Linking Community Profiles, Gene Expression and ... - ACS Publications

Jul 19, 2010 - Anaerobic ammonium oxidation (anammox) requires 60% less oxygen and no external organic carbon compared to...
0 downloads 0 Views 4MB Size
Download PDF
Environ. Sci. Technol. 2010, 44, 6110–6116

Linking Community Profiles, Gene Expression and N-Removal in Anammox Bioreactors Treating Municipal Anaerobic Digestion Reject Water HONGKEUN PARK,† ALEX ROSENTHAL,‡ KRISH RAMALINGAM,‡ JOHN FILLOS,‡ A N D K A R T I K C H A N D R A N * ,† Department of Earth and Environmental Engineering, Columbia University, New York, New York 10027, Department of Civil Engineering, City College of New York, New York, New York 10031

Received January 27, 2010. Revised manuscript received June 21, 2010. Accepted July 2, 2010.

Anaerobic ammonium oxidation (anammox) requires 60% less oxygen and no external organic carbon compared to conventional biological nitrogen removal (BNR). Nevertheless, fullscale installations of anammox are uncommon, primarily owing to the lack of well-established process monitoring and control strategies that result in stable anammox reactor performance. The overarching goal of this study was to develop and apply molecular biomarkers that link microbial community structure and activity to anammox process performance in a bioreactor fed with actual anaerobic digestion centrate from a full-scale operational wastewater treatment facility. Over longterm operation, Candidatus “Brocadia sp. 40” emerged as the dominant anammox population present in the reactor. There was good correspondence between reactor nitrogen removal performance and anammox bacterial concentrations. During the period of reactor operation, there was also a marked shift in biomass morphology from discrete cells to granular aggregates, which was paralleled by a shift also to more stable nitrogen removal and the succession and establishment of bacteria related to the Chlorobi/Bacteroidetes superfamily. Basedonbatchassays,hydrazineoxidoreductase(hzo)expression and concentrations of the 16S-23S rRNA intergenic spacer region (ISR) were good quantitative biomarkers of oxygen- and nitrite-mediated inhibition. When applied to a continuous anammox reactor, both molecular biomarkers show promise as monitoring tools for “predicting” reactor performance.

Introduction As a result of the Ocean Dumping Ban Act (1), municipal sewage sludge cannot be discharged directly into ocean waters and has been typically processed via anaerobic digestion at public utilities. While anaerobic digestion effects pathogen reduction and conversion of the carbonaceous content of sludge to gaseous methane, it results in a liquid stream (termed centrate or reject water) extremely concen* Corresponding author phone: (212) 854 9027; fax: (212) 854 7081; e-mail: [email protected]. † Columbia University. ‡ City College of New York. 6110

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 44, NO. 16, 2010

trated in ammonia and, to a lesser extent, organic nitrogen (2). This concentrated liquid stream could be recirculated to the influent of the activated sludge bioreactor, where it is subjected to conventional BNR via sequential nitrification and denitrification. Alternately, it could be processed via novel nitrogen removal pathways such as anaerobic ammonium oxidation (anammox). It is now well-established that anammox bacteria contribute substantially to the global nitrogen cycling in addition to aerobic ammonia-oxidizing bacteria (AOB) or ammoniaoxidizing archaea (AOA) (3-5). When applied to engineered BNR, anammox offers several advantages over conventional nitrification and denitrification. Anammox consumes 60% less oxygen compared to conventional BNR and no external organic carbon (6). In addition, since anammox bacteria fix CO2 and by themselves cannot produce nitrous oxide (N2O), the net operating carbon footprint of anammox is expected to be lower than that of conventional BNR. Anammox bacteria also have a lower biomass yield compared to heterotrophic denitrifying bacteria owing to their predominantly autotrophic metabolism (7). Despite these advantages, there are, as of 2008, roughly 12 full-scale installations of anammox (>50 m3) treating domestic and industrial wastewater streams (8), all in Europe. The challenges to full-scale implementation of anammox for wastewater treatment include the particularly low maximum specific growth rate of anammox bacteria (9) and their high susceptibilities to oxygen and nitrite toxicity (10, 11). Despite recognition of these challenges, there are very few studies that have aimed to develop quantitative biomarkers that can be adapted for anammox process monitoring and control. Furthermore, use of these biomarkers for estimation of activity measures and biokinetic parameters in anammox bioreactors is even less studied (8, 12). From a process monitoring and control perspective, measures of biological activity such as specific substrate consumption rates are more sensitive and rapid indicators of process upsets and recovery compared to measurement of reactant or product compounds (13), especially in systems operated at high solids retention times (SRTs), such as anammox reactors. However, in complex microbial communities competing for similar substrates [e.g., anammox and ammonia-oxidizing bacteria (AOB) competing for ammonia], it may not be trivial to infer microbial activities from commonly employed batch substrate (ammonia or nitrite) consumption assays. In contrast, biomarkers that target anammox metabolic processes might be more applicable to interrogate the specific activity thereof. Possible biomarkers include the rRNA molecule or precursors thereof, which have been used as indicators of “overall” cell or ribosomal activity (14-17). An alternate biomarker for changes in a given “specific” metabolic process activity is the transcript (messenger RNA or mRNA) concentration of the corresponding gene (13, 18). The basis for using mRNA, rRNA, or precursor RNA is that changes at the protein level (and, by extension, the reactor level) could be driven by changes at the sites of protein synthesis (for instance, the ribosome) or by changes in the rate of transcription of genes coding for proteins (19). The New York City Department of Environmental Protection conducted a preliminary pilot-scale evaluation of the anammox process as an alternate to conventional BNR in New York City during December 2005 through January 2008 (termed PO55). This present study was designed to address process stability concerns that became evident during the previous pilot-scale effort. The overarching goal of this study was to develop and apply molecular biomarkers that link 10.1021/es1002956

 2010 American Chemical Society

Published on Web 07/19/2010

microbial community structure and activity to anammox process performance and thereby ultimately facilitate adaptation of anammox to treat anaerobic digestion centrate at full scale in New York City. The specific objectives of this study were to (1) determine and track (both qualitatively and quantitatively) the microbial protagonists in a lab-scale anammox reactor fed with real centrate from full-scale anaerobic digestion operations, (2) combine molecular measures and mass-balance based common bioreactor design equations for parameter estimation of the anammox bioreactor, and (3) develop molecular biomarkers of specific anammox activity and examine their potential applicability for predictive process monitoring.

Materials and Methods Reactor Setup and Operation. A lab-scale anammox reactor (V ) 19.4 L) was operated for approximately 1 year at T ) 35 °C and pH in the range 7.5-7.8. The reactor was seeded with PO55 reactor biomass, which had in turn been initiated with biomass from a full-scale anammox plant in Strass, Austria. The reactor was fed partially nitrified anaerobic digestion centrate from the 26th Ward Water Pollution Control Facility in Brooklyn, NY. On average the influent ammonia and nitrite concentrations to the anammox reactor were 490 ( 194 mg of NH4+-N/L and 518 ( 222 mg of NO2-N/L, respectively. During periods of stable N-removal, an operational SRT of at least 25 days was maintained. During periods of inadequate N-removal, the SRT was not strictly controlled and biomass wastage was transiently stopped. This specific mode of operation (variable SRT and sequential nitritation-anammox) was chosen so as to mimic the proposed full-scale nitritation-anammox configuration in New York City. Sample Collection, DNA Extraction, Polymerase Chain Reaction, and Denaturing Gradient Gel Electrophoresis. Biomass samples were periodically collected from the reactor and stored at -80 °C for subsequent molecular processing. Samples for RNA extraction were additionally amended with RNAprotect bacteria reagent (Qiagen). DNA extraction was conducted by use of the DNeasy mini kit (Qiagen). Resulting DNA concentrations and quality were measured by UV spectrophotometry (Varian). Molecular fingerprinting was conducted via polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) with the primer set 1055F/1392R with a GC-clamp as described previously (20). DGGE was conducted at 60 °C in 1× TAE buffer at 75 V for 13 h on a Dcode system (Bio-Rad Laboratories) on an 8% polyacrylamide gel with 30-60% denaturant gradient. After visualization under UV transillumination, specific gel bands were excised with a sterilized scalpel. Upon confirmation of the excisions as single bands via a secondary DGGE run, the bands were reamplified, purified with Qiaex II (Qiagen), and sequenced (ABI3730XL DNA analyzer, Applied Biosystems). Cloning, Sequencing, and Phylogenetic Analysis. Two sets of clone libraries were constructed, based on broad Planctomycetes [Pla46F/1492R (21)] and specific anammox [Pla46F/Amx820R (22)] bacterial 16S rRNA gene sequences, at the beginning of the study to identify key community members and develop biomarkers for their quantitative tracking. Four samples including the original seed from Strass (labeled Strass), PO55 reactor biomass after operation for about 1 year (labeled PO55), inoculum to the anammox reactor (labeled Seed), and fresh biomass from the anammox reactor on day 1 (labeled 5GA) were selected for the firstround clone libraries. A second round of clone libraries was constructed with a pooled DNA mixture obtained from the anammox reactor on days 376, 384, and 389 to possibly update the molecular assays, if new members were revealed. PCR amplicons were purified after a visual size check, using

QIAquick PCR purification kit (Qiagen) and inserted into TOPO vector using the TOPO TA cloning kit for sequencing (Invitrogen). Plasmid DNA was purified from the recombinants using the PureLink quick plasmid miniprep kit (Invitrogen). The inserts were confirmed by EcoRI (Fisher Scientific, MD) digestion and gel electrophoresis. The inserts were sequenced (ABI3730XL DNA analyzer, Applied Biosystems), aligned by use of MEGA (23), and analyzed with BLAST (24). Phylogenetic trees were constructed by the neighborjoining method with bootstrap of 1000 replications and Jukes-Cantor computational model (25). The nucleotide sequence results have been deposited in GenBank (accession numbers GQ356038 through GQ356198). Quantitative PCR. The abundance of anammox bacteria (AMX), ammonia-oxidizing bacteria (AOB), and nitriteoxidizing bacteria (NOB) was quantified in triplicate via SYBR green chemistry quantitative PCR (qPCR), specifically targeting AMX 16S rRNA (8), ammonia monooxygenase subunit A (amoA) (26), and Nitrobacter (27) and Nitrospira (28) 16S rRNA, respectively. Total bacterial abundance was also quantified by use of eubacterial 16S rRNA targeted primers (20). Standard curves for qPCR were generated via serial decimal dilutions of plasmid DNA containing specific target gene inserts. Batch Substrate Depletion Assays for Inferring Inhibition and Activity. Batch ammonia and nitrite depletion assays were conducted to determine the activity and inhibitory effect of nitrite and oxygen concentrations on day 217. Fresh reactor biomass was washed with phosphate buffer (pH 7.8), previously rendered anaerobic by sparging with N2 gas. The biomass was apportioned into three samples (V ) 100 mL), spiked with substrates (60 mg of NH4+-N/L, 25 mg of NO2-N/L), and incubated at 37 °C. Subsequently, two biomass samples were inhibited with 450 mg of NO2--N/L (N) and aeration (O). The third biomass sample served as control (C). NH4+-N, NO2--N, NH2OH, and N2H4 were measured in all three treatments every 15-30 min to determine the volumetric activities (10). Samples for gene expression measurement were also collected, stabilized with RNAprotect bacteria reagent (Qiagen), and stored at -80 °C for further processing. Molecular Biomarkers for Inferring Inhibition and Activity. The 16S-23S rRNA intergenic spacer region (ISR) and hydrazine oxidoreductase (hzo) mRNA were selected as candidate biomarkers of activity. ISR is shown to be a sensitive indicator of anammox inhibition by oxygen, as inferred via quantitative fluorescence in situ hybridization (FISH) (17). New real-time reverse transcriptase PCR (RT-q-PCR) primer sets for targeting hzo (CATGGTCAATTGAAAGRCCA-CC and GCCATCGACATACCCATACTS) and ISR (TCCCCTGATAAGGGAAAGGT and TCAAASTGGTGGAGATGAGC) were designed, optimized and implemented [Primer 3 software (29)] based on conserved regions of known hzo and ISR sequences in three different anammox bacterial strains: KSU-1, Candidatus “Brocadia anammoxidans”, and Candidatus “Kuenenia stuttgartiensis”. The partial nucleotide sequences of both hzo and ISR retrieved from the anammox reactor have been deposited in GenBank (accession numbers FJ617453 and FJ617454). RNA Extraction, cDNA Synthesis, and RT-qPCR. Total RNA was extracted by use of an RNeasy kit (Qiagen), and RNA quality and quantity were checked by gel electrophoresis and UV spectrophotometry, respectively. Reverse transcription was conducted with a Quantitect reverse transcription kit (Qiagen). ISR and hzo concentrations determined in triplicate via RT-q-PCR were normalized to AMX 16S rRNA concentrations. VOL. 44, NO. 16, 2010 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

6111

FIGURE 1. (A) Nitrogen removal performance and (B) AMX concentrations of the anammox reactor. Vertical lines in panel A indicate upsets (days 75 and 129). AMX concentrations circled in panel B were used to determine µmax,AMX (eq 1).

Results and Discussion Nitrogen Removal Performance. Nitrogen removal performance was variable during the first 150 days of anammox reactor operation. During this period, there were two transient upsets on days 75 and 129 that resulted in near-complete nitrogen accumulation (Figure 1A). A sharp increase in NH3-N and NO2--N removal and NO3--N production (negative removal) was observed after day 150, with an N removal efficiency of 88% ( 3% and an average effluent nitrogen stoichiometry of 1.00 (NH3-N):1.21 (NO2--N):-0.13 (NO3-N). Coincidentally, the biomass in the reactor was marked by a distinct red color typical of anammox bacteria, and substantial sludge granulation was also observed from this period on. Microbial Ecology of Anammox Reactor Biomass. On the basis of clone libraries, the overall Planctomycetales communities from the initial anammox inoculum (Strass), the inoculum to the anammox reactor (Seed), and the previously operated pilot-scale anammox reactor (PO55) all consisted of both anammox and nonanammox bacteria (please refer to Supporting Information). With a narrower anammox-targeting primer set, a major niche differentiation between the initial inoculum (Strass) and subsequent generations (PO55 and the anammox reactor in this study) was observed. While the initial inoculum from Strass was most closely related to C. “Kuenenia stuttgartiensis”, anammox bacteria in the PO55, Seed, and anammox reactor samples were closely related to C. “Brocadia sp. 40” and Candidatus “Brocadia fulgida”. This shift is possibly due to the purported lower affinity (higher half-saturation coefficient) of “Brocadia” species for nitrite (30) compared to C. “Kuenenia stuttgartiensis” (0.2-3 µM) (31), although specific values for the former have not been reported (30). Indeed, the anammox reactor in this study experienced varied nitrite influent concentrations (9.4 ( 27.5 mg of NO2--N/L), which presumably selected for “Brocadia” species therein. A similar shift in the ecology of anammox bacteria toward “Brocadia” species has been observed in a recent study (8). The 6112

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 44, NO. 16, 2010

coexistence of anammox bacteria related to “Brocadia sp. 40” and C. “Brocadia fulgida” was sustained throughout the period of reactor operation as confirmed by clone libraries constructed 13 months into anammox reactor operation (please refer to Supporting Information). However, DGGE profiling revealed possible chronological succession within the Brocadia genus, with C. “Brocadia sp. 40” emerging prior to C. “Brocadia fulgida” (Figure 2). On the basis of DGGE, the succession and sustenance of yet another unique population, belonging to the Bacteroidetes/ Chlorobi phylum, was distinctly observed coincident with sludge granulation (Figure 2). In parallel, the presence of high amounts of filamentous bacteria in the anammox granules was confirmed via phase-contrast microscopy (data not shown). Several similar observations of the proliferation of filamentous bacteria in other anammox reactors have been made (32, 33). A similar correspondence between the presence of filamentous bacteria and sludge granule formation has also been reported (34, 35). Therefore, it could be speculated that the overall population dynamics and reactor performance in granular sludge anammox reactors are driven not only by Planctomycetes involved in the anammox reaction but also by those that could possibly confer structural integrity to the anammox aggregates. Monitoring of Bacterial Concentrations in the Anammox Reactor. Prior to granulation, the AMX concentrations were highly variable and in the range (8.0 ( 1.0) × 106 to (5.5 ( 0.3) × 108 copies/mL. After granulation, the AMX concentrations increased and stabilized in the range of (0.4 ( 0.03)-(7.8 ( 0.2) × 108 copies/mL. The anammox reactor also harbored AOB and NOB populations in addition to AMX (Figure 3). This is understandable given that the anammox reactor was fed with the effluent stream from a partial nitrification reactor that is expected to be highly enriched in AOB relative to NOB. Within the NOB, Nitrobacter species concentrations were relatively invariant and in the range (8.8 ( 0.8) × 106 copies/mL. Nitrospira species concentrations were lower and ranged from early values of (2.2 ( 0.2) × 106 down to (5.8 ( 2.5) × 101 copies/mL. The relative preponderance of Nitrobacter species in the anammox reactor was likely attributed to their dominance in the partial nitrification reactor, which contained high nitrite concentrations in the range ∼518 ( 222 mg of N/L, as documented elsewhere (36). The specific fractions of AOB, NOB, and AMX in the anammox reactor biomass during the period of high N removal (day 150 onward) were 13.0% ( 4.7%, 1.2% ( 0.2%, and 3.0% ( 0.4%, respectively [cell concentration was calculated by assuming 2 amoA gene copies per AOB, 1 rRNA operon per AMX and NOB, and 4.13 rRNA operons per Eub cell (37)]. The low fraction of AMX:Eub is partly attributed to AOB presence in the influent stream and their possible proliferation under anaerobic conditions (as discussed below). Alternately, the existence of novel anammox organisms that are not detected by the AMX primer set employed also cannot be ruled out. A similarly low anammox population fraction (8%) in a similarly configured one-stage partial nitritation-anammox biofilm reactor has also been recently reported (38). Estimation of µmax,AMX via a Combination of Molecular Assays and Reactor Performance. Based on the rapid increase in AMX concentrations during days 150-200 of reactor operation (Figure 1B), the maximum specific growth rate of anammox bacteria (µmax, AMX) was estimated in the range 0.11-0.15 day-1 (eq 1, after ref 8). These values compare favorably with those in a recent report [0.037-0.34 day-1 (8)], also estimated identically. ln XAMX ) ln XAMX,0 + µAMXt

(1)

where XAMX,0 ) initial anammox bacteria concentration (copies per milliliter), XAMX ) anammox bacteria concentra-

FIGURE 2. 16S rRNA-based DGGE profiles of anammox reactor communities during days 152-389. DGGE markers from the top indicate 16S rRNA sequences related to (1) C. “Kuenenia stuttgartiensis”, (2) C. “Brocadia sp. 40”, and (3) C. “Brocadia fulgida”, respectively. Arrow indicates unknown bacteria, belonging to Bacteroidetes/Chlorobi phylum.

FIGURE 3. Concentrations of AMX (16S rRNA), AOB (amoA), Nitrobacter spp. (16S rRNA), Nitrospira spp. (16S rRNA), and total bacteria (16S rRNA) in the anammox reactor. tion at time t (copies per milliliter), and µAMX ) specific growth rate of anammox bacteria (per day). By use of the average µmax,AMX value estimated above (0.13 day-1) and a recently reported anammox specific decay coefficient (bAMX) of 0.004 day-1 (39), the average minimum SRT (ΘC,min,AMX) required to sustain anammox bacteria in our reactor was calculated from eq 2 (40) and equaled 7.9 days. θC,min,AMX )

1 µmax,AMX - bAMX

(2)

Therefore, during periods of stable removal, the strategy to operate the anammox reactor at an SRT of 25 days was appropriate. Furthermore, based on the µmax,AMX estimates, the corresponding average doubling time (td) of anammox bacteria, calculated as (ln 2/td), was 5.3 days. It has been previously suggested that the average doubling time of anammox bacteria in some environments could be as high as 2 weeks (11). Such long doubling times could be one possible limitation to widespread application of anammox as a viable process for biological nitrogen removal. However, the results of this and another recent study (8) show that

adequately designed and operated anammox bioreactors could enrich for more rapidly growing anammox bacteria, even when operated with real municipal anaerobic digestion reject water. Although periods of substantial increase in AMX concentrations are useful to estimate µmax,AMX, relatively stable AMX concentrations are ideally desired in anammox reactors during long-term operation to achieve stable N removal. Thus, attempts must be made to develop in situ measures of activity applicable even during periods of stable AMX concentrations (as described in the following section). Molecular Measures of in Situ Anammox Activity. Ammonia and nitrite were consumed at almost the same rate in the control batch (11.3 and 10.7 mg of N L-1 h-1, respectively) with minimal accumulation of hydrazine (N2H4) (Figure 4), suggesting possible anammox metabolism. Interestingly, the trends of ammonia consumption in the control (C) were similar to those in the presence of oxygen (batch O) and nitrite (batch N) (Figure 4B). However, concomitant nitrite reduction in inhibited batches (O and N) was not observed (Figure 4A). The depletion of ammonia, but without concomitant nitrite depletion under anoxic conditions (batch N), can be attributed to anaerobic ammonia oxidation by AOB (41). The accumulation of hydroxylamine (NH2OH), which is a metabolic intermediate in AOB (42) and AMX (43) [but not in NOB (44)] also underscores AOB activity and inhibited AMX activity in batches O and N (Figure 4C). Hydrazine (N2H4) accumulation was also observed in batch N, pointing to possible inhibition of HZO in AMX by high nitrite concentrations. These results show that, due to the overlapping intermediates of AOB and AMX pathways, batch substrate depletion-based activity tests may be difficult to interpret and to estimate AMX biokinetics. Systematic decreases in relative AMX-specific hzo mRNA and ISR concentrations were observed in both inhibited batches (Figure 4D). The impact of high nitrite exposure was comparable on both hzo- and ISR-based responses resulting in 26.4% ( 6.9% and 31.1% ( 7.9% reduction in relative copy numbers for hzo and ISR. The impact of oxygen was more severe on hzo expression than on ISR, resulting in 58.7% ( 16.1% and 36.2% ( 21.9% reduction in relative copy numbers VOL. 44, NO. 16, 2010 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

6113

FIGURE 4. Batch profiles of (A) nitrite, (B) ammonia, (C) hydroxylamine and hydrazine concentrations, and (D) expression levels of two molecular biomarkers in control [C], high nitrite [N], and oxygen exposure [O] batches.

FIGURE 5. Relationship between gene expression and nitrogen removals in (A) an independent test anammox reactor and (B) the 5GA anammox reactor. for hzo and ISR, respectively. The similar degrees of reduction in hzo mRNA and ISR concentrations from nitrite exposure could be attributed to the broad mode of nitrite toxicity. Indeed, wide-ranging responses to nitrite stress including energy metabolism, nitrogen metabolism, oxidative stress, and iron homeostasis have been shown in Desulfovibrio 6114

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 44, NO. 16, 2010

vulgaris Hildenborough via global transcriptomic analysis (45). In contrast, oxygen inhibition of obligately anaerobic anammox bacteria, which is reversible (46), is potentially specific to energy metabolism (for instance, hzo expression), at least during short-term exposure. The potential applicability of hzo and ISR expression as “predictive” molecular biomarkers of anammox activity during continuous anammox reactor operation was verified during two distinct periods in the 5GA bioreactor and in an identically operated separate bioreactor (Figure 5). Essentially, the expression trends of both hzo and ISR tracked and preceded the N-removal trends (Figure 5). The relatively long-term precedence (from 8 to 14 days) of both hzo and ISR in this study was possibly due to the slow growth rate and low substrate utilization rate of AMX under substratelimiting conditions (high SRTs) in the anammox bioreactor. Such conditions may result in the slow production of key enzymes such as HZO and a lagging response of reactor performance relative to that of mRNA and rRNA levels. From a process monitoring and control perspective, it is essential to target the most rapid responses to process changes or upsets. The use of gene expression-based molecular activity measures for process control is especially attractive since it enables prediction of cellular activity under environmental stress at very short time scales (18). In the case of anammox bioreactors, tracking activity signatures (such as hzo and ISR expression), is additionally useful since it also allows for AMX-specific resolution and discrimination, unlike conventional measures of activity based on ammonia, nitrite, or nitrate depletion profiles (Figure 4), which do not conclusively implicate AMX, AOB, or NOB. Notwithstanding the promise of hzo mRNA and ISR as potential predictors of N removal, their true utility for process monitoring can be judged better by longer-term application to other anammox processes. Nevertheless, these initial results are in good agreement with those reported previously with ISR (17), and more research is recommended in the direction of developing quantitative biomarkers of specific anammox activity.

Acknowledgments This study was supported by the New York City Department of Environmental Protection. The comments of J. Gijs Kuenen, Mark van Loosdrecht, and Gerard Muijzer from the Delft University of Technology are gratefully acknowledged.

Supporting Information Available One figure showing 16S rRNA clone libraries targeting Planctomycetales and anammox bacteria. This material is available free of charge via the Internet at http://pubs.acs.org.

Literature Cited (1) U.S. EPA. Ocean Dumping Ban Act, 1988. (2) Tchobanoglous, G.; Burton, F. L.; Stensel, H. D., Metcalf and Eddy Wastewater Engineering: Treatment and Reuse, 4th ed.; McGraw Hill: New York, 2003. (3) Dalsgaard, T.; Thamdrup, B.; Canfield, D. E. Anaerobic ammonium oxidation (anammox) in the marine environment. Res. Microbiol. 2005, 156 (4), 457–464. (4) Francis, C. A.; Beman, J. M.; Kuypers, M. M. M. New processes and players in the nitrogen cycle: the microbial ecology of anaerobic and archaeal ammonia oxidation. ISME J. 2007, 1 (1), 19–27. (5) Op den Camp, H. J. M.; Kartal, B.; Guven, D.; van Niftrik, L. A. M. P.; Haaijer, S. C. M.; van der Star, W. R. L.; van de Pas-Schoonen, K. T.; Cabezas, A.; Ying, Z.; Schmid, M. C.; Kuypers, M. M. M.; van de Vossenberg, J.; Harhangi, H. R.; Picioreanu, C.; van Loosdrecht, M. C. M.; Kuenen, J. G.; Strous, M.; Jetten, M. S. M. Global impact and application of the anaerobic ammonium-oxidizing (anammox) bacteria. Biochem. Soc. Trans. 2006, 34, 174–178. (6) Kartal, B.; Kuenen, J. G.; van Loosdrecht, M. C. M. Sewage treatment with anammox. Science 2010, 328 (5979), 702–703. (7) Fux, C.; Boehler, M.; Huber, P.; Brunner, I.; Siegrist, H. Biological treatment of ammonium-rich wastewater by partial nitritation and subsequent anaerobic ammonium oxidation (anammox) in a pilot plant. J. Biotechnol. 2002, 99, 295–306. (8) van der Star, W. R. L.; Abma, W. R.; Blommers, D.; Mulder, J.-W.; Tokutomi, T.; Strous, M.; Picioreanu, C.; van Loosdrecht, M. C. M. Startup of reactors for anoxic ammonium oxidation: Experiences from the first full-scale anammox reactor in Rotterdam. Water Res. 2007, 41 (18), 4149–4163. (9) Strous, M.; Heijnen, J. J.; Kuenen, J. G.; Jetten, M. S. M. The sequencing batch reactor as a powerful tool for the study of slowly growing anaerobic ammonium-oxidizing microorganisms. Appl. Microbiol. Biotechnol. 1998, 50 (5), 589–596. (10) Dapena-Mora, A.; Ferna´ndez, I.; Campos, J. L.; Mosquera-Corral, A.; Me´ndez, R.; Jetten, M. S. M. Evaluation of activity and inhibition. effects on Anammox process by batch tests based on the nitrogen gas production. Enzyme Microb. Technol. 2007, 40 (4), 859–865. (11) Strous, M.; Pelletier, E.; Mangenot, S.; Rattei, T.; Lehner, A.; Taylor, M. W.; Horn, M.; Daims, H.; Bartol-Mavel, D.; Wincker, P.; Barbe, V.; Fonknechten, N.; Vallenet, D.; Segurens, B. A.; Schenowitz-Truong, C.; Madigue, C.; Collingro, A.; Snel, B.; Dutilh, B. E.; Op den Camp, H. J. M.; van der Drift, C.; Cirpus, I.; van de Pas-Schoonen, K. T.; Harhangi, H. R.; van Niftrik, L.; Schmid, M.; Keltjens, J.; van de Vossenberg, J.; Kartal, B.; Meier, H.; Frishman, D.; Huynen, M. A.; Mewes, H.-W.; Weissenbach, J.; Jetten, M. S. M.; Wagner, M.; Le Paslier, D. Deciphering the evolution and metabolism of an anammox bacterium from a community genome. Nature 2006, 440 (7085), 790–794. (12) Schmid, M. C.; Maas, B.; Dapena, A.; van de Pas-Schoonen, K.; van de Vossenberg, J.; Kartal, B.; van Niftrik, L.; Schmidt, I.; Cirpus, I.; Kuenen, J. G.; Wagner, M.; Sinninghe Damste, J. S.; Kuypers, M.; Revsbech, N. P.; Mendez, R.; Jetten, M. S. M.; Strous, M. Biomarkers for in situ detection of anaerobic ammoniumoxidizing (Anammox) bacteria. Appl. Environ. Microbiol. 2005, 71 (4), 1677–1684. (13) Chandran, K.; Love, N. G. Physiological state, growth mode, and oxidative stress play a role in Cd(II)-mediated inhibition of Nitrosomonas europaea 19718. Appl. Environ. Microbiol. 2008, 74 (8), 2447–2453. (14) Bremer, H.; Dennis., P. P., Modulation of chemical composition and other parameters of the cell by growth rate. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology; Neidhardt, F. C., Ingraham, J. L., Low, K. B., Magasanik, B., Schaechter, M., Umbarger, H. E., Eds. American Society for Microbiology: Washington, DC, 1987; pp 1527-1542.

(15) Poulsen, L. K.; Ballard, G.; Stahl, D. A. Use of rRNA fluorescence in situ hybridization for measuring the activity of single cells in young and established biofilms. Appl. Environ. Microbiol. 1993, 59 (5), 1354–1360. (16) Rosset, R.; Julien, J.; Monier, R. Ribonucleic acid composition of bacteria as a function of growth rate. J. Mol. Biol. 1966, 18, 308–320. (17) Schmid, M.; Schmitz-Esser, S.; Jetten, M.; Wagner, M. 16S-23S rDNA intergenic spacer and 23S rDNA of anaerobic ammoniumoxidizing bacteria: implications for phylogeny and in situ detection. Environ. Microbiol. 2001, 3 (7), 450–459. (18) Airoldi, E. M.; Huttenhower, C.; Gresham, D.; Lu, C.; Caudy, A. A.; Dunham, M. J.; Broach, J. R.; Botstein, D.; Troyanskaya, O. G. Predicting cellular growth from gene expression signatures. PLoS Comput. Biol. 2009, 5 (1), e1000257. (19) Madigan, M. T.; Martinko, J. M. Brock Biology of Microorganisms, 11th ed.; Prentice Hall: Upper Saddle River, NJ, 2006. (20) Ferris, M. J.; Muyzer, G.; Ward, D. M. Denaturing gradient gel electrophoresis profiles of 16S rRNA-defined populations inhabiting a hot spring microbial mat community. Appl. Environ. Microbiol. 1996, 62 (2), 340–346. (21) Kindaichi, T.; Tsushima, I.; Ogasawara, Y.; Shimokawa, M.; Ozaki, N.; Satoh, H.; Okabe, S. In situ activity and spatial organization of anaerobic ammonium-oxidizing (Anammox) bacteria in biofilms. Appl. Environ. Microbiol. 2007, 73 (15), 4931–4939. (22) Egli, K.; Fanger, U.; Alvarez, P. J. J.; Siegrist, H.; van der Meer, J. J.; Zehnder, A. J. B. Enrichment and characterization of an anammox bacterium from a rotating biological contactor treating ammonium-rich leachate. Arch. Microbiol. 2001, 175, 198–207. (23) Kumar, S.; Tamura, K.; Nei, M. MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings Bioinf. 2004, 5 (2), 150–163. (24) Altschul, S. F.; Gish, W.; Miller, W.; Myers, E. W.; Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403– 410. (25) Jukes, T. H.; Cantor, C. R.; Munro, H. N. Evolution of Protein Molecules; Academy Press: New York, 1969; pp 21-132. (26) Rotthauwe, J. H.; Witzel, K. P.; Liesack, W. The ammonia monooxygenase structural gene amoA as a functional marker: molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl. Environ. Microbiol. 1997, 63 (12), 4704–4712. (27) Graham, D. W.; Knapp, C. W.; Van Vleck, E. S.; Bloor, K.; Lane, T. B.; Graham, C. E. Experimental demonstration of chaotic instability in biological nitrification. ISME J 2007, 1 (5), 385– 393. (28) Kindaichi, T.; Kawano, Y.; Ito, T.; Satoh, H.; Okabe, S. Population dynamics and in situ kinetics of nitrifying bacteria in autotrophic nitrifying biofilms as determined by real-time quantitative PCR. Biotechnol. Bioeng. 2006, 94 (6), 1111–1121. (29) Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000, 132, 365–386. (30) Strous, M.; Kuenen, J. G.; Jetten, M. S. M. Key physiology of anaerobic ammonium oxidation. Appl. Environ. Microbiol. 1999, 65 (7), 3248–3250. (31) van der Star, W. R. L.; Miclea, A. I.; van Dongen, U. G. J. M.; Muyzer, G.; Picioreanu, C.; van Loosdrecht, M. C. M. The membrane bioreactor: A novel tool to grow anammox bacteria as free cells. Biotechnol. Bioeng. 2008, 101 (2), 286–294. (32) Chamchoi, N.; Nitisoravut, S. Anammox enrichment from different conventional sludges. Chemosphere 2007, 66 (11), 2225– 2232. (33) Li, X.-R.; Du, B.; Fu, H.-X.; Wang, R.-F.; Shi, J.-H.; Wang, Y.; Jetten, M. S. M.; Quan, Z.-X. The bacterial diversity in an anaerobic ammonium-oxidizing (anammox) reactor community. Syst. Appl. Microbiol. 2009, 32 (4), 278–289. (34) Li, J.; Hu, B.; Zheng, P.; Qaisar, M.; Mei, L. Filamentous granular sludge bulking in a laboratory scale UASB reactor. Bioresour. Technol. 2008, 99 (9), 3431–3438. (35) Yamada, T.; Sekiguchi, Y.; Imachi, H.; Kamagata, Y.; Ohashi, A.; Harada, H. Diversity, localization, and physiological properties of filamentous microbes belonging to Chloroflexi subphylum I in mesophilic and thermophilic methanogenic sludge granules. Appl. Environ. Microbiol. 2005, 71 (11), 7493–7503. (36) Ahn, J. H.; Yu, R.; Chandran, K. Distinctive microbial ecology and biokinetics of autotrophic ammonia and nitrite oxidation in a partial nitrification bioreactor. Biotechnol. Bioeng. 2008, 100 (6), 1078–1087. (37) Lee, Z. M.-P.; Bussema, C., III; Schmidt, T. M. rrnDB: documenting the number of rRNA and tRNA genes in bacteria and archaea. Nucleic Acids Res. 2009, 37 (1), D489–493. VOL. 44, NO. 16, 2010 / ENVIRONMENTAL SCIENCE & TECHNOLOGY

9

6115

(38) Vlaeminck, S. E.; Terada, A.; Smets, B. F.; Van der Linden, D.; Boon, N.; Verstraete, W.; Carballa, M. Nitrogen removal from digested black water by one-stage partial nitritation and anammox. Environ. Sci. Technol. 2009, 43 (13), 50355041. (39) Ni, B.-J.; Chen, Y.-P.; Liu, S.-Y.; Fang, F.; Xie, W.-M.; Yu, H.-Q. Modeling a granule-based anaerobic ammonium oxidizing (ANAMMOX) process. Biotechnol. Bioeng. 2009, 103 (3), 490– 499. (40) Grady, C. P. L. J.; Daigger, G. T.; Lim, H. C. Biological Wastewater Treatment, 2nd ed.; Marcel Dekker: New York, 1999. (41) Schmidt, I.; Bock, E. Anaerobic ammonia oxidation with nitrogen dioxide by Nitrosomonas eutropha. Arch. Microbiol. 1997, 167, 106–111. (42) Chain, P.; Lamerdin, J.; Larimer, F.; Regala, W.; Lao, V.; Land, M.; Hauser, L.; Hooper, A.; Klotz, M.; Norton, J.; SayavedraSoto, L.; Arciero, D.; Hommes, N.; Whittaker, M.; Arp, D. Complete genome sequence of the ammonia-oxidizing bacterium and obligate chemolithoautotroph Nitrosomonas europaea. J. Bacteriol. 2003, 185 (9), 2759–2773.

6116

9

ENVIRONMENTAL SCIENCE & TECHNOLOGY / VOL. 44, NO. 16, 2010

(43) van der Star, W. R. L.; van de Graaf, M. J.; Kartal, B.; Picioreanu, C.; Jetten, M. S. M.; van Loosdrecht, M. C. M. Response to anammox bacteria to hydroxylamine. Appl. Environ. Microbiol. 2008, 74 (14), 4417–4426. (44) Aleem, M. I. H.; Sewell, D. L. Mechanism of nitrite oxidation and oxidoreductase systems in Nitrobacter agilis. Curr. Microbiol. 1981, 5, 267–272. (45) He, Q.; Huang, K. H.; He, Z.; Alm, E. J.; Fields, M. W.; Hazen, T. C.; Arkin, A. P.; Wall, J. D.; Zhou, J. Energetic consequences of nitrite stress in Desulfovibrio vulgaris Hildenborough, inferred from global transcriptional analysis. Appl. Environ. Microbiol. 2006, 72 (6), 4370–4381. (46) Strous, M.; van Gerven, E.; Kuenen, J. G.; Jetten, M. S. M. Effects of aerobic and microaerobic conditions on anaerobic ammonium-oxidizing (Anammox) sludge. Appl. Environ. Microbiol. 1997, 63 (6), 2446–2448.

ES1002956