Lauric Acid Stimulates Mammary Gland Development of Pubertal Mice

Dec 16, 2016 - ABSTRACT: It has been demonstrated that dietary fat affects pubertal mammary gland development. However, the role of lauric acid (LA) i...
8 downloads 0 Views 7MB Size
Download PDF
Article pubs.acs.org/JAFC

Lauric Acid Stimulates Mammary Gland Development of Pubertal Mice through Activation of GPR84 and PI3K/Akt Signaling Pathway Yingying Meng,†,‡ Jing Zhang,†,‡ Fenglin Zhang,†,‡ Wei Ai,†,‡ Xiaotong Zhu,†,‡ Gang Shu,†,‡ Lina Wang,†,‡ Ping Gao,†,‡ Qianyun Xi,†,‡ Yongliang Zhang,†,‡ Xingwei Liang,§ Qingyan Jiang,*,†,‡ and Songbo Wang*,†,‡ †

College of Animal Science and National Engineering Research Center for Breeding Swine Industry, South China Agricultural University, Guangzhou 510642, P. R. China ‡ ALLTECH-SCAU Animal Nutrition Control Research Alliance, South China Agricultural University, Guangzhou 510642, P. R. China § State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Guangxi High Education Laboratory for Animal Reproduction and Biotechnology, Guangxi University, Nanning 530004, P. R. China ABSTRACT: It has been demonstrated that dietary fat affects pubertal mammary gland development. However, the role of lauric acid (LA) in this process remains unclear. Thus, this study aimed to investigate the effects of LA on mammary gland development in pubertal mice and to explore the underlying mechanism. In vitro, 100 μM LA significantly promoted proliferation of mouse mammary epithelial cell line HC11 by regulating expression of proliferative markers (cyclin D1/3, p21, PCNA). Meanwhile, LA activated the G protein-coupled receptor 84 (GPR84) and PI3K/Akt signaling pathway. In agreement, dietary 1% LA enhanced mammary duct development, increased the expression of GPR84 and cyclin D1, and activated PI3K/Akt in mammary gland of pubertal mice. Furthermore, knockdown of GPR84 or inhibition of PI3K/Akt totally abolished the promotion of HC11 proliferation induced by LA. These results showed that LA stimulated mammary gland development of pubertal mice through activation of GPR84 and PI3K/Akt signaling pathway. KEYWORDS: lauric acid, mammary gland development, GPR84, PI3K/Akt, pubertal mice

■

INTRODUCTION

medium-chain fatty acids (MCFA) in the development of pubertal mammary gland remains sparely studied. Lauric acid (LA), a saturated MCFA with a 12-carbon atom chain, is the primary fatty acid of coconut oil, with the presence of approximately 45−53%.11 Therefore, the metabolic and physiological properties of LA account for many of the properties of coconut oil, which has been considered as a healthy oil, with beneficial effects on reducing cardiovascular risk factor12,13 and decreasing body weight and body fat accumulation.14,15 In addition, it has been reported that virgin coconut oil consumption during chemotherapy helps to improve the functional status and global quality of life of breast cancer patients.16 Thus, LA-rich medium-chain triglycerides can substitute for the other oils in diet and may have limited pathogenicity.17 It has been demonstrated that LA exerts an inhibitory effect on bacterial growth and influences morphological structure and immune response of IPEC-J2 cells.18 Furthermore, LA prevents testosterone induced prostatic hyperplasia in rats.19 It has been shown that LA strongly activates the G protein-coupled receptor 84 (GPR84),20,21 which has been proposed in regulation of immune response22 and MCFA taste transduction.23

The mammary gland distinguishes mammals from all other animals with its unique anatomical structure that secretes milk for the growth, development, and health of mammalian neonates.1 Mammary gland development occurs through several distinct stages, including embryo, puberty, pregnancy, lactation, and involution.2,3 It has been implicated that pubertal inhibition of mammary gland development leads to impaired development and lactation in the subsequent stages.4,5 Thus, ensuring the optimal pubertal development of the mammary gland will contribute to its subsequent normal structure and function, and the nourishment of the newborns. Pubertal mammary gland development is influenced by hormones such as growth hormone (GH) and estrogen, as well as the growth factor, insulin-like growth factor-1 (IGF-1).6 These factors stimulate the formation of terminal end buds (TEBs) and ductal branching via inducing epithelial cell proliferation through activation of the PI3K/Akt signaling pathway.3,7 Besides hormones and growth factors, pubertal mammary gland development is also affected by nutrition.1,8 It has been reported that high fat diet results in stunted mammary duct elongation and reduced mammary epithelial cell proliferation in the mammary gland of pubertal C57BL/6 mice.9 In addition, it has been shown that long-chain fatty acids such as n-3 polyunsaturated fatty acids (PUFA) and n-6 PUFA play important roles in the morphological development of the mammary gland during puberty.10 However, the role of © XXXX American Chemical Society

Received: Revised: Accepted: Published: A

November 1, 2016 December 15, 2016 December 15, 2016 December 16, 2016 DOI: 10.1021/acs.jafc.6b04878 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

rapidly isolated and weighed. The left side of the fourth pair of mammary glands was fixed for whole mount or HE staining. The right side of the fourth pair of mammary glands was frozen in liquid nitrogen and stored at −80 °C until further analyses. All animal experiments and care procedures were conducted with the permission number of SYXK (Guangdong) 2014-0136 and performed in accordance with the guidelines for the care and use of animals approved by The Animal Ethics Committee of South China Agricultural University. Whole Mount and Hematoxylin and Eosin (HE) Staining. For whole mount staining, the isolated left side of the fourth pair of mammary glands was mounted on glass slides, fixed overnight in Carnoy’s Fixative, rinsed in 70% ethanol, and then stained with carmine alum (2 g/L) for 4 h at 4 °C. The slides were rinsed in a graded series of ethanol and cleared in xylene. For HE staining, paraffin-embedded mammary gland sections (5 μm thick) were prepared and stained with HE.24 Images were taken with a Nikon Eclipse Ti-s microscope (Nikon Instruments, Tokyo, Japan). Immunocytochemistry. The procedure of the immunocytochemistry was performed as previously described.25 Briefly, HC11 cells were fixed with 4% paraformaldehyde, permeabilized with 0.4% Triton X100, and then blocked with PBS containing 1% goat serum for 1 h at room temperature. The cells were then incubated with anti-mouse cyclin D1 or p21 antibody at 4 °C overnight. Thereafter, membranes were incubated with the appropriate FITC secondary antibody for 1 h at room temperature. The nuclei were revealed through DAPI staining for 15 min. The cells were observed and captured with a Nikon Eclipse Ti-s microscope, and the fluorescence intensity was quantified with Nis-Elements BR software (Nikon Instruments, Tokyo, Japan). MTT Assay and EdU Incorporation Assay. After the HC11 cells were cultured with LA for 4 days, the proliferation of HC11 was assessed by using MTT Cell Proliferation and Cytotoxicity Assay Kit and Cell-Light EdU imaging detecting kit according to the manufacturer’s instructions. Briefly, for MTT assay, the HC11 cells were incubated at 37 °C with 10 μL of MTT (5 mg/mL) in each well for 4 h, and then incubated at 37 °C with 100 μL of Formazan lysate for 4 h. The number of viable cells was assessed by measuring the absorbance at 570 nm using a Synergy 2 Multi-Mode Reader (Bio Tek Instruments, Inc., Winooski, VT, USA). For EdU incorporation assay, HC11 were incubated with 50 μM EdU for 2 h. After washing with PBS 3 times, the cells were fixed with 4% paraformaldehyde for 30 min at room temperature, and then stained with Apollo staining reaction solution and Hoechst 33342 reaction mixture in the dark at room temperature for 30 min. The cells were captured with a Nikon Eclipse Ti-s microscope (Nikon Instruments, Tokyo, Japan). The proliferation rate of the HC11 was calculated as the percentage of EdU-positive nuclei to total nuclei in five high-power fields per well. Quantification of Intracellular cAMP. After the HC11 cells were cultured with LA for 4 days, the intracellular cAMP level was measured according to the instructions of the cAMP Direct Immunoassay Kit. Western Blot Analysis. After the HC11 cells were cultured with various treatments for 4 days, the protein was extracted and Western blot analysis was conducted as previously described.26 Primary antibodies used include cyclin D1 (1:2000), p21 (1:2000), GPR84 (1:500), Akt (1:2000), p-AktSer473 (1:2000), PI3K (1:2000), pPI3KTyr508 (1:800), and β-actin (1:1000). Densitometry analysis was perform using image J software, and band density was normalized to the β-actin. Real-Time Quantitative PCR. After the HC11 cells were cultured with various treatments for 4 days, the mRNA expression of cyclin D1, cyclin D3, and PCNA were examined by real-time quantitative PCR as previously described.27 Briefly, total RNA was extracted from the HC11 cells by using an RNA extraction kit (Guangzhou Magen Biotechnology Co., Ltd., Guangdong, China) according to the manufacturer’s protocol and cDNA was synthesized from 2 μg of total RNA by the M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) and random primers oligo-dT18 according to the manufacturer’s instructions. β-Actin was used as a candidate housekeeping gene. Real-time quantitative PCR was carried out in an Mx3005p instrument (Stratagene, La Jolla, CA, USA) by using

However, to our knowledge, there is no reference in the literature to the role of LA in pubertal mammary gland development. Thus, the present study was designed to investigate the effects of LA on mammary gland development and HC11 proliferation. In addition, we sought to explore the underlying mechanism in this process, including the contribution of GPR84 and the related intracellular signaling pathway. Our data showed that LA stimulated mammary gland development of pubertal mice through activation of GPR84 and the PI3K/Akt signaling pathway.

■

MATERIALS AND METHODS

Chemicals and Antibodies. Lauric acid (LA) used in the in vitro study was purchased from Sigma-Aldrich (St. Louis, MO, USA). LA used in the in vivo study was purchased from Chengdu Chemical Technology Co., Ltd. (Chengdu, Sichuan, China). PI3K/Akt inhibitor wortmannin (WT) and MTT assay kit was purchased from Beyotime Biotechnology Inc. (Shanghai, China). RPMI-1640 medium and fetal bovine serum (FBS) were purchased from Gibco BRL (Gaithersburg, MD, USA). DAPI was purchased from Biosharp (Hefei, Anhui, China). 5-Ethynyl-2′-deoxyuridine (EdU) incorporation assay kit was purchased from Ribobio Biological Technology Co., Ltd. (Guangzhou, Guangdong, China). cAMP immunoassay kit was purchased from BioVision Inc. (Milpitas, CA, USA). GPR84 siRNA was purchased from Suzhou Zimmer Genomics Technology Co., Ltd. (Suzhou, Jiangshu, China). Lipofectamine 2000 was purchased from Life Technologies (Carlsbad, CA, USA). Polyclonal antibodies against cyclin D1, p21, phospho-AktSer473 (p-AktSer473), and Akt were purchased from Cell Signaling Technology Inc. (Danvers, MA, USA). Polyclonal antibodies against GPR84, β-actin and PI3K were purchased from Beijing Bioss Biotechnology Co., Ltd. (Beijing, China). Polyclonal antibody against phospho-PI3KTyr508 (p-PI3KTyr508) was purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). The related secondary antibodies were purchased from Bioworld Technology, Inc. (St. Louis Park, MN, USA). Cell Culture and Treatment. The mouse mammary epithelial cell line HC11 (Action-award Biological Technology Co., Ltd., Guangzhou, Guangdong, China) was seeded at a density of 25,000 cell/cm2 and cultured in RPMI-1640 medium supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin in the presence of various concentrations (0, 10, 50, 100, and 200 μM) of LA for 4 days to investigate the dose effect of LA. Meanwhile, the HC11 cells transfected with GPR84 siRNA were incubated with or without 100 μM LA for 4 days to study the role of GPR84 in LA-mediated HC11 proliferation. In addition, the cells were cultured with 100 μM LA and/ or PI3K inhibitor wortmannin (WT) for 4 days to explore the role of PI3K/Akt signaling pathway in LA-mediated HC11 proliferation. The medium was changed every 2 days. Transfection of HC11 with siRNA. The HC11 mouse mammary epithelial cells were transfected with 4 pmol of siRNA specific for GPR84 or scrambled siRNA using Lipofectamine 2000 for 6 h according to the manufacturer’s instructions. Subsequently, the cells were treated with LA for 2 d. Then, the cells were transfected (6 h) and incubated with LA (2 d) once again. The knockdown efficiency of GPR84 was confirmed by Western blot. Animals and in Vivo Study. Twenty C57BL/6 female mice (3 weeks old) purchased from Guangdong Medical Laboratory Animal Center were acclimated for 1 week and then randomly divided into 2 groups: a control group, which was fed a control diet; and a lauric acid (LA) group, which was fed a control diet containing 1% (w/w) LA. The mice were housed in environmentally controlled rooms on a 12 h light−dark cycle with free access to food and water. The body weight and food intake were recorded weekly. At the end of 5 weeks of treatments, mice were anesthetized by carbon dioxide. The blood was collected and incubated at 37 °C for 1 h and then centrifuged at 1500g for 20 min. Then the serum was collected and stored at −20 °C for further determination of serum insulin-like growth factor-1 (IGF-1) and estradiol (E2) level. The fourth pair of mammary glands was B

DOI: 10.1021/acs.jafc.6b04878 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry Table 1. Primer Sequences Used for Real-Time Quantitative PCR gene

forward (5′−3′)

reverse (5′−3′)

amplification length (bp)

β-actin cyclin D1 cyclin D3 PCNA

GGTCATCACTATTGGCAACGAG CTGAAGGCTCGCGGAATAAAA CGAGCCTCCTACTTCCAGTG TTTGAGGCACGCCTGATCC

GAGGTCTTTACGGATGTCAACG GCAAGTTGTGGGCAGCAATA GGACAGGTAGCGATCCAGGT GGAGACGTGAGACGAGTCCAT

142 145 150 135

Figure 1. LA stimulated the proliferation of HC11 by regulating the expression of proliferative markers. (A) Effect of various concentrations of LA (0, 10, 50, 100, and 200 μM) on the proliferation of HC11 after 4-day culture was determined by MTT analysis. (B, F) Representative immunofluorescence staining of cyclin D1 (B) and p21 (F) in control and 100 μM LA group. The nuclei were stained with DAPI. Scale bar = 100 μm. (C, G) Analysis of the relative fluorescence intensity in panels B and F, respectively. (D) Western blot analysis of cyclin D1 and p21 in HC11 after 4-day culture. β-Actin was used as loading control. (E) Mean ± SEM of immunoblotting bands of cyclin D1 and p21; the intensities of the bands are expressed as arbitrary units (n = 3). *P < 0.05, **P < 0.01, and ***P < 0.001 versus 0 μM LA group (control).

Figure 2. LA activated the G protein-coupled receptor 84 (GPR84). (A) Western blot analysis of GPR84 in HC11 after 4-day culture. β-Actin was used as loading control. (B) Mean ± SEM of immunoblotting bands of GPR84; the intensities of the bands are expressed as arbitrary units (n = 3). (C) Intracellular cAMP level in HC11 after 4-day culture. **P < 0.01 versus control group, ##P < 0.01 versus 100 μM LA group. SYBR Green Real-time PCR Master Mix reagents (Toyobo Co., Ltd., Osaka, Japan) and both sense and antisense primers (200 nM for each

gene). Primer sequences (with their respective PCR fragment lengths) are shown in Table 1. C

DOI: 10.1021/acs.jafc.6b04878 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 3. Knockdown of GPR84 eliminated the enhancement of HC11 proliferation induced by LA. (A, B) Effects of 100 μM LA and/or GPR84 siRNA on HC11proliferation by using MTT analysis (A) and EdU incorporation assay (B). The nuclei were stained with Hoechst, and the scale bar = 100 μm. (C) Analysis of EdU positive cell percentage in panel B. (D) The relative mRNA expression level of cyclin D1, cyclin D3, and PCNA in response to 100 μM LA and/or GPR84 siRNA. (E) Western blot analysis of GPR84, cyclin D1, and p21 in HC11 after 4-day culture. β-Actin was used as loading control. (F) Mean ± SEM of immunoblotting bands of GPR84, cyclin D1, and p21. The intensities of the bands are expressed as arbitrary units (n = 4). *P < 0.05, **P < 0.01 versus control group, ##P < 0.01 versus 100 μM LA group. Statistical Analysis. All data are presented as means ± standard error of the mean (SEM). In the mouse feeding trial, an individual animal was considered as an experimental unit and ten mice in each group were used. For cell culture studies, three independent experiments were conducted with at least 3 parallel measurements in each experiment. Statistical analysis was performed using SigmaPlot 12.5 (Systat Software, Inc., San Jose, CA, USA). Differences between means were determined using Student’s t-test, and a confidence level of P < 0.05 was statistically significant.

LA Activated the G Protein-Coupled Receptor 84 (GPR84). To determine whether GPR84 was associated with LA-stimulated HC11 proliferation, we examined the effects of LA on the expression and activation of GPR84. We found that 100 μM LA markedly (P < 0.01) increased the protein expression of GPR84 (Figure 2A,B). In addition, 100 μM LA resulted in a significant (P < 0.01) reduction of intracellular cAMP level (Figure 2C), indicating the activation of GPR84 in response to LA. Furthermore, the decreased cAMP content was reversed by knockdown of GPR84 with its siRNA (Figure 2C). The similar pattern between promoted HC11 proliferation and enhanced GPR84 expression and activation implied that GPR84 might be involved in LA-stimulated HC11 proliferation. Knockdown of GPR84 Eliminated the Enhancement of HC11 Proliferation Induced by LA. To further elucidate the role of GPR84 in LA-stimulated HC11 proliferation, GPR84 siRNA was used to knock down the expression of GPR84 in the present study. As shown in Figure 3E,F, GPR84 siRNA indeed significantly (P < 0.01) decreased protein expression of GPR84. GPR84 siRNA alone had no effect on HC11 proliferation. However, GPR84 siRNA abolished the promotion of HC11 proliferation induced by 100 μM LA (Figure 3A). Meanwhile, by using EdU incorporation assay, we found that the elevated percentage of cells undergoing DNA replication induced by LA was reversed by GPR84 siRNA (Figure 3B,C). In addition, 100 μM LA significantly (P < 0.01) increased the mRNA expression level of proliferative markers, including cyclin D1, cyclin D3, and PCNA. However, the elevated mRNA expression of proliferative markers was abolished by GPR84 siRNA (Figure 3D). Similarly, the increased protein expression of cyclin D1 and the decreased protein level of p21 induced by 100 μM LA

■

RESULTS LA Stimulated the Proliferation of HC11 by Regulating the Expression of Proliferative Markers. To assess the effect of LA on the proliferation of HC11, the cells were incubated in RPMI-1640 supplemented with various concentrations (0, 10, 50, 100, and 200 μM) of LA for 4 days. LA significantly stimulated HC11 proliferation in a dose-dependent manner, with the similar promotive effects observed at 100 and 200 μM LA (Figure 1A). Thus, 100 μM LA was selected and used in the subsequent studies. Meanwhile, EdU incorporation assay was performed to detect the effects of 100 μM LA on the percentage of cells undergoing DNA replication. We found that the percentage of EdU positive cell was dramatically (P < 0.01) elevated by LA (Figure 3B,C). In addition, by using immunofluorescence staining of proliferative markers such as cyclin D1 and p21, we observed that LA significantly (P < 0.01) stimulated the expression of cyclin D1 (Figure 1B,C) and suppressed the expression of p21 (Figure 1F,G). Consistently, the protein expression of cyclin D1 and p21 was respectively increased and decreased by LA (Figure 1D,E). These data showed that LA stimulated the proliferation of HC11 by modulating the expression of proliferative markers. D

DOI: 10.1021/acs.jafc.6b04878 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 4. LA activated the PI3K/Akt signaling pathway. (A) Western blot analysis of p-PI3K, PI3K, p-Akt, and Akt in HC11 after 4-day culture in the presence of LA and/or GPR84 siRNA. β-Actin was used as loading control. (B) Mean ± SEM of immunoblotting bands of p-PI3K/PI3K and pAkt/Akt; the intensities of the bands are expressed as arbitrary units (n = 4). **P < 0.01 versus control group, ##P < 0.01 versus 100 μM LA group.

Figure 5. Inhibition of PI3K/Akt totally blocked the promotion of HC11 proliferation induced by LA. (A) The effect of wortmannin (WT), an inhibitor of PI3K, on the proliferation of HC11 after 4-day incubation was determined by MTT assay (n = 8). (B) The relative mRNA expression level of cyclin D1 and cyclin D3 and PCNA in response to 100 μM LA and/or 100 nM WT. (C) Western blot analysis of p-PI3K, PI3K, p-Akt, Akt, cyclin D1, and p21 in HC11 after 4-day culture. β-Actin was used as loading control. (D) Mean ± SEM of immunoblotting bands of p-PI3K/PI3K, p-Akt/Akt, cyclin D1, and p21; the intensities of the bands are expressed as arbitrary units (n = 4). **P < 0.01 versus control group, ##P < 0.01 versus 100 μM LA group.

implying a link between GPR84 activation and PI3K/Akt activation. These results also suggested that the activation of GPR84 and the intracellular PI3K/Akt signaling pathway might be involved in LA-stimulated HC11 proliferation. Inhibition of PI3K/Akt Totally Blocked the Promotion of HC11 Proliferation Induced by LA. To further verify the role of PI3K/Akt signaling pathway in LA-stimulated cell proliferation of HC11, wortmannin (WT), a potent and selective inhibitor of PI3K, was applied to inhibit the activation of PI3K and thus to prevent the activation of Akt in this study. We found that the significant increase of p-PI3K/PI3K and pAkt/Akt ratio in response to 100 μM LA was reversed by 100 nM WT (Figure 5C,D). Although having no effect on the

were also eliminated by GPR84 siRNA (Figure 3E,F). These results demonstrated that GPR84 knockdown eliminated the promotive effects of LA on HC11 proliferation, thereby indicating the essential role of GPR84 in this process. LA Activated the PI3K/Akt Signaling Pathway. Besides the activation of membrane receptor GPR84, we further assessed the possible involvement of intracellular PI3K/Akt signaling pathway in LA-stimulated HC11 proliferation. We found that 100 μM LA led to a significantly (P < 0.01) increased ratio of the p-PI3K/PI3K and p-Akt/Akt, indicating the activation of the PI3K/Akt signaling pathway (Figure 4). Interestingly, the activation of the PI3K/Akt signaling pathway induced by LA was eliminated by GPR84 siRNA (Figure 4), E

DOI: 10.1021/acs.jafc.6b04878 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 6. Dietary supplementation of 1% LA enhanced the mammary ductal growth of pubertal mice. (A−C) Effects of dietary 1% LA on the body weight (A), average weekly food intake (B), and mammary gland index of the fourth pair (C). (D) Representative images of whole mount and H&E staining of the fourth pair of mammary glands of control and 1% LA treated pubertal mice. Arrows indicate the TEB and ductal branch, respectively. The scale bars are shown in the images. (E, F) Effects of dietary 1% LA on the number of TEBs (E) and the ductal branches (F) in the fourth pair of mammary glands of pubertal mice (n = 6). **P < 0.01 versus control group.

treated mice. By using whole mount staining, we found that the mammary gland size of 1% LA treated mice was bigger than that of control mice (Figure 6D). In addition, the mammary gland of 1% LA treated mice contained more terminal end buds (TEB) and more ductal branches (Figure 6D−F). Consistent with these observations, HE staining also showed that there were more ducts in the mammary gland of 1% LA group mice compared with control mice (Figure 6D). These results suggested that the mammary ductal growth was enhanced by dietary 1% LA in pubertal mice. Dietary 1% LA Increased Serum Level of IGF-1 and E2, Promoted Expression of GPR84 and Cyclin D1, and Activated the PI3K/Akt Pathway in the Mammary Gland of Pubertal Mice. We further explored the possible mechanism by which dietary LA enhanced mammary gland development. As shown in Figure 7A,B, the serum level of IGF1 and E2 was significantly elevated by dietary 1% LA. Meanwhile, we found that, consistent with the in vitro findings, dietary 1% LA promoted the expression of GPR84 (Figure 7). In addition, the phosphorylation levels of PI3K and Akt were

proliferation of HC11, WT totally blocked the promotion of HC11 proliferation induced by 100 μM LA (Figure 5A). In agreement, the significant increase in the mRNA levels of cyclin D1, cyclin D3, and PCNA induced by 100 μM LA was also abolished by WT (Figure 5B). Further, WT reversed the effects of LA on the protein expression of cyclin D1 and p21 (Figure 5C,D). These results strongly suggested that LA promoted HC11 proliferation through activation of PI3K/Akt signaling pathway. Dietary Supplementation of 1% LA Enhanced Mammary Ductal Growth of Pubertal Mice. To further determine whether LA could promote mammary gland development in vivo, 4-week-old mice were treated with control diet or control diet containing 1% LA for 5 weeks. The body weight (Figure 6A) and average weekly food intake (Figure 6B) were comparable between control and 1% LA treated mice. Although the mammary gland index (mg/g body weight) of the fourth pair was not significantly altered between the 1% LA treated and control mice (Figure 1C), noticeable morphological changes in mammary gland were observed in LA F

DOI: 10.1021/acs.jafc.6b04878 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry

Figure 7. Dietary supplementation of 1% LA increased the serum level of IGF-1 and E2, promoted the expression of GPR84 and cyclin D1, and activated the PI3K/Akt pathway in the fourth pair of mammary glands of pubertal mice. (A, B) Effects of dietary 1% LA on the serum level of IGF-1 (A) and E2 (B). (C) Western blot analysis of GPR84, p-PI3K, PI3K, p-Akt, Akt, and cyclin D1 in the mammary gland of pubertal mice. β-Actin was used as loading control. (D) Mean ± SEM of immunoblotting bands of GPR84, p-PI3K/PI3K, p-Akt/Akt, and cyclin D1; the intensities of the bands are expressed as arbitrary units (n = 4). **P < 0.01 versus control group.

various fatty acids or oils might elicit different effects on pubertal mammary gland development, depending on the different structures (length of chain, number and position of unsaturated double bond). In addition, it was reported that LA inhibited the viability of human neuroblastoma28 and induced apoptosis in Caco-2 and IEC-6 cells compared to butyrate.29 These discrepant effects of LA on cell proliferation might be attributed to the different cell types and culture conditions. The expression of proliferative markers such as cyclin D1/3, p21, and PCNA was detected to elucidate the stimulatory effects of LA on HC11 proliferation or mammary ductal growth. It has been demonstrated that cyclin D1 and p21 are involved in regulating the proliferation of mammary epithelial cell.7,30 In agreement, we found that LA increased the expression of cyclin D1/3 and PCNA, as well as decreased the expression of p21, the inhibitor of cyclin-dependent kinase. In addition, the percentage of S-phase cells revealed by EdU incorporation assay was also elevated by LA during HC11 proliferation. Moreover, the serum levels of E2 and IGF-1, which are involved in stimulating pubertal mammary gland development,3 were significantly increased by dietary LA. Thus, these findings showed that LA stimulated HC11 proliferation and mammary ductal growth by regulating the expression of proliferative markers and serum level of proliferative hormones (E2 and IGF-1). It has been shown that LA activates the MCFA receptor GPR84, which plays a pivotal role in metabolism,31 immune response,32 and taste transduction.23 In the present study, we observed an elevated expression of GPR84 in response to LA during HC11 proliferation. In addition, the significant reduction of intracellular cAMP level induced by LA further indicated the activation of GPR84. Furthermore, GPR84 knockdown with GPR84 siRNA reversed the LA-promoted

significantly increased by dietary 1% LA, indicating the activation of the PI3K/Akt signaling pathway (Figure 7). Moreover, the protein expression of proliferative marker cyclin D1 was also increased by dietary 1% LA (Figure 7). These results suggested that activation of GPR84 and the PI3K/Akt signaling pathway and subsequent increased expression of cyclin D1 might be involved in the enhanced mammary gland development induced by dietary 1% LA.

■

DISCUSSION In the present study, we determined that LA stimulated the mammary gland development of pubertal mice and HC11 proliferation by regulating the expression of proliferative markers through activation of plasma membrane receptor GPR84 and the intracellular PI3K/Akt signaling pathway. The development of pubertal mammary gland is mediated by various factors, including hormones, growth factors, and nutrition.1,3,7,8 It has been demonstrated that mice fed a diet containing n-3 PUFA for 4 weeks had more TEB and higher percent coverage of ductal tree compared to mice fed an n-6 PUFA enriched diet.10 With the similar effects to n-3 PUFA, we found that LA, a MCFA, stimulated the mammary ductal growth, with increased TEB number and ductal branch. In accordance, LA promoted the proliferation of mouse mammary epithelial cell HC11. Our data showed, for the first time, that LA, a MCFA, was involved in stimulating mammary gland development of pubertal mice. In contrast, pubertal exposure to high fat diet (11% kcal fat came from corn oil and 49% kcal fat come from lard) inhibited mammary duct elongation and reduced mammary epithelial cell proliferation.9 Meanwhile, the preliminary unpublished data of our ongoing study demonstrated that stearic acid inhibited, while oleic acid stimulated, the proliferation of HC11 cells. These results suggested that G

DOI: 10.1021/acs.jafc.6b04878 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry

■

proliferation of HC11, the increased percentage of EdU positive cells, the elevated expression of proliferative markers (cyclin D1/3 and PCNA), and decreased expression of p21. Together, these observations showed that LA-stimulated HC11 proliferation was mediated, at least in part, by activation of GPR84. Many studies have demonstrated that the activation of PI3K/ Akt signaling pathway is involved in regulating the proliferation of various cells, including muscle cell,33 fibroblast,34 cancer cell,35,36 stem cell,26 and mammary epithelia.37 In addition, it has been shown that the PI3K/Akt signaling pathway is involved in regulating mammary gland development.38,39 In line with the previous reports, we found that the PI3K/Akt signaling pathway was activated by LA during HC11 proliferation and the activation of PI3K/Akt was abolished by GPR84 knockdown. Meanwhile, consistent with the results of cell culture, dietary LA resulted in the activation of the PI3K/Akt signaling pathway in the mammary gland of pubertal mice. Moreover, the inhibition of PI3K/Akt signaling pathway with WT reversed the LA-induced stimulation of HC11 proliferation, increase of EdU positive cells, and alteration of proliferative markers expression. These results provided the evidence that LA stimulated HC11 proliferation and mammary ductal growth via activation of GPR84 and the linked intracellular PI3K/Akt signaling pathway. In conclusion, our findings demonstrated that LA stimulated HC11 proliferation and mammary ductal growth in association with activation of plasma membrane receptor GPR84 and intracellular PI3K/Akt signaling pathway. These results provided new insights into the nutritional regulation of pubertal mammary gland development by dietary medium-chain fatty acids (LA) and suggested the potential application of LA as a health food in promoting pubertal mammary gland development.

■

Article

REFERENCES

(1) Rezaei, R.; Wu, Z.; Hou, Y.; Bazer, F. W.; Wu, G. Amino acids and mammary gland development: nutritional implications for milk production and neonatal growth. J. Anim. Sci. Biotechnol. 2016, 7, 20. (2) Musumeci, G.; Castrogiovanni, P.; Szychlinska, M. A.; Aiello, F. C.; Vecchio, G. M.; Salvatorelli, L.; Magro, G.; Imbesi, R. Mammary gland: From embryogenesis to adult life. Acta Histochem. 2015, 117, 379−85. (3) Macias, H.; Hinck, L. Mammary gland development. Wiley Interdiscip Rev. Dev Biol. 2012, 1, 533−57. (4) Farmer, C.; Palin, M. F.; Martel-Kennes, Y. Impact of diet deprivation and subsequent over-allowance during prepuberty. Part 1. Effects on growth performance, metabolite status, and mammary gland development in gilts. J. Anim. Sci. 2012, 90, 863−71. (5) Kamikawa, A.; Ichii, O.; Yamaji, D.; Imao, T.; Suzuki, C.; Okamatsu-Ogura, Y.; Terao, A.; Kon, Y.; Kimura, K. Diet-induced obesity disrupts ductal development in the mammary glands of nonpregnant mice. Dev. Dyn. 2009, 238, 1092−9. (6) Brisken, C.; O’Malley, B. Hormone action in the mammary gland. Cold Spring Harbor Perspect. Biol. 2010, 2, a003178. (7) Tian, J.; Berton, T. R.; Shirley, S. H.; Lambertz, I.; GimenezConti, I. B.; DiGiovanni, J.; Korach, K. S.; Conti, C. J.; Fuchs-Young, R. Developmental stage determines estrogen receptor alpha expression and non-genomic mechanisms that control IGF-1 signaling and mammary proliferation in mice. J. Clin. Invest. 2012, 122, 192−204. (8) Farmer, C. Review: Mammary development in swine: effects of hormonal status, nutrition and management. Can. J. Anim. Sci. 2013, 93, 1−7. (9) Olson, L. K.; Tan, Y.; Zhao, Y.; Aupperlee, M. D.; Haslam, S. Z. Pubertal exposure to high fat diet causes mouse strain-dependent alterations in mammary gland development and estrogen responsiveness. Int. J. Obes. (Lond) 2010, 34, 1415−26. (10) Anderson, B. M.; MacLennan, M. B.; Hillyer, L. M.; Ma, D. W. Lifelong exposure to n-3 PUFA affects pubertal mammary gland development. Appl. Physiol., Nutr., Metab. 2014, 39, 699−706. (11) Dayrit, F. M. The Properties of Lauric Acid and Their Significance in Coconut Oil. J. Am. Oil Chem. Soc. 2015, 92, 1−15. (12) Kappally, S.; Shirwaikar, A.; Shirwaikar, A. COCONUT OIL−A REVIEW OF POTENTIAL APPLICATIONS. Hygeia. J. D. Med. 2015, 7, 34−41. (13) Eyres, L.; Eyres, M. F.; Chisholm, A.; Brown, R. C. Coconut oil consumption and cardiovascular risk factors in humans. Nutr. Rev. 2016, 74, 267−80. (14) Mumme, K.; Stonehouse, W. Effects of medium-chain triglycerides on weight loss and body composition: a meta-analysis of randomized controlled trials. J. Acad. Nutr. Diet. 2015, 115, 249−63. (15) Assuncao, M. L.; Ferreira, H. S.; dos Santos, A. F.; Cabral, C. R., Jr.; Florencio, T. M. Effects of dietary coconut oil on the biochemical and anthropometric profiles of women presenting abdominal obesity. Lipids 2009, 44, 593−601. (16) Law, K. S.; Azman, N.; Omar, E. A.; Musa, M. Y.; Yusoff, N. M.; Sulaiman, S. A.; Hussain, N. H. The effects of virgin coconut oil (VCO) as supplementation on quality of life (QOL) among breast cancer patients. Lipids Health Dis. 2014, 13, 139. (17) McCarty, M. F.; DiNicolantonio, J. J. Lauric acid-rich mediumchain triglycerides can substitute for other oils in cooking applications and may have limited pathogenicity. Open Heart 2016, 3, e000467. (18) Martinez-Vallespin, B.; Vahjen, W.; Zentek, J. Effects of medium-chain fatty acids on the structure and immune response of IPEC-J2 cells. Cytotechnology 2016, 68, 1925−36. (19) Veeresh Babu, S. V.; Veeresh, B.; Patil, A. A.; Warke, Y. B. Lauric acid and myristic acid prevent testosterone induced prostatic hyperplasia in rats. Eur. J. Pharmacol. 2010, 626, 262−5. (20) Miyamoto, J.; Hasegawa, S.; Kasubuchi, M.; Ichimura, A.; Nakajima, A.; Kimura, I. Nutritional Signaling via Free Fatty Acid Receptors. Int. J. Mol. Sci. 2016, 17, 450. (21) Wang, J. H.; Wu, X. S.; Simonavicius, N.; Tian, H.; Ling, L. Medium-chain fatty acids as ligands for orphan G protein-coupled receptor GPR84. J. Biol. Chem. 2006, 281, 34457−34464.

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. Tel/fax: +86 20 85284901. *E-mail: [email protected]. Tel/fax: +86 20 85284901. ORCID

Songbo Wang: 0000-0001-9190-9401 Funding

This work was supported by the National Key Research and Development Program of China (2016YFD0500503), National Natural Science Foundation of China (31672508, 31372397), and Guangdong special support program (2014TQ01N260). Notes

The authors declare no competing financial interest.

■

ABBREVIATIONS USED cAMP, cyclic adenosine monophosphate; EdU, 5-ethynyl-2′deoxyuridine; E2, estrogen; FBS, fetal bovine serum; GPR84, G protein-coupled receptor 84; HE, hematoxylin and eosin; HC11, HC11 mouse mammary epithelial cells; IGF-I, insulinlike growth factor 1; GH, growth hormone; LA, lauric acid; MCFA, medium-chain fatty acids; p21, cyclin-dependent protein kinase inhibitor 21; PUFA, polyunsaturated fatty acids; PBS, phosphate buffered saline; PCNA, proliferating cell nuclear antigen; PI3K, phosphatidylinositol 3-kinase; PKA, protein kinase A; Akt, protein kinase B; siRNA, small interfering RNA; TEBs, terminal end buds; WT, wortmannin H

DOI: 10.1021/acs.jafc.6b04878 J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Article

Journal of Agricultural and Food Chemistry (22) Alvarez-Curto, E.; Milligan, G. Metabolism meets immunity: The role of free fatty acid receptors in the immune system. Biochem. Pharmacol. 2016, 114, 3−13. (23) Liu, Y. The role of GPR84 in medium-chain saturated fatty acid taste transduction. Dissertation, Utah State University, 2016. (24) Cai, X.; Zhu, C.; Xu, Y.; Jing, Y.; Yuan, Y.; Wang, L.; Wang, S.; Zhu, X.; Gao, P.; Zhang, Y.; Jiang, Q.; Shu, G. Alpha-ketoglutarate promotes skeletal muscle hypertrophy and protein synthesis through Akt/mTOR signaling pathways. Sci. Rep. 2016, 6, 26802. (25) Jing, Y.; Cai, X.; Xu, Y.; Zhu, C.; Wang, L.; Wang, S.; Zhu, X.; Gao, P.; Zhang, Y.; Jiang, Q.; Shu, G. alpha-Lipoic Acids Promote the Protein Synthesis of C2C12 Myotubes by the TLR2/PI3K Signaling Pathway. J. Agric. Food Chem. 2016, 64, 1720−9. (26) Ye, J.; Ai, W.; Zhang, F.; Zhu, X.; Shu, G.; Wang, L.; Gao, P.; Xi, Q.; Zhang, Y.; Jiang, Q.; Wang, S. Enhanced Proliferation of Porcine Bone Marrow Mesenchymal Stem Cells Induced by Extracellular Calcium is Associated with the Activation of the Calcium-Sensing Receptor and ERK Signaling Pathway. Stem Cells Int. 2016, 2016, 6570671. (27) Wang, S.; Wang, G.; Zhang, M.; Zhuang, L.; Wan, X.; Xu, J.; Wang, L.; Zhu, X.; Gao, P.; Xi, Q.; Zhang, Y.; Shu, G.; Jiang, Q. The dipeptide Pro-Asp promotes IGF-1 secretion and expression in hepatocytes by enhancing JAK2/STAT5 signaling pathway. Mol. Cell. Endocrinol. 2016, 436, 204−210. (28) Amissah, F.; Taylor, S.; Duverna, R.; Lamango, N. S. Fatty Acid Suppression of Cell Proliferation is Associated with the Inhibition of Polyisoprenylated Methylated Protein Methyl Esterase. FASEB J. 2010, 24, 503.1. (29) Fauser, J. K.; Matthews, G. M.; Cummins, A. G.; Howarth, G. S. Induction of apoptosis by the medium-chain length fatty acid lauric acid in colon cancer cells due to induction of oxidative stress. Chemotherapy 2013, 59, 214−24. (30) Balasenthil, S.; Sahin, A. A.; Barnes, C. J.; Wang, R. A.; Pestell, R. G.; Vadlamudi, R. K.; Kumar, R. p21-activated kinase-1 signaling mediates cyclin D1 expression in mammary epithelial and cancer cells. J. Biol. Chem. 2004, 279, 1422−8. (31) Nagasaki, H.; Kondo, T.; Fuchigami, M.; Hashimoto, H.; Sugimura, Y.; Ozaki, N.; Arima, H.; Ota, A.; Oiso, Y.; Hamada, Y. Inflammatory changes in adipose tissue enhance expression of GPR84, a medium-chain fatty acid receptor: TNFalpha enhances GPR84 expression in adipocytes. FEBS Lett. 2012, 586, 368−72. (32) Lattin, J. E.; Schroder, K.; Su, A. I.; Walker, J. R.; Zhang, J.; Wiltshire, T.; Saijo, K.; Glass, C. K.; Hume, D. A.; Kellie, S.; Sweet, M. J. Expression analysis of G Protein-Coupled Receptors in mouse macrophages. Immunome Res. 2008, 4, 5. (33) Fang, X.; Chen, X.; Zhong, G.; Chen, Q.; Hu, C. Mitofusin 2 Downregulation Triggers Pulmonary Artery Smooth Muscle Cell Proliferation and Apoptosis Imbalance in Rats With Hypoxic Pulmonary Hypertension Via the PI3K/Akt and Mitochondrial Apoptosis Pathways. J. Cardiovasc. Pharmacol. 2016, 67, 164−174. (34) Zhang, E.; Gao, B.; Yang, L.; Wu, X.; Wang, Z. Notoginsenoside Ft1 Promotes Fibroblast Proliferation via PI3K/Akt/mTOR Signaling Pathway and Benefits Wound Healing in Genetically Diabetic Mice. J. Pharmacol. Exp. Ther. 2016, 356, 324−32. (35) Chen, J.; Bai, M.; Ning, C.; Xie, B.; Zhang, J.; Liao, H.; Xiong, J.; Tao, X.; Yan, D.; Xi, X. Gankyrin facilitates follicle-stimulating hormone-driven ovarian cancer cell proliferation through the PI3K/ AKT/HIF-1α/cyclin D1 pathway. Oncogene 2016, 35, 2506−2517. (36) Lien, G. S.; Lin, C. H.; Yang, Y. L.; Wu, M. S.; Chen, B. C. Ghrelin induces colon cancer cell proliferation through the GHS-R, Ras, PI3K, Akt, and mTOR signaling pathways. Eur. J. Pharmacol. 2016, 776, 124−131. (37) Zhu, W.; Nelson, C. M. PI3K regulates branch initiation and extension of cultured mammary epithelia via Akt and Rac1 respectively. Dev. Biol. 2013, 379, 235−45. (38) Wickenden, J. A.; Watson, C. J. Key signalling nodes in mammary gland development and cancer. Signalling downstream of PI3 kinase in mammary epithelium: a play in 3 Akts. Breast Cancer Res. 2010, 12, 202.

(39) Schmidt, J. W.; Wehde, B. L.; Sakamoto, K.; Triplett, A. A.; Anderson, S. M.; Tsichlis, P. N.; Leone, G.; Wagner, K. U. Stat5 regulates the phosphatidylinositol 3-kinase/Akt1 pathway during mammary gland development and tumorigenesis. Mol. Cell. Biol. 2014, 34, 1363−77.

I

DOI: 10.1021/acs.jafc.6b04878 J. Agric. Food Chem. XXXX, XXX, XXX−XXX