Linear Discriminant Analysis Identifies Mitochondrially Localized

Page 1 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

Linear discriminant analysis identifies mitochondrially localized proteins in Neurospora crassa Lisette Wirsing1, Frank Klawonn1,6, Wiebke Anna Sassen2, Heinrich Lünsdorf3, Corinna Probst4, Michael Hust5, Ralf R. Mendel4, Tobias Kruse4*, Lothar Jänsch1* 1

Research Group Cellular Proteomics, Helmholtz Centre for Infection Research, 38124

Braunschweig, Germany. 2

Division of Cellular and Molecular Neurobiology, Zoological Institute, Braunschweig

University of Technology, 38106 Braunschweig, Germany. 3

Central Facility for Microscopy, Helmholtz Centre for Infection Research, 38124

Braunschweig, Germany. 4

Department of Plant Biology, Braunschweig University of Technology, 38106 Braunschweig,

Germany. 5

Department of Biotechnology, Institute for Biochemistry and Biotechnology, Braunschweig

University of Technology, 38106 Braunschweig, Germany. 6

Department of Computer Science, Ostfalia University of Applied Sciences, 38302 Wolfenbüttel,

Germany. *corresponding authors: Lothar Jänsch ([email protected], Phone: +49 (0)531

61813030) and Tobias Kruse ([email protected], Phone: +49 (0)531 3915873)

ACS Paragon Plus Environment

1


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 52

ABSTRACT: Besides their role as powerhouses, mitochondria play a pivotal role in the spatial organization of numerous enzymatic functions. They are connected to the ER and many pathways are organized through the mitochondrial membranes. Thus, the precise definition of mitochondrial proteomes remains a challenging task.

Here, we have established a proteomic strategy to accurately determine the mitochondrial localization of proteins from the fungal model organism Neurospora crassa. This strategy relies on both, highly pure mitochondria as well as the quantitative monitoring of mitochondrial components along their consecutive enrichment. Pure intact mitochondria were obtained by a multistep approach combining differential and density Percoll (ultra)-centrifugations. When compared with three other intermediate enrichment stages peptide sequencing and quantitative profiling of pure mitochondrial fractions revealed prototypic regulatory profiles of per se mitochondrial components. These regulatory profiles constitute a distinct cluster defining the mitochondrial compartment and support linear discriminant analyses, which rationalized the annotation process. In total, this approach experimentally validated the mitochondrial localization of 512 proteins including 57 proteins, which were not reported for N. crassa before. KEYWORDS: mitochondrial proteomics, Linear Discriminant Analysis (LDA), Neurospora crassa, heme biosynthesis, D-arabinitol dehydrogenase


2

Page 3 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Mitochondria play a pivotal role not only in energy metabolism but also in the compartmentation of essential metabolic processes and signaling pathways. This includes heme biosynthesis, ironsulfur cluster assembly, molybdenum cofactor biosynthesis, calcium signaling and apoptosis.1–3 In turn, mitochondrial dysfunctions in humans can trigger multiple diseases ranging from neurodegenerative disorders, cancer, cardio, renal, muscle and liver failure to diabetes mellitus.4 Meanwhile, numerous proteome studies were applied to mitochondria-enriched fractions from different organisms as well as from individual tissues documenting a significantly variable inventory of mitochondria.2,5–7 Results obtained by experimental and theoretical studies are summarized in separate databases.8 Based on an integration of these data, it was predicted that about 1500 proteins in mammals and 1000 in fungi have the capacity to locate to mitochondria. 9 However, the definition of mitochondrial functions as part of cellular networks remains a challenging task. A major reason is the high dynamic range of differentially abundant mitochondrial components recognized in parallel to an increasing sensitivity and resolution of mass spectrometry.8 Numerous genuine mitochondrial proteins have dual and multiple cellular localization10 which however often aggravates the differentiation between genuine mitochondrial and co-purified proteins.8 Therefore, there is a strong demand for strategies supporting the definition of varied mitochondrial inventories unambiguously. The filamentous fungus Neurospora crassa contributed to our understanding of the mitochondrial biogenesis11 and constitutes an important model12, since its mitochondria share more similarities with those from mammals than those from yeast13. Several publications of N. crassa mitochondrial


3


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 52

proteomes had addressed the outer membrane14,15, the ribosomal proteins16 and the respiratory chain13 as well as the whole proteome17 and mutant strains18. Here, we used N. crassa to establish a quantitative proteome strategy for the rational annotation of mitochondrially localized proteins. This strategy combined and refined established protocols11,19 for the step-wise purification of intact mitochondria from N. crassa. Importantly, quantitative data were obtained for all major purification stages and successfully used for the unambiguous classification of mitochondrial proteins by linear discriminant analysis. This strategy also supports the definition of cellular processes that are organized across the mitochondrial membranes. For instance, enzymes of the heme biosynthesis were accurately annotated as part of either the cytosolic or mitochondrial compartment by our approach. In total, this study alone experimentally characterized the mitochondrial localization of 512 proteins thereby confirming a significant portion of the known mitochondrial proteome of N. crassa17,18,20. Notably, 57 of those were defined as novel mitochondrial components in N. crassa, while some enzymes such as the D-arabinitol dehydrogenase were detected in mitochondria for the first time at all.

MATERIALS AND METHODS The mitochondrial enrichment from culturing through proteome data elicitation as well as all quality control experiments was done three times as biological replicates. Culturing Neurospora crassa N. crassa was grown on Vogel’s minimal medium21 containing 2% sucrose. For solid medium 1.5% agar was added. To obtain mycelium for the isolation of mitochondria, the N. crassa wild-


4

Page 5 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


type strain (74-OR8-la) was initially grown in a flask containing solid medium for seven days at 30 °C. Subsequently the culture was kept for three days at room temperature (RT) on the laboratory bench. Conidia were harvested by washing the agar with autoclaved distilled water. For growing N. crassa in liquid cultures 1.056 x 105 conidia per mL were used for inoculation. Conidia concentration was measured based on optical density at 530 nm (A530 = 0.1 is equivalent to 2 x 105 conidia per mL). Cultures were grown in baffled flasks at 30 °C and 130 rpm for 12 h. Mycelium was harvested by filtration. The yield was about 25 g wet weight per liter culture medium. Cell rupturing and enrichment of mitochondria The extraction of mitochondria was executed according to Nargang and Rapaport11 and is described also in Figure 1. Briefly, directly after harvesting the mycelium was ground at 4 °C in 1 mL extraction buffer (250 mM sucrose, 25 mM HEPES, 5 mM EGTA (pH 7.5), protease inhibitor (ROCHE Complete, EDTA-free)) and 1 g Silicon dioxide (Sigma-Aldrich) per g mycelium. When the mixture was homogenized 1 mL of extraction buffer per g mycelium was added again to grind the cells for further 45 sec. Afterwards mitochondria were harvested by differential centrifugation11 at 4 °C and between both repeats an additional Benzonase digest to avoid DNA and RNA contamination (200 units Benzonase per g used mycelium) was performed. The mitochondrial pellet was suspended in extraction buffer and designated as crude mitochondrial fraction (cM). Next, a one-step Percoll density gradient centrifugation (7 mL of cM sample was mixed with 40 mL of 25% Percoll) was performed to obtain a pure mitochondrial fraction (pM) according to Wieckowski and coworkers.19 As control the upper band of the Percoll gradient was sampled as impure mitochondrial fraction (iM).


5


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 52

In parallel, mycelium was ground in presence of liquid nitrogen and proteins were extracted with extraction buffer (100 mM HEPES (pH 7.5); 150 mM NaCl; 5 mM EDTA; 5% (v/v) glycerol; 0.05% (v/v) Tween 20 and Protease inhibitor (ROCHE Complete, EDTA-free)). After incubating the extracts for 15 min on ice they were centrifuged for 20 min at 16 000 g and the supernatant was retained as a mycelium extract (Myc). Quality control For quality control we used samples obtained from the whole enrichment process (Myc, cM, iM and pM, see description above as well as figure 1). For transmission electron microscopy (TEM) samples were fixed in 2% formaldehyde and 2% glutaraldehyde in extraction buffer (with addition of 0.1 M potassium chloride) for 2 h at RT. Afterwards, they were immobilized in 2% (w/v) low melting agarose, washed (50 mM cacodylate; pH 7.2; 250 mM sucrose) and fixed for 2 h with 0.5% osmium in 80 mM cacodylate (pH 7.2) before being washed again twice. Dehydration was achieved with increasing concentrations of ethanol (10% with 1% uranylacetate and 30% at RT; 50, 70 and 90% on ice and 100% again at RT) and incubation in acetone at RT with about 30 min intervals per step. Then the samples were infiltrated with epoxy resin (Spurr-mixture, Fluka, Buchs, Switzerland) in 1:2 and 2:3 mixtures of resin monomer with acetone and finally with pure resin solution. Each of these steps were performed overnight at RT. Aliquots of the samples were transferred to resin-filled gelatin capsules and polymerized at 75 °C for 16 h. Sections (approximately 90 nm) were cut on a Reichert Ultracut S Ultramicrotome (Leica Mikrosysteme, Vienna, Austria) and picked up on 300 mesh Formvar® coated copper grids (Plano, Wetzlar, Germany). Next, sections were post-stained with 4% uranylacetate in a 0.2 fold Ultrostain 2 (Leica Mikrosysteme) and then examined with a Libra


6

Page 7 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


120 plus energy-filter transmission electron microscope (Zeiss, Oberkochen, Germany). Zero-loss filtered images were acquired with a bottom-mount 2x2k CCD-camera (SharpEye, Tröndle, Moorenwies, Germany) at 120 kV acceleration voltage and an 1 µA beam current within a magnification range (nominal) of 4 000 to 12 000 fold. The protein amounts were quantified with BioRad Protein Assay (BioRad, Munich, Germany) against a BSA standard curve (0.1 to 1 mg/mL), according to the manufacturer’s instructions. Mitochondrial integrity was examined with the cytochrome c oxidase (according to Cytochrome c oxidase assay kit, Sigma Aldrich). In brief, cytochrome c oxidase is not accessible for external ferrocytochrome c as substrate in intact mitochondria. n-Dodecyl β-D-maltoside-treated mitochondria are used as a reference for the definition of 100% cytochrome c oxidase enzyme activity (corresponding to 0% intact mitochondria). Accordingly, enzyme activities and the ratio of intact mitochondria, which are inversely proportional, were calculated in relation to the reference of n-Dodecyl β-D-maltoside-treated mitochondria. 5 µg protein of the sample were taken and the absorbance was measured after a 10 sec delay and further a 15 sec reaction time to determine the enzyme activity. For immune detection of marker proteins SDS-PAGE was performed by standard methods22 utilizing 4.2% stacking gel (pH 6.8) and 12% separating gel (pH 8.8). PageRuler Plus Prestained Protein Ladder 10 – 250 kDa (3 μl) (Thermo Scientific) was used as protein marker. Electrophoresis was conducted for 1.5 h in a Minigel-Twin Electrophoresis Cell (Biometra, Goettingen, Germany) at RT. 5 µg of protein preparations was run on SDS-PAGE gels and transferred onto an Immun-Blot PVDF membrane (BioRad) using blotting buffer (25 mM TrisBase (pH 8.3); 192 mM glycin; 10% methanol; 0.02% SDS). Membranes were blocked with 5%


7


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 52

(v/w) nonfat dry milk in TBS (pH 7.8) for 1 h and incubated overnight with primary antibodies (Table S1, Supporting Information) in blocking solution. The antibody was washed off and the membrane was incubated for 2 h with a secondary antibody coupled to alkaline phosphatase (Jackson ImmunoResearch, West Grove, USA) in blocking solution (1:2000) followed by washing. For visualization of antigens the membrane was incubated with Amersham™ ECL™ Prime Western blotting reagent (GE Healthcare). The relative quantification of proteins according to Gene Ontology (GO23) localization annotations was carried out with the Proteome Discoverer Software (1.4, Thermo Scientific) by summing up the peak areas of the three most abundant peptides of every identified protein. For this purpose proteins were extracted, digested and measured (without SCX-fractionation) as described below. Protein extraction, digestion and iTRAQ modification of peptides Proteins were extracted from each fraction of the enrichment procedure (Myc, cM, iM and pM) according to Wessel and Flügge24 and dissolved in dissolution buffer (8 M urea; 0,6 M TEAB). Protein concentrations were determined using a NanoDrop spectrophotometer (ND-1000, Peqlab, Biotechnology GmbH, Erlangen, Germany). Equal amounts of protein samples were digested with sequencing grade modified trypsin from Promega, in a ratio of 1:20 at 37 °C overnight. Peptides were vacuum dried, dissolved in 0.2% trifluoroacetic acid / 3% acetonitrile and desalted on an Oasis HLB Cartridge 1cc (Waters, Eschborn, Germany). Labeling of tryptic peptides with isobaric iTRAQ reagents was performed according to the manufacturer's guidelines (Applied Biosystems, Foster City, CA). Peptides derived from Myc, cM, iM and pM were labeled with iTRAQ reagents 114, 115, 116 and 117, respectively. Peptides from the different samples were combined (1:1


8

Page 9 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ratio), vacuum dried, dissolved in 0.2% trifluoroacetic acid / 3% acetonitrile and desalted on an Oasis HLB Cartridge 3cc (Waters). Strong Cation Exchange Chromatography (SCX) The combined iTRAQ-labeled peptide samples were further sub-fractionated by strong cation exchange chromatography (SCX) to support representative and comprehensive protein identification by LC-MS/MS. Peptides were dissolved in SCX buffer (0.065% formic acid, 25% acetonitrile) and fractionated on a Mono SPC1.6/5 column connected to an Ettan micro-LC system (both GE Healthcare). Separation occurred at a flow rate of 150 μl/min for 15 min with a linear gradient from 0–35% SCX buffer supplemented with 0.5 M potassium chloride. Fractions were collected by a microfraction collector every minute (SunCollect). Peptide elution was monitored by an UV detector at 214 nm. Peptide-containing fractions were partially combined according to concentration, vacuum-dried, desalted on Oasis HLB Cartridge 1cc (Waters) and analyzed separately by LC-MS/MS. LC- MS/MS analysis LC-MS/MS analyses were performed with an UltiMate 3000 RSLCnano LC system (Thermo Scientific) connected to an LTQ Orbitrap Velos Fourier transform mass spectrometer (Thermo Scientific). Peptides were applied to a C18 precolumn (3-μm, Acclaim, 75 μm × 20 mm, Dionex) and washed with 0.1% TFA for 3 min at a 6 μl/min flow rate. Subsequently, peptides were separated on a C18 analytical column (3-μm, Acclaim PepMap RSLC, 75 μm × 25 cm, Dionex) at 350 μl/min via a linear 120 min 3.7–31.3% B gradient with UPLC solvent A (0.1% formic acid in water) and UPLC solvent B (0.1% formic acid in 80% acetonitrile). The LC system was operated with Chromeleon Software (version 6.8, Dionex). The effluent from the column was electro-


9


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 52

sprayed (Pico Tip Emitter Needles, New Objectives) into the mass spectrometer. The mass spectrometer was controlled by Xcalibur software (version 2.1, Thermo Scientific) and operated in the data-dependent mode allowing the automatic selection of doubly and triply charged peptides and their subsequent fragmentation (precursor ion scans and selection in mass range 350 – 1500 m/z with a resolution of 60.000). Peptide fragmentation was carried out using Higher-energy Collision Dissociation (HCD) settings, with Collision Energy (CE) 38 optimized for iTRAQlabeled peptides (fragment ion scans with a resolution of 7.500, up to 10 MS/MS scans per cycle and 1 repeat with an 18 s dynamic exclusion time). MS/MS raw data from all SCX fractions, corresponding to one experiment, were visualized by Xcalibur software (.raw-file) and merged for protein identification (Proteome Discoverer 1.4, Thermo Scientific; used Mascot version 2.4, Matrix Science) against UniProtKB protein database (release 2014_05; taxonomy: Neurospora crassa with 10,257 entries). The following search parameters were used: enzyme, trypsin; maximum missed cleavages, 2; fixed modifications, iTRAQTM 4-plex (K), iTRAQTM (N terminus), Methylthio (C); variable modifications, oxidation (M), Phospho (ST), Phospho (Y); peptide ion mass tolerance, 10 ppm; MS/MS tolerance, 100 mmu. Mascot-aided decoy searches were performed against the randomized Uniprot protein database (Mascot version V2.3.02, Matrix Science) against UniProtKB protein database (release 2014_05; taxonomy: Neurospora crassa with 10,257 entries) and protein false discovery rates (FDRs) were calculated by Proteome Discoverer on the basis of FDR = FP (false positive)/(FP + TP (true positives)). On average the FDRs were always determined between 0.01 and 0.05. Only proteins identified by at least two unique peptides (Mascot rank 1) showing a high peptide confidence (corresponding to 99 % confidence according to Proteome Discoverer) and a Mascot (Ion) Score of at least 30 were accepted in this survey. Additionally, slim category GO annotations for all proteins were matched


10

Page 11 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


by using Proteome Discoverer 1.4 (integrated Protein Center search) and protein grouping was permitted. Protein quantification Enrichment patterns of proteins during the purification process were determined by relative quantification using iTRAQ. Proteome Discoverer provided raw protein quantification ratios, based on the iTRAQ-label intensity of all unique peptides per protein. Their quantification ratios (116/114, 115/114, 117/114) represent the relative abundance of a protein in cM, iM and pM, respectively, compared to Myc (enrichment factors). Data analysis and statistics Statistical analysis was carried out with the free software environment for statistical computing and graphics R (http://www.R-project.org). Only proteins that were measured in at least one replicate with all three enrichment factors were taken into account for the analysis. Enrichment factors were analyzed on a logarithmic scale (base 2), where no quantity differences correspond to 0, two-fold up- or down-quantification to 1 and -1, respectively. Median normalization was applied so that after the normalization the median enrichment of each enrichment factor and replicate was zero. In addition, an interquartile normalization was carried out after median normalization by dividing the median normalized values by the length of the interquartile range of the corresponding enrichment factor and replicate. The reason for this was that the variation of enrichment factors for pM in terms of the length of the interquartile range and standard deviation was significantly higher than in cM and iM in all replicates. Linear discriminant analysis was applied to the three replicates separately. This result in three classifiers each of them providing a probability whether a given protein can be considered to be mitochondrial localized. Of these probabilities the median


11


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 52

was formed (LDA-Score) and a mitochondrial localization was annotated when the LDA-Score was higher than 0.5. Anti-Hex1 antibody generation The anti-Hex1 antibody SH1237-F8 was generated as described before25 by using the human naive scFv gene libraries HAL9/1026. The selection was performed on biotinylated peptide (Peps4LS, Heidelberg, Germany) (N' MGYYDDDAHGHVEAD C'). The scFv antibody was recloned into the scFv-Fc format (Yumabs, Braunschweig, Germany) with a human IgG1 Fc part by using the vector pCSE2.6-hIgG1-Fc-XP. The antibody was produced in HEK293-6E cells and purified by protein A as previously described.27 Post Embedding Protein A-Gold Labeling (EM) Mycelium of N. crassa wild-type strain (74-OR8-la) was fixed in 6% formaldehyde and 0.1% glutaraldehyde in extraction buffer (with addition of 0.1 M potassium chloride) for 4 h at RT. First, cells were washed twice with TE buffer (20 mM Tris, pH 7.4, 1 mM EDTA), treated with 0.5% (w/v) uranylacetate in TE buffer and washed again. Samples were immobilized in 2% LM-agarose, washed twice in 100 mM cacodylate (pH 7.2) for 5 min, were fixed for 1 h with glycine in 100 mM cacodylate (pH 7.2) at RT and again washed at RT for 5 min and at 4 °C over night. Dehydration was achieved with increasing concentrations of ethanol (10% and 30% at RT and 0 °C, respectively; 50, 70 and 90% each for 20 min as well as twice 100% each at -28 °C for 30 min). Further on samples were Lowicryl K4M (Fluka) infiltrated with 1:2 mixtures of K4M with ethanol (twice at -28 °C over night) and at least twice with pure resin solution (at -28 °C for 72 h and 24 h). Sample aliquots were transferred to resin-filled gelatin capsules and polymerized under UVirradiation in a “cryo-cask” for 36 h. UV-irradiation was continued at RT for 1 to 2 days. Sections


12

Page 13 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(approximately 90 nm) were cut on a Reichert Ultracut S Ultramicrotome (Leica Mikrosysteme) and picked up on 300 mesh nickel grids (Plano). Next, sections were incubated with the anti-Hex1 antibody (SH1237-F8, concentration 35 µg/mL) at 4 °C over night and washed with PBS buffer. After this a 1:200 dilution of Protein A-Gold10nm (BBI Solutions, Cardiff, UK) was added and sections were incubated for 30 min at RT. Final washing was done with PBS/Tween, PBS buffer, TE buffer and water. Samples were examined with a Libra 120 plus energy-filter transmission electron microscope (Zeiss, settings as above). Construction of NCU02128-CeGFP and ATP-1-Presequence-mCherryNC encoding constructs For eGFP (enhanced green fluorescent protein) fusion protein expression, we modified vector pCCG::C-Gly::3xFLAG28 (GenBank: FJ457001.1) by replacing the multiple cloning site (MCS) and

the

FLAG-tag

with

a

novel

sequence

stretch

(5´TCGCGATCTAGAGGATCCAGATCTCACGTGACTAGTGGAGGAATGTCCGCCTGGT CCCACCCCCAGTTCGAGAAGAGCGCTATGCATTACGTCTTAAGTGGCCATAGTGATC CCGGG´3) thus introducing two MCS separated by a linker sequence, encoding two glycine residues followed by the Strep-Tag® II sequence29. The open reading frame (ORF) of eGFP was PCR-amplified from plasmid PMF309 (GenBank: AY598430.1) by using primers eGFP-for (5´TATAATGCATGTGAGCAAGGGCGAGG´3) attaching a NsiI restriction site and eGFP-rev (5´TATATGGCCACTTGTACAGCTCGTCC´3) attaching a MscI restriction site. The CloneJET PCR Cloning Kit (Thermo Scientific) has been used for subcloning followed by sequencing of the cloned ORF. By using the attached restriction sites, eGFP was subsequently cloned into MCS II of the modified pCCG::C-Gly::3xFLAG vector, thus yielding the new plasmid pCCG-C-eGFP. Sequencing confirmed the identity of the obtained basis-vector. N. crassa D-arabinitol dehydrogenase

was

amplified

by

PCR

using

primers

NCU02128_for

(5´


13


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 52

TATATCTAGAATGGCAACCCGCGCCGTTC´3) attaching an XbaI restriction site and NCU02128_rev (5´ATAAAGATCTCGTACAAGTGTACCCCCC´3) attaching a BglII restriction site. The CloneJET PCR Cloning Kit (Thermo Scientific) was used for subcloning followed by sequencing of the cloned ORF. Subcloning into pCCG-C-eGFP yielded expression vector pCCGNCU02128-C-eGFP. The presequence-coding region of the N. crassa atp-1 gene30 fused with restriction sites allowing the following cloning steps was synthesized by Geneart (Regensburg, Germany). The sequence synthesized

was

(5´

TCGCGATCTAGAATGTTCCGGAACGCCCTCCGTCAGAGCACTCGCGCCGTCGGCGCC TTCTCTGCCACTGGCAGAGTCGCCGCGCGAAATGCCGCACCTGTAGTTTCCGCCGTC CAGGCCCGCACCTACGCCACTAGTGGAGGAATGTCCGCCTGGTCCCACCCCCAGTTC GAGAAGAGCGCTATGCATTACGTACTTAAGTGGCCATAGTGATCCCGGG´3).

The

sequence obtained was cloned into vector pMA-T. The ORF encoding codon-optimized mCherry for N. crassa (mCherryNC) was amplified by the specific primers Nc_mCherry_for (5´TTATATGCATAGCAAGGGCGAGGAGGATAAC´3)

and

Nc_mCherry_rev

(5´ATAACCCGGGATCACTTAAGCTTGTACAGCTCGTCC´3) attaching restrictions sites NsiI and XmaI, respectively. As template for PCR-based cloning we used plasmid PmFP24 (a kind gift of E. Castro-Longoria and colleagues).31 The CloneJET PCR Cloning Kit (Thermo Scientific) was used for subcloning followed by sequencing of the cloned ORF. By using the attached restriction sites, mCherryNC was subsequently cloned in frame behind the ATP-1 presequence coding region. The ORF encoding the fusion protein APT-1-Presequence-mCherryNC was next subcloned into pCCG-C-eGFP, thereby replacing C-eGFP. Sequencing confirmed the identity of the obtained expression vector.


14

Page 15 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Creation of the NCU02128-C-eGFP and ATP-1-Presequence-mCherryNC expression strains Expressions vectors were transformed into N. crassa strain (Δmus-52::bar+, his-3; Fungal Genetics Stock Center32, FGSC # 9720) as described by Margolin and Co-workers.33 Primary transformants were analyzed for fluorescence derived from GFP and mCherry, respectively, using the Leica fluorescence microscope (DM5500B) and Zeiss Axiophot-II, respectively. Subsequently single spore isolates were prepared. To do so, conidial mixtures were plated on BDES medium. 34 The latter results in a compact growth of N. crassa, thus allowing the isolation of individual colonies. For subsequent cultivation we used Vogel’s medium plus 2% sucrose and 1.5% Agar. Cultivation temperatures were 22 °C (BDES plates) and 30 °C (Vogel’s medium slant tubes). Confocal microscopy Heterokaryots were used to test for co-localization of ATP-1-Presequence-mCherryNC with NCU02128-C-eGFP (D-arabinitol-dehydrogenase-C-eGFP). Therefore, spore suspensions of the two N. crassa strains expressing different fluorescent fusion proteins were prepared and mixed in a 2:3 ratio. 20 µL of the obtained spore mixture were inoculated on an acetate agar plate (Vogel’s minimal medium plus 1.2% sodium acetate as sole carbon source and 1.5% Agarose). After over night growth at 30 °C and for at least 3 hours at RT and light, a small piece of agar was cut from the leading edge, placed on a glass slide and covered with a cover glass. Confocal laser scanning imaging was performed with a Leica TCS SP8 equipped with a Leica DMI6000 inverted microscope. eGFP was excited at 488 nm and fluorescence was detected at 500 to 556 nm. mCherryNC was excited by 561 nm and the signal was detected between 598 to 702 nm. Unidirectional sequential scanning was done line by line with a line average of 4 and a scan


15


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 52

speed of 700 Hz. The objective used was 63x/1.20 (water) and the digital zoom was 2.24. Obtained images were processed with the Leica Application Suite X and exported as .tif-files.

RESULTS AND DISCUSSION Enrichment strategy and quality control of mitochondrial purification This study is based on expertise which was established in different laboratories, allowing the consecutive and finally most accurate purification of intact mitochondria from N. crassa. Basically, mitochondria were first enriched by differential centrifugation and further purified by density-gradient-ultracentrifugation (Figure 1). In order to obtain a fraction of highly pure and intact mitochondria two aspects should be noted before: (i) Repeating the differential centrifugation procedure significantly improved the purity of crude mitochondrial extracts when starting from mycelium.11 (ii) For ultra-centrifugation iso-osmotic Percoll19 was used instead of sucrose gradients as in other studies of N. crassa mitochondria17,18.

Figure 1. Enrichment strategy for highly pure mitochondria from N. crassa. Mycelium was harvested, subsequently ground mixed with silicon dioxide particles and differentially centrifuged


16

Page 17 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


twice to obtain crude mitochondrial extracts (cM), thus enriching mitochondria (illustrated as red dots) and depleting other cellular contents (exemplarily depicted as differentially colored forms). Next the crude mitochondrial fraction was loaded onto a Percoll gradient. Upon ultracentrifugation, two brownish bands (iM) were visible: The upper band contained mitochondria as well as other cell organelles (e.g. peroxisomes, endoplasmatic reticulum), while the lower band (pM) almost exclusively contained mitochondria. In addition, a crude mycelium extract (Myc) was prepared by grinding mycelium in liquid nitrogen. Consecutive enrichment of mitochondria by this purification strategy (Figure 1) was validated at the microscopic, the enzymatic and the proteome level: First, we evaluated the purification quality at the ultrastructural level by electron microscopy (EM, Figure 2A). As expected, crude mitochondrial fraction (cM) and the upper band of the Percoll gradient (iM) were found to be contaminated by membrane fragments and non-mitochondrial organelles. In contrast, no obvious contaminants could be detected in the lower band of the final Percoll gradient by EM and thus was termed as pure mitochondria fraction (pM). Next we evaluated mitochondrial membrane integrity by the cytochrome c oxidase activity assay (for details see materials and methods section). At the stage of crude mitochondria we determined that at least 65% of the purified mitochondria could be considered as physiologically intact. Notably, by handling the samples carefully during density gradient centrifugation we were able to maintain the ratio of physiological intact mitochondria with good reproducibility (Figure 2B). While at the same time the amount of contaminants significantly decreased (Figure 2C). To specify the nature of non-mitochondrial contaminants we analyzed representative sub-cellular markers as part of the crude (cM), impure (iM) and pure (pM) mitochondrial fractions as well as in an N. crassa mycelium extract, serving as a control (Figure 2D). Overall, the relative amounts of distinct organelle marker proteins (Pex1435,36, Nit-93,37,


17


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 52

HH338, VMA-139, VPS-5239) decreased while mitochondrion-specific proteins (TOM4040–42, AAC11,43 and CPSA44) increased during enrichment. The only exception was the amount of the endoplasmic reticulum protein GRP-7839 which was less effectively reduced. Indeed, the presence of endoplasmic reticulum proteins within highly pure mitochondrial fractions is widely known.45 Only trace amounts of the cytosol (Nit-9), the vacuole (VMA-1) and the Golgi-apparatus (VPS52) were finally detectable in the pure mitochondria fractions. The advantage of a repetitive differential centrifugation became apparent because it further removed contaminants from crude mitochondria after the second step (Figure S1A, Supporting Information). In conclusion, both parts of this purification strategy, i.e. the differential centrifugation and Percoll gradient centrifugation, synergize to obtain a pure fraction with a high content of intact mitochondria. We also inspected the step-wise enrichment of mitochondria at the global level by using mass spectrometry and protein localization information as annotated in GO. Qualitative proteome experiments (LC-MS/MS) were performed consecutively from cM, iM and pM fractions as well as whole mycelium extracts, revealing differential ratios of sub-cellular compartments. Figure 2F summarizes the ratios of Proteome Discoverer areas from mitochondrial in comparison to nonmitochondrial proteins. Profiling the mycelium demonstrates the pivotal role of this organelle at the cellular level of N. crassa. Based on the peptide intensity areas we determined 23.5% of mitochondrial proteins as part of the mycelium. This ratio increases to 78.3% in pM, which underscores the efficiency of the enrichment strategy. Counting all localization information according to GO in the different fractions (more than one localization per protein is possible, Figure S2, Supporting Information), the relative enrichment of mitochondrial proteins can be validated likewise, but the number of non-mitochondrial localizations always was counted more frequently (981 versus 202 in pure mitochondria). Actually, mitochondrial proteins are often co-


18

Page 19 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


annotated as membrane, organelle lumen and cytoplasmic localized. Thus, the relative ratios of “membrane” and “organelle lumen” localization counts somewhat resemble that of the “mitochondrial” proteins.

Figure 2. Quality control of mitochondria enrichment. The pure (pM), impure (iM) and crude (cM) mitochondrial fractions were analyzed by (A) electron microscopy (scale bar corresponds to


19


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 52

2 µm) and (B) cytochrome c oxidase activity assay. (C) Absolute protein amounts were quantified for the fractions analyzed in (A) and (B). (D) Analysis of marker proteins in Myc (mycelium extract), cM, iM and pM fractions by immunodetection. (F) The relative amounts of mitochondrial (light grey) and non-mitochondrial (dark grey) localized proteins (GO) are illustrated for Myc, cM, iM and pM. Here, the peak areas as a measure of the amounts of proteins present were utilized for semi-quantitative detection of N. crassa proteins. For the sake of comparison, the relative amounts of all non-mitochondrially localized proteins were summed up instead of showing individual annotations. ER = endoplasmic reticulum, OM = outer mitochondrial membrane, IM = inner mitochondrial membrane. Overall, all experimental validations confirmed the efficiency of a step-wise enrichment of mitochondria. All fractions can be prepared with good reproducibility and qualitative proteome analyses revealed their individual compositions. It is apparent that intact mitochondria are “decorated” with variable but distinct contaminants in the investigated fractions thereby generating a prototypic enrichment profile. Strategies like protein correlation profiling (PCP46) or localization of organelle proteins by isotope tagging (LOPIT47) have previously demonstrated their power to distinguish between genuine mitochondrial and co-purified proteins.6,8,45 Therefore, we decided to establish a LOPIT-based strategy in combination with a linear discriminant analysis (LDA) thus allowing to accurately identify mitochondrially localized proteins.

Annotation of mitochondrial proteins by linear discriminant analysis To establish a LOPIT-based strategy, quantitative information on mitochondrial proteins during their consecutive enrichment is required. Therefore, three independent mitochondria purifications


20

Page 21 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


were carried out and in each case, proteins of the four major fractions, the mycelium, cM, iM and pM (Figure 1), were differentially labeled by iTRAQ™, combined and relatively quantified during peptide sequencing by accurate mass spectrometry (SCX-LC-MS/MS). Overall we obtained quantitative data for 2422 proteins (File S1, Supporting Information), which include 245 proteins already annotated as mitochondrial in GO, and Venn diagrams revealed that mitochondrial annotations in comparison to non-mitochondrial annotations were achieved with a better reproducibility (66.7 % versus 87.7 % in Figure S1B, Supporting Information). We then validated whether proteins from the different mitochondrial compartments were covered representatively. Sub-mitochondrial localization information was available for about 100 identified proteins in GO (Figure S3, Supporting Information). As expected, the majority of these proteins were annotated as being localized in the inner membrane (IM, 58 proteins) followed by matrix (23 proteins), the outer membrane (OM, 19 proteins) and the intermembrane space (IMS, 7 proteins). Since matrix and IMS proteins were detected with representative ratios these data are in accordance with our cytochrome c oxidase assay (Figure 2B), thus confirming the intactness of mitochondria. Data evaluation then focused on the detection of quantitative profiles, which are prototypic for the step-wise enrichment of mitochondria or in turn correlate with the decreasing protein amounts of components from other subcellular compartments. Here, we took advantage of the fact that organelle localization information was available for 1090 quantified proteins in GO, and thus pattern ascertainment was not limited by using only a few marker proteins. Indeed, proteins belonging to different organelles exhibited variable quantitative profiles, wherein mitochondrial proteins showed the most distinct pattern (Figure 3A). Thereby, the importance of combining differential and density gradient centrifugation becomes apparent. Differential centrifugation can


21


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 52

remove other organelles with the exception of the ER. In turn, density gradient centrifugation acts complementarily and removes the ER but not vacuolar components efficiently. In combination, this not only results in pure mitochondria but also allows a step-wise sampling of fractions for relative proteome analyses and the generation of enrichment profiles.

Figure 3. iTRAQ-based quantification and clustering of mitochondrial proteins in comparison to proteins from distinct organelle localizations. (A) Enrichment profiles of proteins from different organelles according to iTRAQ quantification ratios. Samples derived from mycelium extract


22

Page 23 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Myc), crude (cM), impure (iM) and pure (pM) mitochondrial fractions. (B) Distribution of annotated proteins (according to GO) based on iTRAQ quantification ratios. (C) Classification by linear discriminant analyses (LDA) based on iTRAQ quantification ratios of all identified proteins. The analytical value of these regulatory profiles became even more obvious by plotting log2enrichment ratios of the 1090 GO-annotated proteins in a 3D-diagram (Figure 3B). Two distinct ellipsoidal clusters became apparent. Notably, the group of 245 mitochondrial proteins (training data set) defines almost exclusively the upper cluster, whereas proteins with non-mitochondrial annotations are grouped together in the lower cluster (Figure 3B). This constituted a promising basis to rationalize by means of statistics, which of the identified but so far not annotated proteins are also part of the mitochondrial compartment. Because the mitochondrial and non-mitochondrial proteins form two distinct ellipsoidal clusters, linear discriminant analysis (LDA) is the natural choice for the statistical data evaluation. LDA is a classification method predicting correct classes – here mitochondrial or non-mitochondrial – under the assumption that the distinct classes follow multivariate normal distributions, i.e. they form ellipsoidal clusters. 3D-data representation of the total data set (including proteins not annotated in GO) actually maintained both ellipsoidal clusters and therefore further confirmed the distinct clustering of mitochondrial proteins based on representative regulatory profiles. Importantly, the LDA approach was optimized with conservative settings that tend to reject than accept mitochondrial annotations. Thereby, LDA-Scores higher than 0.5 are a robust indication of mitochondrial components, as for instance the LDA-Score of cytochrome c148 which was determined as 0.54 (File S1, Supporting Information). In that way, the LDA model established in this study was applied to the classification of proteins without GO annotations. In total, LDA-based classification annotated 512 out of 2422 identified proteins as mitochondrially localized (Figure 3C).


23


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 52

The conservative character of this annotation and the used LDA-settings was documented by the inspection of per se mitochondrial components. Since LDA parameters were defined for an unambiguous annotation of the mitochondrial compartment, some per se mitochondrial players might be rejected, e.g. based on limited regulatory data qualities. Indeed, this study identified a total of 31 proteins of the respiratory chain, whereof 30 were confirmed as mitochondrially localized by LDA. The 20.9 kDa subunit of the NADH-ubiquinone oxidoreductase just missed the classification criteria (LDA-Score of 0.47) although its regulatory profile basically looks prototypic similar to other mitochondrial proteins (File S1, Supporting Information). We next evaluated whether metabolic pathways involving both the cytosolic and mitochondrial compartment were correctly annotated. As for the respiratory chain, this study provides comprehensive data for the heme biosynthesis pathway. Enzymes of this pathway are known to act both in the cytosol and mitochondria, thus making them ideal candidates for testing the established classification method. We detected all heme pathway components in the investigated fractions, with the exception of protoheme IX farnesyltransferase (COX10), and classified them by LDA. Indeed, LDA determines mitochondrial and cytosolic localizations fully in accordance with our understanding of how this pathway is spatially organized (Figure 4). In conclusion, data evaluation of known mitochondrial enzymes and pathways confirm that this LDA-based approach is suitable for the robust recognition of mitochondrial functions.


24

Page 25 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Heme biosynthesis pathway and heme integration in target enzymes (Franken and coworkers49 modified). The coloring of the enzymes indicates the clustering within the current data (dark green – mitochondrial; red – probably non-mitochondrial; white – not identified by MS). Proteins were matched to associated reactions and genes by KEGG pathway50 of N. crassa (http://www.genome.jp/kegg/pathway.html). ALAS (Q7RVY5) – 5′-aminolevulinic acid synthase; ALAD (Q7S819) – 5’-aminolevulinic acid dehydratase; PBGD (Q6MW51) – porphobilinogen deaminase: UROS (Q7S4P0) – uroporphyrinogen III synthase; UROD (Q7SE23) – uroporphyrinogen III decarboxylase; CPO (F5H9D4) – coproporphyrinogen III oxidase, PPO (V5IQT0; identified by BLAST search with P40012 from Saccharomyces cerevisiae) – protoporphyrinogen oxidase; FC (Q7SA94) – ferrochelatase; CCHL (Q7S3Z2 / P14187) – cytochrome c heme-lyase; COX10 (Q7S5E7) – protoheme IX farnesyltransferase; COX15 (Q7S6L8) – cytochrome c oxidase assembly protein subunit 15; MET1 (Q7SI49) – uroporphyrin-


25


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 52

III C-methyltransferase; MET8 (Q7SBH1) – precorrin-2 dehydrogenase / sirohydrochlorin ferrochelatase (MET conforms to S. cerevisiae nomenclature). What is known, what is new? Proteome analyses of highly pure mitochondria and LDA scoring classified 512 proteins as mitochondrially localized indicating that this study covers information for about half of the predicted mitochondrial proteome of fungi.9 However, the GO database initially listed only 245 of all identified proteins as mitochondrial components. This discrepancy highlights a significant lack of information in one of our major biological databases and additionally raised the question which part of the mitochondrial proteome of N. crassa identified here is known and which is new? As in other proteome studies, central mitochondrial processes were covered almost completely. This includes all major components of the respiratory chain complexes13, the protein import machinery51 such as TOM and TIM proteins, mitochondrially localized ribosomes16 and proteins of the outer membrane14,15 and the heme biosynthesis49 (File S1, Supporting Information). Indeed, not only those 245 proteins but the vast majority of the N. crassa mitochondrial proteome characterized in this study is known to be mitochondrially localized at least when considering results obtained from other organisms. As a complementation of the GO database we also evaluated N. crassa specific data from Uniprot52, proteome studies17,18, the N. crassa genome database53,54 and MitoP220. In total, 89% of the 512 proteins have been previously described as mitochondrial components in N. crassa. However, 57 proteins (Table 1 and File S1, Supporting Information), which had not been previously reported for N. crassa remained and thus complement our knowledge about of the mitochondrial inventory of this organism. According to UniProt the majority of those proteins


26

Page 27 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


have not yet been characterized, although our BLAST55,56 searches suggest enzymatic functions for 26 out of 36. A further 15 of the 57 proteins have already been characterized in the context of mitochondria from other organisms (e.g. tryptophanyl-tRNA synthetase, thioesterase, protein phosphatase and malonyl CoA-acyl carrier protein transacylase). Interestingly, the group of 57 also indicates the presence of six enzymatic activities, which were neither reported for mitochondria from N. crassa nor for any other organism. Of those novel proteins, Hex1 and the Dyp-type peroxidase (Table 1 and File S1, Supporting Information) were detected with the highest abundances and robust LDA values. Hex1 was previously described as a major component of the so-called Woronin body, a fungi-specific organelle of peroxisomal origin.57–59 By using a self-developed anti-Hex1 antibody we confirmed its localization in Woronin bodies as published before.59 In addition, we detected a weak staining in the cytosol which may represent cytosolic Hex1 which needs to be actively transported into the peroxisomal compartment.36,60 Weak staining was also detectable in mitochondria. However, preliminary analysis of a Hex1-C-eGFP encoding construct by confocal microscopy showed a ubiquitous cytosolic distribution but confirmed neither mitochondrial nor Woronin body localization (data not shown). Therefore, further experiments are required to validate Hex1 as a mitochondrially localized functional protein in N. crassa. Even less information is available for the identified Dyp-type peroxidase.61 This enzyme belongs to the family of heme peroxidases,62 which also occurs in plants and animals. In mitochondria this peroxidase might realize a so far not described degradation/detoxification process, and/or with respect to its heme group, requires the mitochondrial compartment and herein located hemebiosynthesis for its own assembly.


27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 52

Figure 5. Detection of Hex1 localization by Post-embedding Protein A-Gold Labeling. Transmission electron micrographs show cells of N. crassa. 90 nm ultrathin sections were incubated with anti-Hex1 recombinant antibody SH1237-F8 and were tagged subsequently with protein A-10 nm gold conjugates (A and C with enlarged boxed areas). Gold particles (black dots) localize Hex1 mainly in Woronin bodies (W in A) but also in other organelles like mitochondria (M) and the cytosol (A and B). CW – cell wall, V – vacuole, scale bars correspond to 1 µm (above) and 0.5 µM (below). Interestingly, we detected two dehydrogenases among the six novel mitochondrial proteins (Table 1 and File S1, Supporting Information), which indicate alternative metabolic routes to provide NADH for the oxidative phosphorylation. In Candida albicans the D-arabinitol dehydrogenase catalyzes the dephosphorylation and reduction from D-ribulose-5-phosphate to D-arabinitol.63 Furthermore, also the reverse reaction is described for this enzyme, whereby D-ribulose is


28

Page 29 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


metabolized in growth.64 To verify mitochondrial localization, the D-arabinitol dehydrogenase was fused to C-eGFP and expressed in N. crassa. Mitochondrial localization was revealed upon imaging of a heterokaryon, expressing the mitochondrial marker N. crassa ATP-1-Presequence30 fused to mCherryNC31 and the D-arabinitol dehydrogenase C-eGFP fusion (Figure 6). The NADdependent methanol dehydrogenase at least has low sequence similarities (52% identity, BLAST55,56) to mammalian hydroxyacid-oxoacid transhydrogenases, which actually are mitochondrially localized. In conclusion, both dehydrogenases can support respiration in mitochondria, but the involved metabolic routes remain widely undefined at this stage.


29


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 52

Figure 6. Mitochondrial localization of the D-arabinitol dehydrogenase C-eGFP fusion protein. (A) Subcellular localization of the D-arabinitol dehydrogenase C-eGFP fusion protein, (B) subcellular localization of ATP-1-Presequence-mCherryNC, (C) overlay of the signals obtained for (A) and (B). Scale bar corresponds to 10 µm.


30

Page 31 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


CONCLUSION Mitochondria play the pivotal role for energy metabolism and in addition contribute to the spatial organization of numerous cellular processes. There is growing evidence of their variable composition, e.g. in different human tissues, whereby a total of 1000 to 1500 proteins are considered to integrate in or associate with mitochondria in different eukaryotes and physiological conditions. Accurate mass spectrometry of course can unambiguously identify proteins as part of fractions enriched with mitochondria. However, none of the available purification protocols yield 100% pure mitochondria and the decision whether identified proteins are genuine mitochondrial components or contaminants still remains a challenging task. By using N. crassa as a model system, a strategy to define the mitochondrial proteome irrespective of multiple localizations within the cell was established. The approach takes advantage of two facts: (i) Components belonging to the same organelle-type remain linked even along a multi-step purification procedure. In this study, combination of differential and density ultra-centrifugation results in a highly pure mitochondrial fraction, but importantly also generates distinct intermediate fractions. In concert, relative quantitative data of all these fractions contain representative regulation profiles also of genuine mitochondrial components. (ii) Although not complete, information on localization in the Gene Ontology database can be considered as robust and thus each identified mitochondrial component strengthened the training data set for cluster analyses. To rationalize the definition of the mitochondrial proteome of N. crassa based on the apparent discriminative quality of the regulatory profiles this study employed linear-discriminant analyses (LDA), which supported a conservative annotation. With LDA parameters used in this study we accepted the rejection of weaker data points and a few well-known mitochondrial components, but in turn supported a conservative annotation with lowest risk for false positives. For instance,


31


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 52

pathways spanning the border between mitochondria and cytoplasm, like the heme biosynthesis, were depicted by LDA with accurate localizations of enzymes for both compartments. In total, this proteome study detected half of the predicted 1000 mitochondrial proteins of fungi, whereby 57 proteins were annotated in this way for the first time for N. crassa and six known enzymes were novel for mitochondria in general (Table 1). Among those, the D-arabinitol dehydrogenase was verified to localize in mitochondria by confocal microscopy. In conclusion, this study recommends employing enrichment profiles and linear discriminant analyses to complement missing mitochondrial annotations and importantly to better target the variability of mitochondrial proteomes not only in N. crassa.


32

Page 33 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. Proteins for first time categorized as mitochondrial in N. crassa. UniProt accession (gene locus)

P87252 (NCU08332) Q7S3A4 (NCU09210) V5IRR9 (NCU16466) V5IP06 (NCU02128) Q7S5L5 (NCU05828) Q1K8U3 (NCU06740) Q7S7U5 (NCU04114) V5IPG4 (NCU01436) V5IP95 (NCU16844) Q7S228 (NCU09886) A7UWJ0 (NCU11129) Q7SI66 (NCU00584) V5IN02 (NCU16742) Q7S6F1 (NCU07072) Q7S8P2 (NCU08661) Q7S3A0 (NCU09222) V5IQT0 (NCU16396) Q7RZE2 (NCU04078) Q7S8M7 (NCU06587) Q7S1P8 (NCU09517)

Protein name / description*

MW [kDa]

Median MudPit score (PD)

LDAScore

Woronin body major protein (Hex1)#

19.13

7598.24

0.71

Dyp-type peroxidase#

58.07

4759.85

0.81

Nucleic acid-binding protein

38.19

2225.04

0.80

D-arabinitol dehydrogenase#$

38.70

423.13

0.81

amidohydrolase

102.59

776.93

0.56

NADH-ubiquinone reductase complex 1 MLRQ subunit

10.99

623.01

0.84

transcription factor C6

8.24

614.87

0.84

NADH dehydrogenase (predicted)

9.84

452.34

0.56

alpha-1,2 glucosyltransferase alg10-like protein

10.34

453.40

0.86

mesaconyl-C4 CoA hydratase

39.87

403.07

0.79

Carboxypeptidase s

66.14

398.46

0.52

thioesterase family protein

35.88

360.16

0.52

Metallo-hydrolase/oxidoreductase

20.88

254.88

0.89

Galactose-1-phosphate uridylyltransferase#

61.63

342.91

0.54

Pantoate-beta-alanine ligase#

47.61

283.53

0.64

Uncharacterized protein

12.65

202.45

0.86

protoporphyrinogen oxidase

72.58

464.13

0.60

NAD-dependent methanol dehydrogenase#

54.27

173.32

0.70

Mitochondrial 18kDa protein

35.16

213.24

0.60

squalene/phytoene synthase

42.47

389.39

0.55


33


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

UniProt accession (gene locus)

Q7S0F0 (NCU10028) V5IRJ3 (NCU16496) U9W8A6 (NCU16657) Q7RYA5 (NCU04502) Q1K7V9 (NCU01307) Q7S204 (NCU09895) Q7S9Y3 (NCU07935) V5IM60 (NCU17114) U9W321 (NCU06220) Q7S2X6 (NCU08994) Q7SBV1 (NCU07858) Q7SGH8 (NCU00944) V5IQE0 (NCU16833) Q1K4P5 (NCU03495) Q7RYV8 (NCU06461) A7UXA6 (NCU10169) Q1K616 (NCU04010) Q7RXM3 (NCU00203) Q7S020 (NCU08579) Q1K7F8 (NCU03817) Q1K7F9 (NCU03816)

Page 34 of 52


MW [kDa]


LDAScore

Bax Inhibitor family protein

38.18

140.30

0.54

NUDIX family hydrolase

51.18

136.87

0.76

Tryptophanyl-tRNA synthetase

46.98

281.45

0.67

SET domain protein

12.06

179.39

0.75

rhomboid family membrane protein

29.97

224.20

0.74

Thioesterase

32.02

260.69

0.52

Caffeine-induced death protein Cid2

22.13

63.77

0.62

mitochondrial 54S ribosomal protein YmL39

7.01

154.58

0.68


53.58

120.39

0.65

45.51

169.38

0.73

28.96

129.07

0.89

L-allo-threonine aldolase

50.49

165.21

0.54

ring finger domain protein

22.80

208.37

0.76

Protein phosphatase 2c

76.77

118.40

0.64

glutathione S-transferase-like protein

101.99

105.75

0.69

YebC-like protein

26.35

112.44

0.69

Malonyl CoA-acyl carrier protein transacylase

48.48

95.40

0.73

SIR2 family histone deacetylase

45.08

151.24

0.67

Ubiquitin carboxyl-terminal hydrolase

68.18

115.00

0.67

FMI1 protein

43.07

72.08

0.57

Modification methylase HemK

47.88

88.83

0.63

MOZ protein represents a chromatinassociated acetyltransferase NADH dehydrogenase [ubiquinone] 1 alpha subcomplex assembly factor-like protein


34

Page 35 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


UniProt accession (gene locus)

Q7SDV5 (NCU03135) Q7S1H8 (NCU09303) U9W558 (NCU00458) Q7SH55 (NCU02674) V5IKY3 (NCU07782) V5IKM3 (NCU17240) Q7S6P7 (NCU04788) V5IR00 (NCU06844) Q7S2Z7 (NCU07552) Q1K533 (NCU03334) Q7S9F6 (NCU06391) Q7S984 (NCU07283) Q7RYQ0 (NCU00411) Q7SHP0 (NCU02577) V5ILK9 (NCU12112) Q7RXI6 (NCU03997)


MW [kDa]


LDAScore

Cytochrome c oxidase biogenesis protein

23.27

100.77

0.51


52.79

144.86

0.50

Beta-ketoacyl synthase

24.16

194.92

0.51

pentatricopeptide repeat protein

94.10

102.87

0.52

thioesterase thiol ester dehydrase-isomerase

34.36

118.21

0.77

87.72

138.84

0.57

32.91

80.34

0.66


18.65

60.97

0.53


56.80

148.82

0.54


15.52

114.94

0.54


86.38

75.79

0.74


44.77

75.12

0.71


21.67

74.10

0.58

paired amphipathic helix protein

45.00

63.27

0.64

Cell division protein ftsj, variant

52.68

60.20

0.68

exosome complex exonuclease

10.64

59.87

0.51

S-adenosyl-L-methionine-dependent methyltransferase, partial Cytosolic Fe-S cluster assembling factor NBP35

LDA-Scores higher than 0.5 imply mitochondrial classification, MudPit-Score – PD provided a Score, which under these experimental conditions is defined as MudPit-Score, here the median over all three replicates is mentioned, * BLAST results in italic (for more details see File S1 second data sheet ‘BLAST results’, Supporting Information), # - not reported for mitochondria in general before, PD – Proteome Discoverer, LDA – linear discriminant analysis, MW – Molecular weight, $ - verified by confocal microscopy


35


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 52

ASSOCIATED CONTENT Supporting Information Available: This material is available free of charge via the Internet at http://pubs.acs.org Supplemental Table S1. Antibodies against organelle marker proteins for immunodetection. Supplemental File S1. Mitochondrial classification by linear discriminant analysis (sheet 1) and BLAST results of 'uncharacterized proteins' (sheet 2). Supplemental Figure S1. Immunodetection of marker proteins within supernatants and reproducibility of proteome data. Supplemental Figure S2. Enrichment effects of mitochondrially localized proteins during purification. Supplemental Figure S3. Sub-organelle localization of identified mitochondrial proteins.

ACKNOWLEDGEMENTS The authors thank Uwe Kärst and Amanda Mühlmann for revision of this manuscript as well as Reiner Munder, Ingeborg Kristen, Saskia Helmsing, Anke Oelbermann and Ute Nieländer for excellent technical assistance. Furthermore, we thank Sabine Buchmeier, Brigitte Jockusch, Frank Nargang, Wolfgang Girzalsky, Ralf Erdmann and Christian Erck for best working antibodies. We thank Jens Jurgeleit for cultivating N. crassa and Reinhard W. Köster for constant support with confocal microscopy. Additionally we thank the Protein analytics platform of the HZI for support


36

Page 37 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with MS-analysis and Perter Braun for inspection of candidate proteins. We acknowledge the FGSC (Kansas City, Missouri USA) for continuous support. Financial support for this study was provided by the Deutsche Forschungsgemeinschaft (FOR 1220, PROTRAIN).

ABBREVIATIONS cM, crude mitochondrial fraction; eGFP, enhanced green fluorescent protein; EM, electron microscopy; ER, endoplasmic reticulum; FGSC, Fungal Genetics Stock Center; GO, Gene Ontology; iM, impure mitochondrial fraction; IM, mitochondrial inner membrane; IMS, mitochondrial intermembrane space; iTRAQ, isobaric tag for relative and absolute quantitation; LC, liquid chromatography; LOPIT, localization of Organelle Proteins by Isotope Tagging; MCS, multiple cloning site; MS, mass spectrometry; Myc, mycelium fraction; OM, mitochondrial outer membrane; ORF, open reading frame; PCP, protein correlation profiling; pM, pure mitochondrial fraction; RT, room temperature; SCX, strong cation exchange chromatography.

REFERENCES (1)

Da Cruz, S.; Parone, P. A.; Martinou, J.-C. Building the mitochondrial proteome. Expert Rev Proteomics 2005, 2, 541–551.

(2)

Pagliarini, D. J.; Rutter, J. Hallmarks of a new era in mitochondrial biochemistry. Genes Dev 2013, 27, 2615–2627.

(3)

Mendel, R. R.; Kruse, T. Cell biology of molybdenum in plants and humans. Biochim Biophys Acta - Mol Cell Res 2012, 1823, 1568–1579.

(4)

Vafai, S. B.; Mootha, V. K. Mitochondrial disorders as windows into an ancient organelle. Nature 2012, 491, 374–383.

(5)

Yan, W.; Aebersold, R.; Raines, E. W. Evolution of organelle-associated protein profiling. J Proteomics 2009, 72, 4–11.


37


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 38 of 52

(6)

Zhang, J.; Lin, A.; Powers, J.; Lam, M. P.; Lotz, C.; Liem, D.; Lau, E.; Wang, D.; Deng, N.; Korge, P.; et al. Mitochondrial proteome design: From molecular identity to pathophysiological regulation. J Gen Physiol 2012, 139, 395–406.

(7)

Pagliarini, D. J.; Calvo, S. E.; Chang, B.; Sheth, S. A.; Vafai, S. B.; Ong, S.-E.; Walford, G. A.; Sugiana, C.; Boneh, A.; Chen, W. K.; et al. A Mitochondrial Protein Compendium Elucidates Complex I Disease Biology. Cell 2008, 134, 112–123.

(8)

Calvo, S. E.; Mootha, V. K. The Mitochondrial Proteome and Human Disease. Annu Rev Genomics Hum Genet 2010, 11, 25–44.

(9)

Meisinger, C.; Sickmann, A.; Pfanner, N. The Mitochondrial Proteome: From Inventory to Function. Cell 2008, 134, 22–24.

(10)

Fagerberg, L.; Stadler, C.; Skogs, M.; Hjelmare, M.; Jonasson, K.; Wiking, M.; Åbergh, A.; Uhlén, M.; Lundberg, E. Mapping the Subcellular Protein Distribution in Three Human Cell Lines. J Proteome Res 2011, 10, 3766–3777.

(11)

Nargang, F. E.; Rapaport, D. Neurospora crassa as a Model Organism for Mitochondrial Biogenesis. In Mitochondria; Leister, D.; Herrmann, J. M., Eds.; Methods in Molecular Biology; Humana Press, 2007; Vol. 372, pp. 107–123.

(12)

Borkovich, K. A.; Alex, L. A.; Yarden, O.; Freitag, M.; Turner, G. E.; Read, N. D.; Seiler, S.; Bell-Pedersen, D.; Paietta, J.; Plesofsky, N.; et al. Lessons from the Genome Sequence of Neurospora crassa: Tracing the Path from Genomic Blueprint to Multicellular Organism. Microbiol Mol Biol Rev 2004, 68, 1–108.

(13)

Marques, I.; Dencher, N. A.; Videira, A.; Krause, F. Supramolecular Organization of the Respiratory Chain in Neurospora crassa Mitochondria. Eukaryot Cell 2007, 6, 2391– 2405.

(14)

Mannella, C. A. Structure of the outer mitochondrial membrane: ordered arrays of porelike subunits in outer-membrane fractions from Neurospora crassa mitochondria. J Cell Biol 1982, 94, 680–687.

(15)

Schmitt, S.; Prokisch, H.; Schlunck, T.; Camp, D. G.; Ahting, U.; Waizenegger, T.; Scharfe, C.; Meitinger, T.; Imhof, A.; Neupert, W.; et al. Proteome analysis of mitochondrial outer membrane from Neurospora crassa. Proteomics 2006, 6, 72–80.

(16)

Gan, X.; Arita, K.; Isono, S.; Kitakawa, M.; Yoshino, K.; Yonezawa, K.; Kato, A.; Inoue, H.; Isono, K. Identification and comparative analysis of the large subunit mitochondrial ribosomal proteins of Neurospora crassa. FEMS Microbiol Lett 2006, 254, 157–164.

(17)

Keeping, A.; DeAbreu, D.; DiBernardo, M.; Collins, R. A. Gel-based mass spectrometric and computational approaches to the mitochondrial proteome of Neurospora. Fungal Genet Biol 2011, 48, 526–536.


38

Page 39 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(18)

Summers, W. A. T.; Wilkins, J. A.; Dwivedi, R. C.; Ezzati, P.; Court, D. A. Mitochondrial dysfunction resulting from the absence of mitochondrial porin in Neurospora crassa. Mitochondrion 2012, 12, 220–229.

(19)

Wieckowski, M. R.; Giorgi, C.; Lebiedzinska, M.; Duszynski, J.; Pinton, P. Isolation of mitochondria-associated membranes and mitochondria from animal tissues and cells. Nat Protoc 2009, 4, 1582–1590.

(20)

Elstner, M.; Andreoli, C.; Ahting, U.; Tetko, I.; Klopstock, T.; Meitinger, T.; Prokisch, H. MitoP2: An Integrative Tool for the Analysis of the Mitochondrial Proteome. Mol Biotechnol 2008, 40, 306–315.

(21)

Vogel, H. A convenient growth medium for Neurospora. Microbila Genet Bull 1956, 13, 42 – 43.

(22)

Laemmli, U. K. Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4. Nature 1970, 227, 680–685.

(23)

Ashburner, M.; Ball, C. A.; Blake, J. A.; Botstein, D.; Butler, H.; Cherry, J. M.; Davis, A. P.; Dolinski, K.; Dwight, S. S.; Eppig, J. T.; et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 2000, 25, 25–29.

(24)

Wessel, D.; Flügge, U. I. A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal Biochem 1984, 138, 141–143.

(25)

Frenzel, A.; Kügler, J.; Wilke, S.; Schirrmann, T.; Hust, M. Construction of human antibody gene libraries and selection of antibodies by phage display. Methods Mol Biol 2014, 1060, 215–243.

(26)

Kügler, J.; Wilke, S.; Meier, D.; Tomszak, F.; Frenzel, A.; Schirrmann, T.; Dübel, S.; Garritsen, H.; Hock, B.; Toleikis, L.; et al. Generation and analysis of the improved human HAL9/10 antibody phage display libraries. BMC Biotechnol 2015, 15, 10.

(27)

Jäger, V.; Büssow, K.; Wagner, A.; Weber, S.; Hust, M.; Frenzel, A.; Schirrmann, T. High level transient production of recombinant antibodies and antibody fusion proteins in HEK293 cells. BMC Biotechnol 2013, 13, 52.

(28)

Honda, S.; Selker, E. U. Tools for fungal proteomics: Multifunctional neurospora vectors for gene replacement, protein expression and protein purification. Genetics 2009, 182, 11– 23.

(29)

Schmidt, T. G. M.; Skerra, A. The Strep-tag system for one-step purification and highaffinity detection or capturing of proteins. Nat Protoc 2007, 2, 1528–1535.


39


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 52

(30)

Fuchs, F.; Prokisch, H.; Neupert, W.; Westermann, B. Interaction of mitochondria with microtubules in the filamentous fungus Neurospora crassa. J Cell Sci 2002, 115, 1931– 1937.

(31)

Castro-Longoria, E.; Ferry, M.; Bartnicki-Garcia, S.; Hasty, J.; Brody, S. Circadian rhythms in Neurospora crassa: dynamics of the clock component frequency visualized using a fluorescent reporter. Fungal Genet Biol 2010, 47, 332–341.

(32)

McCluskey, K.; Wiest, A.; Plamann, M. The fungal genetics stock center: A repository for 50 years of fungal genetics research. J Biosci 2010, 35, 119–126.

(33)

Margolin, B. S.; Freitag, M.; Selker, E. U. Improved plasmids for gene targeting at the his-3 locus of Neurospora crassa by electroporation. Fungal Genet Newsl 1997, 44, 34– 36.

(34)

Davis, R. H.; de Serres, F. J. Genetic and microbiological research techniques for Neurospora crassa. Methods Enzym 1970, 17, 79–143.

(35)

Grant, P.; Ahlemeyer, B.; Karnati, S.; Berg, T.; Stelzig, I.; Nenicu, A.; Kuchelmeister, K.; Crane, D. I.; Baumgart-Vogt, E. The biogenesis protein PEX14 is an optimal marker for the identification and localization of peroxisomes in different cell types, tissues, and species in morphological studies. Histochem Cell Biol 2013, 140, 423–442.

(36)

Managadze, D.; Würtz, C.; Sichting, M.; Niehaus, G.; Veenhuis, M.; Rottensteiner, H. The Peroxin PEX14 of Neurospora crassa is Essential for the Biogenesis of Both Glyoxysomes and Woronin Bodies. Traffic 2007, 8, 687–701.

(37)

Probst, C.; Ringel, P.; Boysen, V.; Wirsing, L.; Alexander, M. M.; Mendel, R. R.; Kruse, T. Genetic characterization of the Neurospora crassa molybdenum cofactor biosynthesis. Fungal Genet Biol 2014, 66, 69–78.

(38)

Thermo Scientific. Histone H3 Antibody, http://www.pierce-antibodies.com/Histone-H3antibody-Polyclonal--PA128871.html#.

(39)

Bowman, B. J.; Draskovic, M.; Freitag, M.; Bowman, E. J. Structure and Distribution of Organelles and Cellular Location of Calcium Transporters in Neurospora crassa. Eukaryot Cell 2009, 8, 1845–1855.

(40)

Kiebler, M.; Pfaller, R.; Söllner, T.; Griffiths, G.; Horstmann, H.; Pfanner, N.; Neupert, W. Identification of a mitochondrial receptor complex required for recognition and membrane insertion of precursor proteins. Nature 1990, 348, 610–616.

(41)

Künkele, K. P.; Heins, S.; Dembowski, M.; Nargang, F. E.; Benz, R.; Thieffry, M.; Walz, J.; Lill, R.; Nussberger, S.; Neupert, W. The preprotein translocation channel of the outer membrane of mitochondria. Cell 1998, 93, 1009–1019.


40

Page 41 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(42)

Ahting, U.; Thieffry, M.; Engelhardt, H.; Hegerl, R.; Neupert, W.; Nussberger, S. Tom40, the pore-forming component of the protein-conducting TOM channel in the outer membrane of mitochondria. J Cell Biol 2001, 153, 1151–1160.

(43)

Sherman, E. L.; Taylor, R. D.; Go, N. E.; Nargang, F. E. Effect of mutations in Tom40 on Stability of the translocase of the outer mitochondrial membrane (TOM) complex, assembly of Tom40, and import of mitochondrial preproteins. J Biol Chem 2006, 281, 22554–22565.

(44)

Davis, R. H.; Ristow, J. L.; Hanson, B. A. Carbamyl phosphate synthetase A of Neurospora crassa. J Bacteriol 1980, 141, 144–155.

(45)

Zhang, J.; Li, X.; Mueller, M.; Wang, Y.; Zong, C.; Deng, N.; Vondriska, T. M.; Liem, D. A.; Yang, J.-I.; Korge, P.; et al. Systematic characterization of the murine mitochondrial proteome using functionally validated cardiac mitochondria. Proteomics 2008, 8, 1564– 1575.

(46)

Andersen, J. S.; Wilkinson, C. J.; Mayor, T.; Mortensen, P.; Nigg, E. A.; Mann, M. Proteomic characterization of the human centrosome by protein correlation profiling. Nature 2003, 426, 570–574.

(47)

Dunkley, T. P. J.; Watson, R.; Griffin, J. L.; Dupree, P.; Lilley, K. S. Localization of Organelle Proteins by Isotope Tagging (LOPIT). Mol Cell Proteomics 2004, 3, 1128– 1134.

(48)

Römisch, J.; Tropschug, M.; Sebald, W.; Weiss, H. The primary structure of cytochrome c1 from Neurospora crassa. Eur J Biochem 1987, 164, 111–115.

(49)

Franken, A.; Lokman, B.; Ram, A.; Punt, P.; van den Hondel, C.; de Weert, S. Heme biosynthesis and its regulation: towards understanding and improvement of heme biosynthesis in filamentous fungi. Appl Microbiol Biotechnol 2011, 91, 447–460.

(50)

Ogata, H.; Goto, S.; Sato, K.; Fujibuchi, W.; Bono, H.; Kanehisa, M. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res 1999, 27, 29–34.

(51)

Schmidt, O.; Pfanner, N.; Meisinger, C. Mitochondrial protein import: from proteomics to functional mechanisms. Nat Rev Mol Cell Biol 2010, 11, 655–667.

(52)

The UniProt Consortium. UniProt: a hub for protein information. Nucleic Acids Res 2015, 43, D204–D212.

(53)

Galagan, J. E.; Calvo, S. E.; Borkovich, K. A.; Selker, E. U.; Read, N. D.; Jaffe, D.; FitzHugh, W.; Ma, L.-J.; Smirnov, S.; Purcell, S.; et al. The genome sequence of the filamentous fungus Neurospora crassa. Nature 2003, 422, 859–868.


41


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 42 of 52

(54)

Broad Institute of Harvard and MIT. Neurospora crassa Sequencing Project http://www.broadinstitute.org/.

(55)

Altschul, S. F.; Madden, T. L.; Schäffer, A. A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D. J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res 1997, 25, 3389–3402.

(56)

Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J. Basic local alignment search tool. J Mol Biol 1990, 215, 403–410.

(57)

Tenney, K.; Hunt, I.; Sweigard, J.; Pounder, J. I.; McClain, C.; Bowman, E. J.; Bowman, B. J. hex-1, a Gene Unique to Filamentous Fungi, Encodes the Major Protein of the Woronin Body and Functions as a Plug for Septal Pores. Fungal Genet Biol 2000, 31, 205–217.

(58)

Markham, P.; Collinge, A. J. Woronin bodies of filamentous fungi. FEMS Microbiol Lett 1987, 46, 1–11.

(59)

Liu, F.; Ng, S. K.; Lu, Y.; Low, W.; Lai, J.; Jedd, G. Making two organelles from one: Woronin body biogenesis by peroxisomal protein sorting. J Cell Biol 2008, 180, 325–339.

(60)

Tey, W. K.; North, A. J.; Reyes, J. L.; Lu, Y. F.; Jedd, G. Polarized gene expression determines woronin body formation at the leading edge of the fungal colony. Mol Biol Cell 2005, 16, 2651–2659.

(61)

Colpa, D. I.; Fraaije, M. W.; Van Bloois, E. DyP-type peroxidases: A promising and versatile class of enzymes. J Ind Microbiol Biotechnol 2014, 41, 1–7.

(62)

Sugano, Y. DyP-type peroxidases comprise a novel heme peroxidase family. Cell Mol Life Sci 2009, 66, 1387–1403.

(63)

Wong, B.; Murray, J. S.; Castellanos, M.; Croen, K. D. D-Arabitol metabolism in Candida albicans: Studies of the biosynthetic pathway and the gene that encodes NAD-dependent D-arabitol dehydrogenase. J Bacteriol 1993, 175, 6314–6320.

(64)

Fraser-Reid, B. O.; Tatsuta, K.; Thiem, J. Glycoscience - Chemistry and Chemical Biology I-III; Glycoscience: Chemistry and Chemical Biology I-III; Springer, 2001.


42

Page 43 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


FIGURE LEGENDS Figure 1. Enrichment strategy for highly pure mitochondria from N. crassa. Mycelium was harvested, subsequently ground mixed with silicon dioxide particles and differentially centrifuged twice to obtain crude mitochondrial extracts (cM), thus enriching mitochondria (illustrated as red dots) and depleting other cellular contents (exemplarily depicted as differentially colored forms). Next the crude mitochondrial fraction was loaded onto a Percoll gradient. Upon ultracentrifugation, two brownish bands (iM) were visible: The upper band contained mitochondria as well as other cell organelles (e.g. peroxisomes, endoplasmatic reticulum), while the lower band (pM) almost exclusively contained mitochondria. In addition, a crude mycelium extract (Myc) was prepared by grinding mycelium in liquid nitrogen. Figure 2. Quality control of mitochondria enrichment. The pure (pM), impure (iM) and crude (cM) mitochondrial fractions were analyzed by (A) electron microscopy (scale bar corresponds to 2 µm) and (B) cytochrome c oxidase activity assay. (C) Absolute protein amounts were quantified for the fractions analyzed in (A) and (B). (D) Analysis of marker proteins in Myc (mycelium extract), cM, iM and pM fractions by immunodetection. (F) The relative amounts of mitochondrial (light grey) and non-mitochondrial (dark grey) localized proteins (GO) are illustrated for Myc, cM, iM and pM. Here, the peak areas as a measure of the amounts of proteins present were utilized for semi-quantitative detection of N. crassa proteins. For the sake of comparison, the relative amounts of all non-mitochondrially localized proteins were summed up instead of showing individual annotations. ER = endoplasmic reticulum, OM = outer mitochondrial membrane, IM = inner mitochondrial membrane.


43


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 44 of 52

Figure 3. iTRAQ-based quantification and clustering of mitochondrial proteins in comparison to proteins from distinct organelle localizations. (A) Enrichment profiles of proteins from different organelles according to iTRAQ quantification ratios. Samples derived from mycelium extract (Myc), crude (cM), impure (iM) and pure (pM) mitochondrial fractions. (B) Distribution of annotated proteins (according to GO) based on iTRAQ quantification ratios. (C) Classification by linear discriminant analyses (LDA) based on iTRAQ quantification ratios of all identified proteins. Figure 4. Heme biosynthesis pathway and heme integration in target enzymes (Franken and coworkers49 modified). The coloring of the enzymes indicates the clustering within the current data (dark green – mitochondrial; red – probably non-mitochondrial; white – not identified by MS). Proteins were matched to associated reactions and genes by KEGG pathway50 of N. crassa (http://www.genome.jp/kegg/pathway.html). ALAS (Q7RVY5) – 5′-aminolevulinic acid synthase; ALAD (Q7S819) – 5’-aminolevulinic acid dehydratase; PBGD (Q6MW51) – porphobilinogen deaminase: UROS (Q7S4P0) – uroporphyrinogen III synthase; UROD (Q7SE23) – uroporphyrinogen III decarboxylase; CPO (F5H9D4) – coproporphyrinogen III oxidase, PPO (V5IQT0; identified by BLAST search with P40012 from Saccharomyces cerevisiae) – protoporphyrinogen oxidase; FC (Q7SA94) – ferrochelatase; CCHL (Q7S3Z2 / P14187) – cytochrome c heme-lyase; COX10 (Q7S5E7) – protoheme IX farnesyltransferase; COX15 (Q7S6L8) – cytochrome c oxidase assembly protein subunit 15; MET1 (Q7SI49) – uroporphyrinIII C-methyltransferase; MET8 (Q7SBH1) – precorrin-2 dehydrogenase / sirohydrochlorin ferrochelatase (MET conforms to S. cerevisiae nomenclature). Figure 5. Detection of Hex1 localization by Post-embedding Protein A-Gold Labelling. Transmission electron micrographs show cells of N. crassa. 90 nm ultrathin sections were incubated with anti-Hex1 recombinant antibody SH1237-F8 and were tagged subsequently with


44

Page 45 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


protein A-10 nm gold conjugates (A and C with enlarged boxed areas). Gold particles (black dots) localize Hex1 mainly in Woronin bodies (W in A) but also in other organelles like mitochondria (M) and the cytosol (A and B). CW – cell wall, V – vacuole, scale bars correspond to 1 µm (above) and 0.5 µM (below). Figure 6. Mitochondrial localization of the D-arabinitol dehydrogenase C-eGFP fusion protein. (A) Subcellular localization of the D-arabinitol dehydrogenase C-eGFP fusion protein, (B) subcellular localization of ATP-1-Presequence-mCherryNC, (C) overlay of the signals obtained for (A) and (B). Scale bar corresponds to 10 µm.


45


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 46 of 52

Abstract graphic


46

Page 47 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Percoll gradient Myc

iM

2000 g

17400 g

50000 g

5 min

12 min

25 min

17400 g 15 min

twice

cM

Figure 1


pM


cM

5AintactAmitochondria

pM

iM

)bb

replicateA)

D mitochondrion

%b

6b

peroxisome

mitochondrion

)b ] b

cM

iM

pM

cM

Myc cM iM pM

replicateA6 replicateA%

pM

[b

replicateA)

)]

iM

6b

6] 6b

replicateA%

8b

b

C

replicateA6

Pex)[

cytosol

NitI9

Nucleus

HHI%

vacuole

VMAI)

Golgi

VPSI]6

ER

GRPI78

OM

TOM[b

IM matrix

markerAproteins

B

A

proteinAamountA[mg]

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 48 of 52

AAC CPSA

F mitochondrial nonImitochondrial 4replicatesAcombinedT

Myc

cM

pM

iM

FigureA6


Page 49 of 52

A

2.0

pattern description (A) Mitochondrion ER nucleus vacuole cytoskeleton Golgi

enrichmentvfactor

1.8 1.6 1.4 1.2 1.0

classification description (B and C)

0.8

all identified annotated mitochondrial non-mitochondrial

0.6

Myc Myc

B

cM Myc

iM Myc

pM Myc

C

GO annotated proteins

all identified proteins

245

512

2.0

2.0

1.5

1.5

1.0 0.5 0.0 -0.5 -1.0 -1.5 -2.0

-1.0

0.0

1.0

log2(cM/Myc)

2.0

-4.0

-3.0

-2.0

-1.0

c) My

M/

(i g2

lo

0.0

1.0

2.0

log2(pM/Myc)

log2(pM/Myc)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1.0 0.5 0.0 1.0

-0.5 -1.0 -1.5 -3.0

-2.0

-1.0

0.0

1.0

log2(cM/Myc)

Figurev3


2.0

0.0 -1.0 c) -2.0 My / M -3.0 2(i -4.0 g lo 2.0


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4


Page 50 of 52

Page 51 of 52

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


A

CW

B

M

V M

M

M

M

M

M M W

M

Figure 5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 6


Page 52 of 52

Linear Discriminant Analysis Identifies Mitochondrially Localized

Recommend Documents