.0% and 2.8%, respectively. The results demonstrated that the obtained nGO@TiO2 NLPs have good stability, showing great application potential in bioassays.


Page 5 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 2. Schematic illustration of developed label-free ratiometric ECL aptasensor for cTnI based on nGO@TiO2 NLPs. Assembly strategy for label-free ratiometric ECL aptasensor. Considering excellent potential-resolved ECL property of nGO@TiO2 NLPs in the presence of K2S2O8 in neutral aqueous solution, a novel strategy was developed to fabricate label-free ratiometric ECL aptasensor by taking cTnI as target analyte and its aptamer as recognition element as shown in Scheme 2. The aptamer was recently selected and was used for the determination of cTnI for the first time. nGO@TiO2 NLPs was assembled on the FTO electrode via simply dropping and drying under air condition. The FT-IR results revealed that the surface of nGO@TiO2 NLPs had carboxyl groups (Figure S3c), which could be activated by EDC/NHS, then acted as the bridge to connect with SA. Therefore, SA could be modified on the surface of FTO electrode by amide bond between carboxyl group of nGO@TiO2 NLPs and amino group of SA. The unreacted activated carboxyl groups were blocked with MEA. Based on the high affinity between biotin and SA, biotin-apta were further connected onto the SA modified electrode. Finally, PVP was used to block the non-specific binding sites on the constructed FTO electrode to obtain PVP/biotinapta/MEA/SA/nGO@TiO2 NLPs modified electrode. This modified electrode has two functions. 1) It exhibited two strong potential-resolved ECL peaks in neutral K2S2O8 solution under negative potential range. 2) The aptamer on the modified electrode could be used to capture the target cTnI and then both of the two ECL signals increased due to the formation of aptamer-cTnI complexes. The ratio of ECL-1 and ECL-2 in the absence and presence of cTnI, were presented as I10/I20 and I1/I2, respectively. The increased Δ(I1/I2) value (Δ(I1/I2) = I1/I2 - I10/I20) could be used to quantitatively analyze cTnI. Characterization of modified ECL aptasensor. To characterize the assembly process of ECL aptasensor, the fabricated FTO electrode was characterized via EIS and ECL. Due to the good conductivity of nGO, the impedance value of nGO@TiO2 NLPs modified electrode was decreased obviously (Figure 4A, curve b) compared with bare FTO electrode (Figure 4A, curve a). When SA were connected to the surface of nGO@TiO2 NLPs modified FTO electrode, the

electron transfer resistance increased significantly (Figure 4A, curve c), which was due to that protein could inhibit electron transfer. After reacted with MEA, the electron transfer resistance increased, since MEA could also suppress electron transfer on the electrode.19 When biotin-apta bonded with modified electrode, the result was similar to that of MEA. Since the negative charges of the phosphate backbone of DNA molecule hindered the transfer of the [Fe(CN)6]3-/4- redox pair on the electrode.20 Due to the poor conductivity of PVP, the electron transfer resistance of PVP modified FTO electrode increased remarkably (Figure 4A, curve f). However, when the modified electrode reacted with cTnI, the impedance value decreased. Pan and coworkers revealed that when singlestranded DNA bonded with the target sequence DNA, the charge transfer resistance reduced. This was ascribed to the hydrophilicity and rigidity of the DNA duplex that cause it to reside further from the electrode surface and facilitate the approach of negatively charged redox moieties to the interface.21 Accordingly, when biotin-apta bonded with cTnI, it might follow similar mechanism to decrease the impedance.

Figure 4. (A) EIS and (B) ECL intensity under CV obtained on (a) bare FTO electrode, (b) nGO@TiO2 /FTO electrode, (c) SA/nGO@TiO2/FTO electrode, (d) MEA/SA/nGO@TiO2/FTO electrode, (e) biotin-apta/MEA/SA/nGO@TiO2/FTO electrode, (f) PVP/biotin-apta/MEA/SA/nGO@TiO2/FTO electrode and (g) cTnI/PVP/biotin-apta/MEA/SA/nGO@TiO2/FTO. EIS experiment was conducted in PBS (0.1 mol/L, pH = 7.5) containing [Fe(CN)6]3−+[Fe(CN)6]4− (both 1.0×10−3 mol/L). ECL signals were measured in 0.02 mol/L PBS with 0.05 mol/L K2S2O8, PMT: -500 V.



Page 6 of 9

Table 1. A comparison of ECL aptasensor with some reported bioassays based on electrochemical method for the determination of cTnI. Linear range

Detection limit

（ng/mL）

（pg/mL）

cit-AuNPsa

0.2 –12.5

200

22

EIS

prGOb

0.1–10

70

23

FETsc

f-RGd

0.01–1

10

24

DPVe

AuNP-Hep-xGnPf

0.05–0.35

16

25

ECL

luminol-AuNPsg

0.1–1000

60

26

ECL

nGO@TiO2 NLPs

0.0023-2.3

0.91

This work

Analytical method

Sensing platform

Capacitance

Ref.

a

cit-AuNPs: Citrate-capped gold nanoparticles; b prGO: Mesoporous graphene oxide; c FETs: Feld-effect transistors d f-RG: Rebar graphene; e DPV: Differential pulse voltammetry f AuNP-Hep-xGnP: Exfoliated graphite nanoplatelets decorated with heparin-stabilized gold nanoparticle g luminol-AuNPs: Luminol functionalized gold nanoparticles.

Figure 4B displays the ECL emission of the modiﬁed electrode at each immobilization step. No ECL signals were observed on a bare FTO electrode (a). When nGO@TiO2 NLPs were assembled on the surface of an FTO electrode, two strong potential-resolved ECL signals were observed (b). When SA (c), MEA (d), biotin-apta (e) and PVP (f) were further assembled in sequence, it could be clearly observed that the intensity of ECL signal sequentially decreased. These were consistent with the results of ESI that the impedance on the electrodes increased successively, mainly due to the inhibition of electron transfer on the electrodes by these substances, resulting in the decreasing of ECL intensity. After the modified electrode reacted with cTnI, the ECL signals increased (g), which was consistent with the result of ESI. Therefore, the above results demonstrated that the ECL aptasensor was constructed successfully and could be used for the quantitative analysis of cTnI. Analytical performance of the ratiometric ECL aptasensor. Under the optimal condition (0.05 M K2S2O8, pH = 7.5, 40 minutes incubation time and 0.1 V/s scan rate; SI, section S8), the quantitative analysis performance of the obtained ratiometric ECL aptasensor was assessed by measuring the ratio of ECL-1 and ECL-2 with different concentrations of cTnI. As shown in Figure 5A, the intensities of ECL-1 (I1) and ECL-2 (I2) enhanced in the presence of cTnI compared with that in the absence of cTnI and the increased ratio of I1 and I2 was employed for the detection of cTnI. As shown in Figure 5B, the value of Δ(I1/I2) linearly depended on the logarithm of cTnI concentration in the range of 1.0×10-13 1.0×10-10 mol/L. The regression equation was Δ(I1/I2) = 3.08+0.23×log C (unit of C is mol/L) with the R of 0.996. Δ(I1/I2) was the relative ECL intensity ratio calculated by I1/I2I10/I20, the value of I1/I2 and I10/I20 were the ECL intensity ratio in the presence and absence of cTnI, respectively. The detection limit calculated by the reference with a signal-tonoise ratio of 3 was 4.0×10-14 mol/L.27,28 The relative standard deviation (R.S.D.) of seven replicate detections of cTnI at 1.0×10-11 mol/L was 3.14 % in one day (intra-day precision, n = 7) and 4.63 % in 7 days (inter-day precision, n = 7), indicating that the ECL aptasensor had good reproducibility. In addition, the ratiometric ECL aptasensor was compared

with other electrochemical bioassays for the detection of cTnI is list in Table 1. The results show that the sensitivity of developed aptasensor is superior to the most reported electrochemical bioassays. Moreover, the aptasensor in this work is constructed based on the ratiometric strategy and the analytical result would be more accurate than the reported electrochemical detection methods.

Figure 5. (A) IECL–E curves of aptasensor in the presence and absence of cTnI. (B) Linear relationship between ECL ratio and logarithm of cTnI concentration. Inset shows a comparison of ECL responses of cTnI (f) with different interfering species, including (a) hFABP, (b) copeptin, (c) hIgG, (d) BSA, (e) HSA and (g) mixture of hFABP, copeptin, hIgG, BSA, HSA and cTnI. cTnI concentration: 1.0 ×10-11 mol/L, interfering species: 1.0 × 10-10 mol/L.

Selectivity of the ratiometric ECL aptasensor. The developed aptasensor was considered to be specific toward determination of cTnI as the aptasensing was based on aptamer-target recognition. Accordingly, five interferents including hFABP, copeptin, hIgG, BSA and HSA were used for the aptasensor instead of cTnI in order to study the selectivity of cTnI aptasensor (Inset of Figure 5B). Among them, FABP and copeptin are also important biomarkers of AMI.29,30 The concentration of the interferents was 10 times that of cTnI. The results showed that cTnI had high Δ(I1/I2) value, whereas other interferents including FABP, copeptin, hIgG, BSA and HSA showed very low Δ(I1/I2) values. The ECL ratio response from the mixture of cTnI with FABP, copeptin, hIgG, BSA and HSA was also studied. And the result was close to that of cTnI. The above results demonstrated that the proposed aptasensor


Page 7 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry Table 2. The recovery of cTnI in healthy human serum samples using the proposed ECL aptasensora.

aMean

Sample

cTnI added（pmol/L）

Total cTnI detected（pmol/L）

R.S.D.（%）

1

0.1

0.099±0.002

99

2

1.0

1.08±0.01

108

3

10.0

10.4±0.4

104

value ± SD of three independent experiments, n = 3.

Table 3. Quantitative determination of cTnI in AMI patient serum samplesa.

aMean

Sample

ECL aptasensor（pmol/L）

1 2 3

ELISA（pmol/L）

R.S.D.（%）

4.82±0.37

4.4

9.79

55.8±2.61

54.3

2.73

59.8±3.46

57.8

3.37

value ± SD of three independent experiments, n = 3.

had good anti-interference and self-calibrating abilities for the detection of cTnI. Detection of cTnI in human serum samples. The obtained aptasensor was used to quantitatively analyze cTnI in real human serum samples to further study the practicability of the aptasensor. The serum samples were collected and pretreated according to the previous work.12 The recovery results obtained from the developed aptasensor is shown in Table 2. The good recoveries (99%-108%) revealed that the matrices in serum sample did not affect the determination of cTnI. The accuracy for the proposed ECL aptasensor was examined by comparing the results obtained by the enzyme-linked immunosorbent assay (ELISA). As shown in Table 3, the amount of three AMI patient serum samples obtained by the proposed ECL method were in good agreement with that detected by ELISA method and the R.S.D. was within 10%. And the aptasensor does not need labeling procedure. It is simpler and faster than that of ELISA method based on labeling technique. This ECL aptasensor may find future applications in accurate and rapid detection of cTnI with AMI patients.

specific and rapid detection of cTnI, which is of great significance for the early diagnosis and therapy of AMI patients. The developed strategy might be extended to detect other protein biomarkers by using corresponding antibodies or aptamers as recognition elements.

CONCLUSIONS

Corresponding Author

A new ‘one-pot’ hydrothermal method has been developed to synthesize nGO@TiO2 NLPs. The prepared nGO@TiO2 NLPs demonstrated potential-resolved ECL property in neutral K2S2O8 solution when negative potential was scanned. ECL-1 and ECL-2 were observed at peak potential of -1.27 V and -1.85 V, corresponding to the ECL emission of TiO2 and nGO moiety of nGO@TiO2 NLPs, respectively. It was suggested that ECL-1 was due to that the formed SO4•− through chemical conversion and electro-reduction of S2O82− injected h+ into the valence band of TiO2 of nGO@TiO2 NLPs, which recombined with electrons in the conduction band, generating the light emission. ECL-2 was owing to that the electro-reduced nGO reacted with SO4•−. Based on the intensity ratio of ECL-1 and ECL-2, a label-free ratiometric ECL aptasensor was established for the determination of AMI biomarker cTnI. For quantitative determination of cTnI, the linear range was 1.0×10-13 ~ 1.0×10-10 mol/L, detection limit was 4.0×10-14 mol/L. This aptasensor was superior to most reported electrochemical methods for the detection of cTnI. It could meet the detection requirements of cTnI in AMI patient serum. Moreover, the developed ratiometric ECL aptasensor is simple, fast and the detection is conducted in the neutral aqueous solution. It is promising for accurate, sensitive,

ASSOCIATED CONTENT Supporting Information Additional information as noted in text (S1. Apparatus, S2. Preparation of nGO, S3. Characterization of nGO, TiO2 and nGO@TiO2 NLPs, S4. ECL measurements, S5. Effect of airsaturated, O2 and N2 atmosphere on ECL intensity of nGO@TiO2 NLPs, S6. Effect of K2S2O8 on ECL intensity of nGO@TiO2 NLPs, S7. Stability of nGO@TiO2 NLPs, S8. Optimization of experimental conditions for the detection of cTnI. The Supporting Information is available free of charge on the ACS Publications website.

AUTHOR INFORMATION * Fax: +86-551-63600730. E-mail: [email protected]

ORCID Hua Cui: 0000-0003-4769-9464

Author Contributions ⊥Zhili Han and Jiangnan Shu are co-first authors and contributed equally to this work. The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript.

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT The support of this research by the National Key Research and Development Program of China (Grant No. 2016YFA0201300) and the National Natural Science Foundation of China (Grant Nos. 21874122, 21527807 and 21475120) are gratefully acknowledged.

REFERENCE (1) Hu, L.; Xu, G. Applications and Trends in Electrochemiluminescence. Chem. Soc. Rev. 2010, 39, 3275-3304.

ACS Paragon Plus Environment

7


(2) Kurita, R.; Arai, K.; Nakamoto, K.; Kato, D.; Niwa, O. Determination of DNA Methylation Using Electrochemiluminescence with Surface Accumulable Coreactant. Anal. Chem. 2012, 84, 17991803. (3) Liu, J. L.; Tang, Z. L.; Zhang, J. Q.; Chai, Y. Q.; Zhuo, Y.; Yuan, R. Morphology-Controlled 9, 10-Diphenylanthracene Nanoblocks as Electrochemiluminescence Emitters for MicroRNA Detection with One-step DNA Walker Amplification. Anal. Chem. 2018, 90, 5298-5305. (4) Babamiri, B.; Hallaj, R.; Salimi, A. Ultrasensitive Electrochemiluminescence Immunoassay for Simultaneous Determination of CA125 and CA15-3 Tumor Markers Based on PAMAM-sulfanilic Acid-Ru(bpy)32+ and PAMAM-CdTe@CdS Nanocomposite. Biosens. Bioelectron. 2017, 99, 353-360. (5) Wu, M. S.; Qian, G. S.; Xu, J. J.; Chen, H. Y. Electrochemiluminescence Detection of c-Myc mRNA in Breast Cancer Cells on a Wireless Bipolar Electrode. Anal. Chem. 2013, 84, 5407-5414. (6) Wu, P.; Hou, X.; Xu, J. J.; Chen, H. Y. Ratiometric Fluorescence, Electrochemiluminescence, and Photoelectrochemical Chemo/Biosensing Based on Semiconductor Quantum Dots. Nanoscale 2016, 8, 8427-8442. (7) Xiangqin, L.; Yugang, S.; Cui, H. Potential-resolved Electrochemiluminescence of Luminol in Alkaline Solutions at Glassy Carbon and Platinum Electrodes. Chinese Journal of Analytical Chemistry 1999, 5. 497-503. (8) Zhang, H. R.; Xu, J. J.; Chen, H. Y. Electrochemiluminescence Ratiometry: A New Approach to DNA Biosensing. Anal. Chem. 2013, 85, 5321-5325. (9) Huang, Y.; Lei, J.; Cheng, Y.; Ju, H. Ratiometric Electrochemiluminescent Strategy Regulated by Electrocatalysis of Palladium Nanocluster for Immunosensing. Biosens. Bioelectron. 2016, 77, 733-739. (10) Shao, K.; Wang, B.; Ye, S.; Zuo, Y.; Wu, L.; Li, Q.; Lu, Z.; Tan, X.; Han, H. Signal-amplified Near-infrared Ratiometric Electrochemiluminescence Aptasensor Based on Multiple Quenching and Enhancement Effect of Graphene/Gold Nanorods/G-Quadruplex. Anal. Chem. 2016, 88, 8179-8187. (11) Gao, L.; Ju, L.; Cui, H. Chemiluminescent and Fluorescent Dual-signal Graphene Quantum Dots and Their Application in Pesticide Sensing Arrays. J. Mater. Chem. C 2017, 5, 7753-7758. (12) Han, Z. L.; Shu, J. N.; Jiang, Q. S.; Cui, H. Coreactant-free and Label-free Eletrochemiluminescence Immunosensor for Copeptin Based on Luminescent Immuno-gold Nanoassemblies. Anal. Chem. 2018, 90, 6064-6070. (13) Shu, J. N.; Han, Z. L.; Zheng, T. H.; Du, D. X.; Zou, G. Z.; Cui, H. Potential-Resolved Multicolor Electrochemiluminescence of N -(4-Aminobutyl)-N -ethylisoluminol/tetra(4carboxyphenyl)porphyrin/TiO2 Nanoluminophores. Anal. Chem. 2017, 89, 12636−12640. (14) Xu, J.; Li, L.; Yan, Y.; Wang, H.; Wang, X.; Fu, X.; Li, G. Synthesis and Photoluminescence of Well-Dispersible Anatase TiO2 Nanoparticles. J. Colloid Interface Sci. 2008, 318, 29-34. (15) Sher Shah, M. S.; Park, A. R.; Zhang, K.; Park, J. H.; Yoo, P. J. Green Synthesis of Biphasic TiO2-Reduced Graphene Oxide Nanocomposites with Highly Enhanced Photocatalytic Activity. ACS Appl. Mater. Interfaces 2012, 4, 3983-3901. (16) Kudin, K. N.; Ozbas, B.; Schniepp, H. C.; Prud'Homme, R. K.; Aksay, I. A.; Car, R. Raman Spectra of Graphite Oxide and Functionalized Graphene Sheets. Nano Lett. 2008, 8, 36-41. (17) Dong, F.; Guo, S.; Wang, H.; Li, X.; Wu, Z. Enhancement of the Visible Light Photocatalytic Activity of C-Doped TiO2 Nanomaterials Prepared by a Green Synthetic Approach. J. Phys. Chem. C 2011, 115, 13285-13292. (18) Dai, P. P.; Yu, T.; Shi, H.-W.; Xu, J. J.; Chen, H. Y. General Strategy for Enhancing Electrochemiluminescence of Semiconductor Nanocrystals by Hydrogen Peroxide and Potassium Persulfate as Dual Coreactants. Anal. Chem. 2015, 87, 12372-12379. (19) Liang, G.; Man, Y.; Jin, X.; Pan, L.; Liu, X. Aptamer-based Biosensor for Label-free Detection of Ethanolamine by Electrochemical Impedance Spectroscopy. Anal. Chim. Acta 2016, 936, 222-228.

Page 8 of 9

(20) Hu, Y.; Wang, K.; Zhang, Q.; Li, F.; Wu, T.; Niu, L. Decorated Graphene Sheets for Label-free DNA Impedance Biosensing. Biomaterials 2012, 33, 1097-1106. (21) Pan, S.; Rothberg, L. Chemical Control of Electrode Functionalization for Detection of DNA Hybridization by Electrochemical Impedance Spectroscopy. Langmuir 2005, 21, 10221027. (22) Bhalla, V.; Carrara, S.; Sharma, P.; Nangia, Y.; Suri, C. R. Gold Nanoparticles Mediated Label-free Capacitance Detection of Cardiac Troponin I. Sens. Actuators, B 2012, 161, 761-768. (23) Kazemi, S. H.; Ghodsi, E.; Abdollahi, S.; Nadri, S. Porous Graphene Oxide Nanostructure as an Excellent Scaffold for Labelfree Electrochemical Biosensor: Detection of Cardiac Troponin I. Mater. Sci. Eng., C 2016, 69, 447-452. (24) Tuteja, S. K.; Sabherwal, P.; Deep, A.; Rastogi, R.; Paul, A. K.; Suri, C. R. Biofunctionalized Rebar Graphene (F-Rg) for LabelFree Detection of Cardiac Marker Troponin I. ACS Appl. Mater. Interfaces 2014, 6, 14767-14771. (25) Zanato, N.; Talamini, L.; Zapp, E.; Brondani, D.; Vieira, I. C. Label-Free Electrochemical Immunosensor for Cardiac Troponin T Based on Exfoliated Graphite Nanoplatelets Decorated with Gold Nanoparticles. Electroanalysis 2017, 29. (26) Li, F.; Yu, Y.; Cui, H.; Yang, D.; Bian, Z. Label-Free Electrochemiluminescence Immunosensor for Cardiac Troponin I Using Luminol Functionalized Gold Nanoparticles as a Sensing Platform. Analyst 2013, 138, 1844-1850. (27) Long, G. L.; Winefordner, J. D. Limit of Detection. A Closer Look at the IUPAC Definition. Anal. Chem., 1983, 55, 712A-724A. (28) Shrivastava, A.; Gupta, V. B. Methods for the Determination of Limit of Detection and Limit of Quantitation of the Analytical Methods. Chron. Young Sci., 2011, 2, 21-25. (29) Gami, B. N.; Patel, D. S.; Haridas, N.; Chauhan, K. P.; Shah, H.; Trivedi, A. Utility of Heart-Type Fatty Acid Binding Protein as a New Biochemical Marker for the Early Diagnosis of Acute Coronary Syndrome. J. Clin. Diagn. Res. 2015, 9, BC22-BC24. (30) Mueller, C.; Möckel, M.; Giannitsis, E.; Huber, K.; Mair, J.; Plebani, M.; Thygesen, K.; Jaffe, A. S.; Lindahl, B. Use of Copeptin for Rapid Rule-out of Acute Myocardial Infarction. Eur. Heart J.: Acute Cardiovascular Care 2018, 7, 570-576.


8

Page 9 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry For Table of Contents Only


9

Label-free Ratiometric Electrochemiluminescence Aptasensor

Recommend Documents