Levels on Fermentation, Peroxidation, and Cellular Water Stress in

Jan 8, 2015 - Low temperature is used to prolong the storage life of strawberries .... CO2 levels under unlimited O2 conditions in Fragaria vesca. The...
1 downloads 0 Views 610KB Size
Download PDF
Article pubs.acs.org/JAFC

Effects of High CO2 Levels on Fermentation, Peroxidation, and Cellular Water Stress in Fragaria vesca Stored at Low Temperature in Conditions of Unlimited O2 Maria Blanch,† Raquel Rosales,† Raquel Mateos,‡ María B. Perez-Gago,§ Maria T. Sanchez-Ballesta,† María I. Escribano,† and Carmen Merodio*,† †

Department of Characterization, Quality and Security and ‡Department of Metabolism and Nutrition, Institute of Food Science Technology and Nutrition (ICTAN-CSIC), Madrid, Spain § Postharvest Technology Center, Valencian Institute of Agricultural Research (IVIA), Valencia, Spain ABSTRACT: To better understand the tolerance of strawberries (Fragaria vesca L.) to high CO2 in storage atmospheres, fermentation and cellular damage were investigated. Fruits were stored for 3 and 6 days at 0 °C in the presence of different CO2 levels (0, 20, or 40%) with 20% O2. Changes in pyruvate decarboxylase (PDC) and alcohol dehydrogenase (ADH) gene expression and in fermentative metabolites, as well as in bound water and malondialdehyde (MDA) concentrations, were analyzed. In strawberries stored without added CO2, up-regulation of PDC and ADH was not associated with an increase in fermentative metabolites. By contrast, moderate ethanol fermentation in fruits exposed to 20% CO2 seems to be essential to maintain fruit metabolism, reducing both lipid peroxidation and cellular water stress. However, if the CO2 concentration increases (40%), the excess acetaldehyde and ethanol produced were closely correlated with a decrease in bound water and production of MDA. KEYWORDS: high CO2 levels, fermentative genes, acetaldehyde, ethanol, MDA, bound water

■

hyde.9,10 This role of acetaldehyde as the main polymerizing agent was demonstrated in model solution systems with (+)-catechin or (−)-epicatechin.11 In addition to the above, high CO2 levels also modified the water status of several high-CO2-tolerant fruits, such as table grapes and strawberries, affecting the unfreezable (bound) water fraction as detected by differential scanning calorimetry (DSC).12,13 Although ethanol is a small, polar molecule able to enter the hydration layer of membranes and weaken interlipid hydrogen bonding,14,15 its influence on fruit cellular water has scarcely been investigated. Water molecules have a primary structural role in the maintenance of cell membrane, participating in the hydrogen-bonded network or hydration layer. In yeast, ethanol concentrations as low as 5% (w/v) reduce water availability sufficiently to have metabolic consequences.16 Thus, we hypothesize that perturbations in bound water, which are essential to maintain cell membrane structure, may be associated with changes in the accumulation of fermentative metabolites. Moreover, and consistent with the above, it is likely that some of the reported effects of high CO2 treatment occur through the accumulation of fermentative metabolites. Nevertheless, excessively high-CO2 treatments may also have an adverse effect on strawberry quality associated with oxidative stress. Enhanced rate of active oxygen species (ROS), often leading to oxidative damage, is an integral part of many stressful

INTRODUCTION Low temperature is used to prolong the storage life of strawberries and to slow fungal decay, mainly caused by gray mold (Botrytis cinerea) that grows at temperatures as low as 0 °C. Thus, relying on low-temperature storage to efficiently control gray mold must involve coadjuvant treatment to preserve the quality of the fruit while enhancing disease resistance. High CO2 levels (15−20%) are used commercially as an effective means of limiting fungal decay.1 Strawberries are tolerant to elevated high CO2 concentrations, although distinct cultivars exhibit different degrees of high CO2 tolerance, and they accumulated different levels of fermentative metabolites, such as acetaldehyde and ethanol.2 These fermentative products influence fruit quality and may also act as natural fungicides or insecticides.3 Strawberries are highly appreciated for their tasty flavor and nutritional value, and in particular they are a particularly good source of polyphenols, of which proanthocyanidins, produced from the condensation of flavan-3-ol units, are the main phenolics.4 Genetic and growth conditions affect the content and composition of proanthocyanidins,5 although quantitative differences are often driven by environmental storage conditions. Flavan-3-ols have positive effects on human health,6 as well as contributing to defense and stress resistance toward different fungi.7 Interestingly, short-term high-CO2 treatment (20% CO2 for 3 days) is an effective treatment for the accumulation of (+)-catechin and procyanidins B1 and B3.8 In some astringent-type fruits such as persimmon, the effectiveness of high-CO2 treatment (95−100% CO2) to promote deastringency is based on the decrease of soluble tannins concentrations through their polymerization by acetalde© 2015 American Chemical Society

Received: Revised: Accepted: Published: 761

July 18, 2014 January 7, 2015 January 8, 2015 January 8, 2015 DOI: 10.1021/jf505715s J. Agric. Food Chem. 2015, 63, 761−768

Article

Journal of Agricultural and Food Chemistry environmental conditions.17 ROS have been recognized as contributing to injury via direct lipid peroxidation that may disrupt membrane integrity.18,19 Peroxidation of lipids may lead to a radical chain reaction that is usually accompanied by the formation of a wide variety of products, including alkanes and carbonyl compounds. The most widely used index of lipid peroxidation is malondialdehyde (MDA) formation, often assayed through thiobarbituric acid (TBA). However, several other compounds are also reactive toward TBA, leading to an overestimation of MDA content. The quantitative determination of MDA by HPLC with UV detection after its derivatization with dinitrophenylhydrazone (DNPH) greatly improves the selectivity and the analytical detection limit of the MDA assay.20 Thus, using this technique, in the present work we have tried to see if the damage produced by excessively high-CO2 treatment (40%) or severely low-temperature (0 °C) storage could be also attributed to oxidative stress. Fermentative metabolism is closely linked to the availability of respiratory substrates, including malic acid, the oxidative decarboxylation of which results in the formation of pyruvic acid that may eventually be converted to fermentative compounds. The activation of ethanolic fermentative metabolism should allow NAD+ regeneration so that a net ATP production can be generated. In the first step of the ethanol fermentation pathway, pyruvate is the substrate of pyruvate decarboxylase (PDC), yielding CO2 and acetaldehyde. Subsequently, acetaldehyde is reduced to ethanol with the concomitant oxidation of NADH to NAD+ by alcohol dehydrogenase (ADH). Changes in the activities and gene expression of PDC and ADH under high-CO 2 /low-O 2 conditions have been reported in Fragaria × ananassa,21−23 yet there is little information about the specific effect of highCO2 levels under unlimited O2 conditions in Fragaria vesca. The aim of this study was to first determine the effect of lowtemperature and high-CO2 levels on ADH and PDC expression as well as on levels of fermentative metabolites, ethanol and acetaldehyde. Accordingly, the transcript abundance of these genes and fermentative metabolites were analyzed in Mara des Bois strawberries exposed for 3 and 6 days to different CO2 concentrations (0, 20, and 40%) during storage at 0 °C. In addition, we set out to stablish the CO2 doses and exposure times capable of activating fermentative metabolism. To achieve this, the availability of respiratory substrates was determined, as was the potential damage of the accumulated ethanol and acetaldehyde on lipid peroxidation and cellular water stress. This was done by analyzing bound water content and MDA.

■

were selected for quality analysis (pH, soluble solids content, titratable acidity) and fermentative metabolites quantification. Another 45 fruits were removed at random from each of group, divided into three batches of 15 strawberries, frozen in liquid nitrogen, and stored at −80 °C for further analysis. The 15 strawberries from each batch served as a biological replicate, and two different measurements were taken from each of the three biological replicates. Relative Gene Expression Assessed by Quantitative RT-PCR. RNA extraction was conducted according to the protocol of Yu et al.,24 with modifications from samples of strawberry treated with 0, 20, and 40% CO2 stored for 0 or 3 days. Total RNA was extracted three times from 0.4 g of each sample with CTBA-based extraction buffer. The quality and purity of the total RNA were evaluated by agarose gel electrophoresis and spectrometry (NanoDrop 2000, Thermo Scientific), and it was then treated with DNase (DNase I, RNasefree, Thermo) to remove any genomic DNA before synthesizing cDNAs from 1 μg of each sample using the iScript TM Reverse Transcription Supermix for RT-qPCR (Bio-Rad). RT-PCR amplification was carried out in a 96-well plate iCycler iQ thermal cycler (BioRad) and quantified using iCycler iQTM-associated software (Real Time Detection System Software, version 2.0), evaluating each gene in at least two independent runs. Sequences from the NCBI database and from the available literature (in particular, refs 21 and 25) were used to design the following gene specific primers using Primer3 software. The primer pairs used in the RT-qPCR for pyruvate decarboxylase (XM_004302484) were FvPDC_F, GTTGCTTGAGTGGGGGTCTA, and FvPDC_R, ATCTGTGAATGCGAATGAAGG; and those for alcohol dehydrogenase (XM_004290520) were FvADH_QFw2, GCCCTTCTATACTGTGTCCTC, and FvADH_QRv2, ACTGTTCTGGCTGACTGGTT. The relative expression of all the genes studied was assayed using quantitative RT-PCR (RT-qPCR). To calculate the efficiency of the reaction (optimal range 90−110%) and to establish the most suitable template concentration, the cDNAs synthesized from serial dilutions of total RNA were amplified (between 40 and 2.5 ng). Standard curves and linear equations were determined by plotting cycle threshold (Ct) values (y-axis) against the logs of the total RNA (x-axis). The efficiency of each individual run was calculated on the basis of the raw fluorescence data (ΔRn) exported as output file and subsequently imported into the LinReg PCR program. The specificity of the products was validated by analyzing the dissociation curves, evaluating in agarose gels, and sequencing (Genomic Department of the CIBCSIC). The actin-97-like housekeeping gene from F. vesca (XM_004307470) was not regulated by low-temperature or highCO2 levels (data not shown) and, thus, it was used as the internal reference gene to normalize the transcript profiles according to the 2−ΔΔCt method and relative to the calibrator sample (fruit at harvest). The actin-97-like was amplified with the primers FvActin_Fw, GGGTTTGCTGGAGATGATG, and FvActin_Rv, CACGATTGGCCTTGGGATTC. Similarly, the specificity of the products was validated by analyzing the dissociation curve in agarose gels and by sequencing. Three biological replicates were assessed for each treatment and sample, each with three technical replicates. Ethanol and Acetaldehyde Content. Ethanol and acetaldehyde were analyzed from the headspace of juice of three replicates of 15 strawberries without calyx, immediately after harvest and for each storage period. An aliquot (5 mL) of juice was transferred to 10 mL vials, closed tightly with crimp-top caps and TFE/silicone septum seals, and frozen at −80 °C. Gas chromatography (Thermo Trace, Thermo Fisher Scientific) was used to measure the ethanol and acetaldehyde according to the procedure of Valencia-Chamorro et al.26 The setup included an autosampler (model HS 2000), a flame ionization detector (FID), and a 1.2 m × 0.32 cm (i.d.) Poropack QS 80/100 column, with the injector set at 175 °C, the column at 150 °C, the detector at 200 °C, and the carrier gas at 28 mL/min. A 1 mL sample of the headspace was withdrawn from vials previously equilibrated in a water bath at 20 °C for 1 h and for 15 min at 40 °C, and it was then injected onto the GC. Ethanol and acetaldehyde were identified by comparison of the retention times with standards, and the results were expressed as milligrams per 100 mL of juice.

MATERIALS AND METHODS

Plant Material. The organic strawberries used in this study (F. vesca L. Mara des Bois) were grown in an orchard in San Sebastian de los Reyes (Madrid, Spain). Strawberries belonging to the first and second inflorescences were harvested, immediately transported to the Institute of Food Science Technology and Nutrition, and selected for uniform size and color. The strawberries with 1 mg flavonoids/g FW and a harvest maturity index of 12 (total soluble solids/titratable acidity ratio) were stored at 0 °C (±0.5) and >95% relative humidity in three sealed containers with a capacity of 1 m3. Fifteen plastic boxes, each containing approximately 0.5 kg of fruit, were stored in each container and exposed to different CO2 concentrations (0, 20, or 40%) with 20% O2 under a continuous flow. Strawberries were analyzed after 3 and 6 days of treatment using fruit analyzed at harvest as a control. The CO2 and O2 concentrations were measured using a gas analyzer (PBI Dansensor mod, Checkmate 9900). At harvest and from each treatment group (0, 20, and 40% CO2-treated fruit), 45 strawberries 762

DOI: 10.1021/jf505715s J. Agric. Food Chem. 2015, 63, 761−768

Article

Journal of Agricultural and Food Chemistry

Figure 1. Two histograms (A) represent the relative expression of fermentative genes and the two tables (B) show the levels of fermentative metabolites. The histograms reflect the relative expressions of the PDC gene XM_004302484 and the ADH gene M_004290520 in Mara des Bois strawberries Fragaria vesca, immediately after harvesting (day 0) and after 3 and 6 days of storage at 0 °C in different concentrations of CO2 (0, 20, or 40%), maintaining a constant concentration of O2 (20%). Transcripts were measured by quantitative RT-PCR and normalized against those actin97-like used as a reference gene. The results were calculated relative to a calibrator sample (day 0) using the formula 2−ΔΔCt and the values representing the means ± SE of three replicates (n = 6). The tables show changes in acetaldehyde and ethanol (mg/100 mL) under the same conditions described above. Each letter indicates significant differences between the means determined by Tukey’s test (P < 0.05). Determination of Water Fractions Content. The water fractions content were determined on a differential scanning calorimeter (DSC822e, Mettler-Toledo Inc., Columbus, OH, USA) equipped with a liquid nitrogen cooling accessory, according to the procedure of Goñi et al.27 The method based on the heat of fusion was used to calculate the unfreezable water (bound) content, whereas the total water content was determined after a stable weight had been obtained following drying at 105 °C. Chromatographic Determination of MDA. MDA was determined as its hydrazone by high-performance liquid chromatography using 2,4-dinitrophenylhydrazine (DNPH) for derivatization and following the method previously described by Mateos et al.,28 with slight modifications in the chromatographic conditions. Frozen fruit samples of approximately 1 g were homogenized in 10 mL of ultrapure water and centrifuged at 30000g for 20 min; after filtering through a 0.45 μm pore size membrane, the supernatants were collected to quantify MDA. An aliquot (250 μL) of the sample was placed in a 1.5 mL Eppendorf, and 50 μL of 6 M NaOH was added to achieve alkaline to hydrolyze protein-bound MDA by incubating this mixture in a 60 °C water bath for 30 min. The protein was then precipitated with 125 μL of 35% (v/v) perchloric acid, and the mixture was centrifuged at 2800g for 10 min. A 250 μL aliquot of the supernatant was transferred to another Eppendorf vial and mixed with 25 μL of DNPH prepared as a 5 mM solution in 2 M hydrochloric acid. Finally, this reaction mixture was incubated for 20 min at room temperature, protected from light. An aliquot of 50 μL of this reaction mixture was injected onto an Agilent 1100 HPLC-DAD with a Nucleosil 100 RP-18 column (4.0 mm × 125 mm, 5 μm particle size, Agilent) preceded by a Lichrospher guard column (4.0 mm × 4.0 mm). Samples were isocratically eluted with a mixture of 0.2% (v/v) acetic acid in deionized water and acetonitrile (75:25 v/v), applied at a flow rate of 0.7 mL/min at room temperature for 40 min. Chromatograms were acquired at 310 nm. Standard MDA was prepared by acidic hydrolysis of 1,1,3,3tetraethoxypropane in 1% sulfuric acid. Like the experimental samples, the standards were treated with 6 M NaOH for 30 min at 60 °C, followed by protein precipitation with 35% perchloric acid and

derivatization with DNPH. Concentrations were expressed as nanomoles of MDA per gram of FW. Determination of Sucrose and Malic Acid Contents. Sucrose and malic acid were measured according to the method of Blanch et al.15 using a Metrohm Advanced compac ion chromatography apparatus (867 IC Metrohm). Sucrose was determined by HPAECPAD with a Metrosep Carb 1-250 IC column (4.6 mm × 250 mm) and malic acid by HPAEC with an IC-819 conductivity detector equipped with a Metrosep Organic Acids column (7.8 mm × 100 mm). Sucrose and malic acid were identified by their retention times and quantified on the basis of calibration curves derived from standards; their contents were expressed as milligrams per gram of FW of the sample. The data represent the means of the three replicates on which two different measurements were taken. Determination of Total Soluble Solids and Titratable Acidity. The total soluble solids were determined using a digital refractometer (Atago PR-101, Atago, Japan), expressed as a percentage. The titratable acidity was analyzed by titration with 0.1 N NaOH to pH 8.1 (Mettler DL-70, Mettler-Toledo, Spain). Statistical Analysis. The analysis of variance (ANOVA) was performed using SPSS v. 19.0. Multicomparison of the means was performed using Tukey’s test, with the level of significance set at P < 0.05. The main effects of CO2 treatment and storage time and the treatment × time interaction were analyzed.

■

RESULTS AND DISCUSSION Effect of CO2 on PDC and ADH transcripts and on fermentative metabolites. To better understand the effect of low-temperature and high-CO2 levels on fermentative metabolism, we analyzed the expression of genes encoding for PDC and ADH by RT-qPCR in strawberries stored for 3 and 6 days with 0, 20, or 40% CO2 in 20% O2 (Figure 1). We analyzed the expression of the gene codifying for the Fvpdc isoform 2-like (XP_004302532), which is the PDC isoform in F. vesca with the highest homology to the Fapdc1 (AF333772) from Fragaria × ananassa that has been shown to be induced by 763

DOI: 10.1021/jf505715s J. Agric. Food Chem. 2015, 63, 761−768

Article

Journal of Agricultural and Food Chemistry stress conditions.23 Likewise, we studied the expression of genes codifying for the predicted F. vesca ADH isoform XP_004290568, which was the sequence with the highest homology to the ADH from Fragaria × ananassa (P17648) involved in cold tolerance.25 The expression of PDC was already high at harvest, but storage at 0 °C without added CO2 induced a progressive accumulation of its transcripts. After 3 days, PDC expression had increased 40%, and this increase reached 77% after 6 days. However, in fruit exposed to 20 and 40% CO2 PDC expression was similar to that found in fruit at harvest, suggesting that application of high-CO2 levels prevented the increase in PDC transcription induced by low temperature. These results agree with those of Ponze-Valadez et al.,21 who found that CO2 inhibited PDC expression in Jewel strawberries during the first days of storage at 2 °C. Even with an atmosphere of 60% CO2 for 7 days,23 no effect in PDC mRNA levels in Chandler strawberries was detected. Low temperature induced its transcription even more drastically. After 3 and 6 days without added CO2, ADH expression was 8.5- and 23-fold higher than that of fruit at harvest, respectively. This increase was more moderate in the fruit exposed to 20% CO2, and it was even less pronounced when fruits were exposed to 40% CO2. ADH mRNA accumulation by low temperature has been reported in several plant species.29,30 Also in Jewel strawberries, the ADH expression, which was low at harvest, increased after the second day of storage at low temperature,21 although accumulation of ethanol was not shown. Considering that in the present work all samples exhibited the same O2 (20%), our results indicate that factors other than O2 are influencing the expression of PDC and ADH genes. The observed marked accumulation of PDC and ADH transcripts in strawberries stored without added CO2 seems to indicate that low temperature is involved in the induction of both genes. The lowest ethanol values were found in strawberries stored without added CO2 (Figure 1B), and ethanol was not even detected after 6 days. By contrast, a marked increase in ethanol content was detected following exposure to CO2, and whereas a 4-fold increase was measured after 3 days in 20% CO2, the increase was 41-fold in 40% CO2. When fruits were exposed to CO2 for 6 days, the increase in ethanol was more pronounced, whereas no such increase was found in fruit that was not exposed to CO2. In the case of acetaldehyde, again the highest levels were found in fruit treated with 40% CO2. Furthermore, after a 3 day exposure to 40% CO2, the increase in acetaldehyde in fruit was higher than that observed for ethanol. Also in Chandler strawberries treated with 50% CO2 and with oxygen kept at 21%, acetaldehyde markedly increased with respect to untreated fruit, and its levels were higher compared with those under hypoxia conditions.31 A progressive increase in acetaldehyde and ethanol concentrations has also been reported in other fruits during ripening at 20 °C and under elevated CO2 and normal atmospheric oxygen concentration.32 Moreover, Zhang and Watkins22 showed that accumulation of fermentative metabolites and ADH transcripts in CO2 -treated strawberries was temperature dependent, being higher at 20 °C than at 2 °C. Our results indicate that the highest ethanol values were obtained in fruit exposed to 40% CO2 for 6 days (67.7 ± 2.8 mg/100 mL). Despite its accumulation, there was significantly less ethanol than in the juice of other fruits such as oranges26,33 and less than the level indicated by Ben-Aire et al.34 as an off-flavor developed in persimmons (75 mg/100 mL). Also in 40% CO2-treated fruit the highest levels of acetaldehyde were quantified, reaching values of 10 mg/100

mL. In 20% CO2-treated fruit the maximum ethanol and acetaldehyde levels were 4- and 10-fold lower than those found in 40% CO2-treated ones. Furthermore, the accumulation of such fermentative metabolites was not correlated with the strongest expression of PDC and ADH. Our results show that PDC and ADH expression was up-regulated by low temperature and it was unmodified (PDC) or weakly induced (ADH) by high levels of CO2. The sharp induction of PDC and ADH driven by low temperature was not accompanied by a shift toward ethanolic fermentation, such that the levels of acetaldehyde and ethanol did not increase concomitantly. Although high CO2 appears to exert a clear influence in avoiding the specific induction of PDC and ADH genes analyzed in this work, fruit is able to maintain an active fermentative metabolism based on the accumulation of ethanol and acetaldehyde. In light of the discrepancies between ADH transcripts and ethanol content described elsewhere21,22 and the data shown here, the correlation between fermentative metabolites and PDC and ADH gene expression still requires further study. Accordingly, other experiments should be performed to determine if there is a PDC or ADH isoform specifically induced by high concentrations of CO2. Cellular Water Stress in Response to Various CO2 Levels. The determination of bound water content by DSC showed a clear difference between CO2 doses and duration of exposure (Figure 2). In freshly harvested strawberries, the

Figure 2. Correlation between ethanol and bound water in Mara des Bois strawberries Fragaria vesca immediately after harvesting (day 0) and after 3 days of storage at 0 °C in different CO2 concentrations (0, 20, or 40%), maintaining a constant concentration of O2 (20%). The bound water content is represented by the shaded bars, whereas the line shows the relative percent of ethanol over maximum level. The R value and significance level are indicated in the top right-hand corner of the figure. An inverse correlation was also found between bound water and acetaldehyde (R = −0.836; P = 0.000) (data not shown).

bound water (2.5 g/g DW) was slightly lower than in fruit exposed to 20% CO2, which exhibited the highest values. By contrast, the bound water content decreased in fruit stored at low temperature in air, although less so than in fruit maintained in 40% CO2 in which a marked depletion was quantified after 3 days. The low bound water content then remained constant for a further 3 days, reaching values of 0.71 g/g DW. Modifications 764

DOI: 10.1021/jf505715s J. Agric. Food Chem. 2015, 63, 761−768

Article

Journal of Agricultural and Food Chemistry of water fractions have already been detected in several fruits during ripening and storage.12,27 Our present results indicate that excessively high CO2 leads to a significant conversion of bound water to free water content, with the consequent implications on the availability of water in the cell. Interestingly, the decrease in the content of bound water was inversely correlated with the increase in the levels of ethanol (R = −0.887) (Figure 2) and acetaldehyde (R = −0.836, data not shown). Strawberries treated with 40% CO2 showed the highest fermentative volatile values and the lowest values for bound water. This good correlation seems to indicate that there is competition between acetaldehyde and/or ethanol and bound water, and excessive fermentative metabolites can disrupt membrane structures. Klemm35 reported that alcohol and water compete with each other on target membrane molecules, specifically, lipids and proteins near the membrane surface. Ethanol could bind certain targets preferentially and displace water, leading to conformational consequences. Using model membrane systems, FTIR spectroscopic evidence revealed that alcohol has a nonstereospecific binding capacity for membrane surface molecules and that such binding occurs at sites that would otherwise be occupied by hydrogen-bonded water.36 Our results suggest that fermentative metabolites can modulate the displacement of water from the hydrogen-bonded network in the hydration layer, resulting in a reduction of bound water. Ethanol also perturbed cell membranes by weakening interlipid hydrogen bonding, involving water.14 Furthermore, as we previously reported that 40% CO2 treatment affected cellular structure and water potential in strawberries,13 our results suggest that excess alcohol might trigger cellular water stress. Alternatively, the lack of ethanol in fruit stored without added CO2 may restrain the flexibility of the membrane, in part, through the changes in membrane rigidity associated with storage at low temperature.37 Consequently, the beneficial effect of 20% CO2 treatment may be attributed to the stabilization of membrane component interactions, involving water. Indeed, keeping the water fractions within normal parameters seems to be important to maintain a relatively constant distance between membrane components and to stabilize lipid−lipid interactions that strongly influence the structure of biological membranes. Oxidative Damage in Response to Various CO2 Levels. Oxidative damage was quantified by measuring MDA using HPLC-UV detection as the DNPH derivative. Figure 3 shows the HPLC chromatogram at 310 nm of strawberry homogenates after treatment for MDA determination, indicating the hydrazone derivative of MDA, which was confirmed by spiking samples with standard MDA before the treatment. A good chromatographic peak resolution was obtained, with no interfering peaks, which allowed a straightforward determination of the MDA derivative. Using this precise and sensitive method, the effect of low temperature and high CO 2 concentrations on lipid peroxidation was evident (Figure 3). After 3 days, MDA levels increased in fruit stored without added CO2 with respect to freshly harvested fruit and then declined, indicating that radical-induced damage is involved in the initial stage of storage at low temperature. When strawberries were treated with 20% CO2 for 3 days, the MDA levels increased, but to lower levels than for strawberries stored without added CO2, and then remained constant for a further 3 days. In fruits treated with 40% CO2, higher levels of MDA were detected than for strawberries stored without added CO2, mainly after 6 days of treatment.

Figure 3. Chromatogram showing the MDA peak and a graph indicating the changes in the levels of MDA in Mara des Bois strawberries Fragaria vesca immediately after harvesting (day 0) and after 3 days of storage at 0 °C in different CO2 concentrations (0, 20, or 40%), maintaining a constant concentration of O2 (20%). Each letter indicates significant differences between the means determined by Tukey’s test (P < 0.05).

Membrane phospholipids, and especially the group of polyunsaturated fatty acids, are susceptible to reactions with free radicals. The significant increase in MDA in fruit tissues indicates enhanced lipid peroxidation. Lipid peroxidation may be the result of more than one environmental factor, including chilling temperature.38 Our data indicate that 20% CO2 reduces the oxidative stress caused by severely low temperature, supporting the significant increase previously observed in several tissues of table grape bunches as a response to lowtemperature storage.39,40 Given the high MDA levels in 40% CO2-treated fruit, we suggest that the decomposition of lipid hydroperoxide is possibly enhanced by the accumulation of potentially toxic levels of acetaldehyde and/or ethanol that disproportionally affect the displacement of water molecules in this hydrogen-bonded water network, thereby disrupting membrane structure. The above changes in membrane stability associated with excessive fermentative metabolites might also accelerate the oxidative damage determined by an increase in MDA levels. Changes in Sucrose, Malic Acid, Total Soluble Solids, pH, and Titratable Acidity in Response to Various CO2 Levels. At harvest, a steady-state level of sucrose was maintained in CO2-treated fruit, this being the main constituent 765

DOI: 10.1021/jf505715s J. Agric. Food Chem. 2015, 63, 761−768

Article

Journal of Agricultural and Food Chemistry

Table 1. Changes in the Content of Sucrose and Malic Acid Determined by HPAEC and in the Quality Parameters (Total Soluble Solids (°Brix), pH, and Titratable Acidity (TA)) in Fragaria vesca Mara des Bois Strawberries Immediately after Harvesting and after 3 and 6 Days of Storage at 0 °C in Different CO2 Concentrations (0, 20, or 40% CO2), Maintaining a Constant Concentration of O2 (20%)a 3 days sucrose (mg/g fw) °Brix (%) malic acid(mg/g fw) pH TA (% citric acid) a

6 days

at harvest

0% CO2

20% CO2

40% CO2

0% CO2

20% CO2

40% CO2

17.92 ± 1.2bc 9.80 ± 0.2cd 3.48 ± 0.2d 3.57 ± 0.0a 0.80 ± 0.0c

12.36 ± 0.9a 9.80 ± 0.2cd 2.91 ± 0.1c 3.71 ± 0.0d 0.85 ± 0.0d

17.83 ± 0.2bc 9.27 ± 0.2ab 2.09 ± 0.2a 3.64 ± 0.0c 0.78 ± 0.0b

16.98 ± 1.1bc 9.47 ± 0.1bc 2.93 ± 0.2c 3.72 ± 0.0d 0.73 ± 0.0a

13.25 ± 0.5a 9.03 ± 0.1a 2.36 ± 0.1ab 3.60 ± 0.0b 0.78 ± 0.0b

19.13 ± 1.6c 10.10 ± 0.0d 2.49 ± 0.1b 3.64 ± 0.0c 0.81 ± 0.0c

17.63 ± 1.8bc 9.93 ± 0.1d 2.74 ± 0.0bc 3.69 ± 0.0d 0.73 ± 0.0a

Data are presented as the means ± SE of three replicates (n = 6); different letters (a−d) within rows indicate significant differences at P < 0.05.

seems to be potentiated by the activation of malic acid decarboxylation in accordance with the decrease in malic acid quantified in these treated fruit. Stimulation of NADP-ME activity in 20% CO2-treated fruit has already been reported.45 Thus, the activation of fermentative metabolism has been described as an adaptive response of fruit to stressful conditions.21 Therefore, the controlled modulation of ethanol and acetaldehyde levels that are allowed to accumulate in strawberry tissues in fruit seems to be an extremely important protective mechanism for conferring tolerance to high-CO2 levels, thus reducing damage to severely low temperature. Our data indicate that the expression of PDC and ADH genes in Fragaria vesca Mara des Bois strawberries stored at low temperature without added CO2 is greatly in excess of the rate of fermentation metabolites. Moreover, the progressive decrease in the transcript levels of PDC and ADH as CO2 increases suggests that the induction of fermentative genes is correlated with low-temperature storage. Our results demonstrate that treating strawberries with 20% CO2 activates fermentative metabolism by means of a marked increase in the levels of fermentative metabolites. Moreover, favorable fermentative metabolism combined with the activation of malic acid decarboxylation may represent a protective mechanism. On exposure to 40% CO2, the exclusive disposition of fermentative metabolism caused damage due to the excessive accumulation of fermentative metabolites in the fruit, leading to elevated oxidative stress as witnessed by acute MDA production. Moreover, excess ethanol and acetaldehyde accumulation could potentially accelerate the loss of membrane integrity, provoking the loss of bound water fraction that resembles cellular water stress. Therefore, the controlled modulation of ethanol and acetaldehyde levels in fruit concomitant with an activation of malic decarboxylation may in part explain complex processes such as cross tolerance between low temperature and beneficial high-CO2 concentrations. This study demonstrates the up-regulation of ADC and PDC in strawberries at 0 °C in conditions of unlimited O2 while nonaccumulation of fermentative products occurred. Moreover, storage at low temperature was coupled to oxidative stress, exacerbated by excessive high CO2 (40%) and controlled by beneficially high-CO2 (20%) levels. Furthermore, the accumulation of fermentative products was correlated with marked changes in fruit water status, without the influence of extra surrounding water.

of carbohydrate reserve (Table 1). By contrast, a decrease in sucrose was observed in fruit stored without additional CO2 (0%) after both 3 and 6 days in storage at 0 °C. These results reveal that without added CO2, fruits deplete their energy reserves, leading to a decrease in sucrose and lower levels of total soluble solids after 6 days in storage. Conversely, fruits saved energy reserves when exposed to CO2 and had more abundant sucrose than fruits stored at low temperature without added CO2. Ethanol synthesis has generally been regarded as the means to regenerate NAD+ required to sustain glycolytic energy production. Furthermore, and consistent with the pHstat mechanism for H+ consumption, the activation of ethanol synthesis in CO2-treated fruit could be an important role given that ethanol synthesis is not accompanied by H+ production and, so, it could be a way to limit cytoplasmic acidification. Although cytoplasmic pH determination has not been performed in this study, the fruit extract pH indicated that fruit with excessive CO2 levels (40%) exhibited the highest pH levels and the lowest titratable acidity (Table 1). Increasing pH and decreasing titratable acidity in strawberry tissues was more marked in fruit stored in high CO2 atmospheres.41 Malic acid content is involved in regulating cytoplasmic pH, and changes in endogenous malate levels in response to experimental treatment are expected to cause cytoplasmic pH shifts.42 The lowest values of malic acid were found in fruit exposed to 20% CO2 for 3 days (Table 1). The decrease in malic acid in fruit treated with 20% CO2 for 3 days might prevent a drop in the cytoplasmic pH and, consequently, a high degree of fermentation might not be required in accordance with the aforementioned hypothesis. A significant role for malate in the regulation of cytoplasmic pH in hypoxic plant tissue has been proposed.43 However, when the exposure to CO2 treatment was stronger and persisted longer, this pattern changed. In the case of fruit stored at 0 °C without added CO2, the upregulation of fermentative genes while ethanol formation was restricted implies that the potential capacity for ethanolic fermentation was insufficient. Ethanolic fermentation not only is considered to be the main factor in providing energy under low oxygen concentrations but also has additional important functions in the presence of atmospheric oxygen.44 Our results show that following exposure to high CO2 under unlimited oxygen conditions, the activation of fermentative metabolism in fruit with the associated production of ethanol and acetaldehyde may represent an essential supplementary metabolic pathway for energy production. Favorable fermentative metabolism in strawberries exposed to 20% CO2, with a marked increase in the levels of fermentative metabolites, should promote the consumption of reducing power and H+. Moreover, the reoxidation of NADH in 20% CO2-treated fruit 766

DOI: 10.1021/jf505715s J. Agric. Food Chem. 2015, 63, 761−768

Article

Journal of Agricultural and Food Chemistry

■

(16) Hallsworth, J. E. Ethanol-induced water stress in yeast. J. Ferment. Bioeng. 1998, 85, 125−137. (17) Mitller, R. Oxidative stress, antioxidant and stress tolerance. Trends Plant Sci. 2002, 7, 405−410. (18) de Lima, V. R. D.; Morfim, M. P.; Teixeira, A.; Creczynski-Pasa, T. B. Relationship between the action of reactive oxygen and nitrogen species on bilayer membranes and antioxidants. Chem. Phys. Lipids 2004, 132, 197−208. (19) Xu, M.; Dong, J.; Zhang, M.; Xu, X.; Sun, L. Cold-induced endogenous nitric oxide generation plays a role in chilling tolerance of loquat fruit during postharvest storage. Postharvest Biol. Technol. 2012, 65, 5−12. (20) De Zwart, L. L.; Meerman, J. H. N.; Commandeur, J. N. M.; Vermeulen, N. P. E. Biomarkers of free radical damage applications in experimental animals and in humans. Free Radical Biol. Med. 1999, 26, 202−226. (21) Ponce-Valadez, M.; Watkins, C. B. Fermentation and malate metabolism in response to elevated CO2 concentrations in two strawberry cultivars. Physiol. Plant. 2008, 134, 121−33. (22) Zhang, J. J.; Watkins, C. B. Fruit quality, fermentation products, and activities of associated enzymes during elevated CO2 treatment of strawberry fruit at high and low temperatures. J. Am. Soc. Hortic. Sci. 2005, 130, 124−130. (23) Moyano, E.; Encinas-Villarejo, S.; López-Ráez, J.; RedondoNevado, J.; Blanco-Portales, R.; Bellido, M. L.; Sanz, C.; Caballero, J. L.; Muñoz-Blanco, J. Comparative study between two strawberry pyruvate decarboxylase genes along fruit development and ripening, post-harvest and stress conditions. Plant Sci. 2004, 166, 835−845. (24) Yu, D.; Tang, H.; Zhang, Y.; Du, Z.; Yu, H.; Chen, Q. Comparison and improvement of different methods of RNA isolation from strawberry (Fragraria × ananassa). J. Agric. Sci. 2012, 4, 51−56. (25) Koehler, G.; Wilson, R. C.; Goodpaster, J. V.; Sønsteby, A.; Lai, X.; Witzmann, F. A.; You, J. S.; Rohloff, J.; Randall, S. K.; Alsheikh, M. Proteomic study of low-temperature responses in strawberry cultivars (Fragaria × ananassa) that differ in cold tolerance. Plant Physiol. 2012, 159, 1787−1805. (26) Valencia-Chamorro, S. A.; Pérez-Gago, M. B.; del Río, M. A.; Palou, L. Effect of antifungal hydroxypropyl methylcellulose (HPMC)lipid edible composite coatings on postharvest decay development and quality attributes of cold-stored ‘Valencia’ oranges. Postharvest Biol. Technol. 2009, 54, 72−79. (27) Goñi, O.; Muñoz, M.; Ruiz-Cabello, J.; Escribano, M. I.; Merodio, C. Changes in water status of cherimoya fruit during ripening. Postharvest Biol. Technol. 2007, 45, 147−150. (28) Mateos, M.; Lecumberri, E.; Ramos, S.; Goya, L.; Bravo, L. Determination of malondialdehyde (MDA) by high-performance liquid chromatography in serum and liver as a biomarker for oxidative stress. Application to a rat model for hypercholesterolemia and evaluation of the effect of diets rich in phenolic antioxidants from fruits. J. Chromatogr., B 2005, 827, 76−82. (29) Christie, P. J.; Hahn, M.; Walbot, V. Low-temperature of alcohol dehydrogenase-1 mRNA and protein activity in maize and rice seedlings. Plant Physiol. 1991, 95, 699−706. (30) Jarillo, J. A.; Leyva, A.; Salinas, J.; Martínez-Zapater, J. M. Low temperature induces the accumulation of alcohol dehydrogenase mRNA in Arabidopsis thaliana, a chilling-tolerant plant. Plant Physiol. 1993, 101, 833−837. (31) Ke, D.; Zhou, L.; Kader, A. A. Mode of oxygen and carbon dioxide action on strawberry ester biosynthesis. J. Am. Soc. Hortic. Sci. 1994, 119, 971−975. (32) Muñoz, M. T.; Escribano, M. I.; Merodio, C. Ethanolic metabolism in cherimoya fruit during storage at ambiente and under high CO2 atmosphere. J. Hortic. Sci. Biotechnol. 1997, 72, 976−982. (33) Pérez-Gago, M. B.; Rojas, C.; del Río, M. A. Effect of lipid type and amount of edible hydroxypropyl methylcellulose−lipid composite coatings used to protect postharvest quality of mandarins cv. Fortune. J. Food Sci. 2002, 67, 2903−2910.

AUTHOR INFORMATION

Corresponding Author

*(C.M.) Phone: 34-91-5492300. Fax: 34-91-5493627. E-mail: [email protected]. Funding

This work was financed by CICYT Projects AGL2008-02949 and AGL2011-26742 from MICINN of the Spanish government. R.R. was supported by a postdoctoral JAE contract from the CSIC. Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Wszelaki, A. L.; Mitcham, E. J. Effect of combination of hot water dips, biological control and controlled atmospheres for control of gray mold on harvested strawberries. Postharvest Biol. Technol. 2003, 27, 255−264. (2) Fernandez-Trujillo, J. P.; Nock, J. F.; Watkins, C. B. Fermentative metabolism and organic acid concentrations in fruit of selected strawberry cultivars with different tolerances to carbon dioxide. J. Am. Soc. Hortic. Sci. 1999, 124, 696−701. (3) Pesis, E. The role of the anaerobic metabolites, acetaldehyde and ethanol, in fruit ripening, enhancement of fruit quality and fruit deterioration. Postharvest Biol. Technol. 2005, 37, 1−19. (4) Buendia, B.; Gil, M. I.; Tudela, J. A.; Gady, A. L.; Medina, J. J.; Soria, C.; López, J. M.; Tomás-Barberán, F. A. HPLC-MS analysis of proanthocyanidin oligomers and other phenolics in 15 strawberry cultivars. J. Agric. Food Chem. 2010, 58, 3916−3926. (5) Akhatou, I.; Fernández-Recamales, A. Nutritional and nutraceutical quality of strawberries in relation to harvest time and crop conditions. J. Agric. Food Chem. 2014, 62, 5749−5760. (6) Aron, P. M.; Kennedy, J. A. Flavan-3-ols: nature, occurrence and biological activity. Mol. Nutr. Food Res. 2008, 52, 79−104. (7) Panjehkeh, N.; Backhouse, D.; Taji, A. Role of proanthocyanidins in resistance of the legume Swainsona formosa to Phytophthora cinnammi. J. Phytopathol. 2010, 158, 365−371. (8) Blanch, M.; Alvarez, I.; Sanchez-Ballesta, M. T.; Escribano, M. I.; Merodio, C. Increasing catechin and procyanidin accumulation in high CO2-treated Fragaria vesca strawberries. J. Agric. Food Chem. 2012, 60, 7489−7496. (9) Arnal, L.; Del Río, M. A. Removing astringency by carbon dioxide and nitrogen-enriched atmospheres in persimmon fruit cv. ‘Rojo brillante’. J. Food Sci. 2003, 68, 1516−1518. (10) Min, T.; Yin, X.; Shi, Y.; Luo, Z.; Yao, Y.; Grierson, D.; Ferguson, I. B.; Chen, K. Ethylene-responsive transcription factors interact with promoters of ADH and PDC involved in persimmon (Diospyros kaki) fruit de-astringency. J. Exp. Bot. 2012, 63, 6393−6405. (11) Es-Safi, N.; Fulcrand, H.; Cheynier, V.; Moutounet, M. Competition between (+)-catechin and (−)-epicatechin in acetaldehyde induced polymerization of flavanols. J. Agric. Food Chem. 1999, 47, 2088−2095. (12) Goñi, O.; Fernandez-Caballero, C.; Sanchez-Ballesta, M. T.; Escribano, M. I.; Merodio, C. Water status and quality improvement in high-CO2 treated table grapes. Food Chem. 2011, 128, 34−39. (13) Blanch, M.; Goñi, O.; Sanchez-Ballesta, M. T.; Escribano, M. I.; Merodio, C. Characterisation and functionality of fructo-oligosaccharides affecting water status of strawberry fruit (Fragaria vesca L. cv. Mara des Bois) during postharvest storage. Food Chem. 2012, 134, 912−919. (14) Slater, S. J.; Frank, C. H.; Taddeo, F. J.; Kelly, M. B.; Stubbs, C. D. Contribution of hydrogen bonding to lipid-lipid interactions in membranes and the role of lipid order: effects of cholesterol, increased phospholipid unsaturation, and ethanol. Biochemistry 1993, 32, 3714− 3721. (15) Fujita, Y.; Yoshikawa, M. Vapor permeation of aqueous ethanol mixtures through agarose membranes. J. Membr. Sci. 2014, 459, 114− 121. 767

DOI: 10.1021/jf505715s J. Agric. Food Chem. 2015, 63, 761−768

Article

Journal of Agricultural and Food Chemistry (34) Ben-Aire, R.; Zutkhi, Y.; Sonego, L.; Klein, J. Modified atmosphere packaging for long-term storage of astringent persimmons. Postharvest Biol. Technol. 1991, 1, 169−179. (35) Klemm, W. R. Biological water and its role in the effects of alcohol. Alcohol 1998, 15, 249−267. (36) Chiou, J. S.; Kuo, C. C.; Lin, S. H.; Kamaya, H.; Ueda, I. Interfacial dehydration by alcohols: hydrogen bonding of alcohols to phospholipids. Alcohol 1991, 8, 143−150. (37) Gualanduzzi, S.; Baraldi, E.; Braschi, I.; Carnevali, F.; Gessa, C. E.; De Santis, A. Respiration, hydrogen peroxide levels and antioxidant enzyme activities during cold storage of zucchini squash fruit. Postharvest Biol. Technol. 2009, 52, 16−23. (38) Hodges, D. M.; Lester, G. E.; Munro, K. D.; Toivonen, P. M. A. Oxidative stress: importance for postharvest quality. HortScience 2004, 39, 924−929. (39) Rosales, R.; Fernandez-Caballero, C.; Romero, I.; Escribano, M. I.; Merodio, C.; Sanchez-Ballesta, M. T. Molecular analysis of the improvement in rachis quality by high CO2 levels in table grapes stored at low temperature. Postharvest Biol. Technol. 2013, 77, 50−58. (40) Romero, I.; Sanchez-Ballesta, M. T.; Maldonado, R.; Escribano, M. I.; Merodio, C. Anthocyanin, antioxidant activity and stress-induced gene expression in high CO2-treated table grapes stored at low temperature. J. Plant Physiol. 2008, 165, 522−530. (41) Holcroft, D. M.; Kader, A. A. Controlled atmosphere-induced changes in pH and organic acid metabolism may affect color and stored strawberry fruit. Postharvest Biol. Technol. 1999, 17, 19−32. (42) Sakano, K. Metabolic regulation of pH in plant cells: role of cytoplasmic pH in defense reaction and secondary metabolism. Int. Rev.Cytol. 2001, 206, 1−44. (43) Roberts, J. K. M.; Hooks, M. A.; Miaullis, A. P.; Edwards, S.; Webster, C. Contribution of malate and amino acid metabolism to cytoplasmic pH regulation in hypoxic maize root tips studied using nuclear magnetic resonance spectroscopy. Plant Physiol. 1992, 98, 480−487. (44) Tadege, M.; Dupuis, I.; Kuhlemeier, C. Ethanolic fermentation: new functions for an old pathway. Trends Plant Sci. 1999, 8, 320−325. (45) Blanch, M.; Rosales, R.; Goya, L.; Sanchez-Ballesta, M. T.; Escribano, M. I.; Merodio, C. NADP-malic enzyme and glutathione reductase contribute to glutathione regeneration in Fragaria vesca fruit treated with protective high CO2 concentrations. Postharvest Biol. Technol. 2013, 86, 431−436.

768

DOI: 10.1021/jf505715s J. Agric. Food Chem. 2015, 63, 761−768