Lonicera caerulea Berry Polyphenols Activate SIRT1, Enhancing

Article Cite This: J. Agric. Food Chem. 2019, 67, 7157−7166

pubs.acs.org/JAFC

Lonicera caerulea Berry Polyphenols Activate SIRT1, Enhancing Inhibition of Raw264.7 Macrophage Foam Cell Formation and Promoting Cholesterol Efflux Suwen Liu,*,† Qianqian Sui,† Yanxue Zhao,† and Xuedong Chang†,‡ †

College of Food Science & Technology, Hebei Normal University of Science and Technology, Qinhuangdao, Hebei 066004, China Hebei Yanshan Special Industrial Technology Research Institute, Qinhuangdao, Hebei 066004, China

Downloaded via BUFFALO STATE on July 21, 2019 at 13:53:19 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

‡

ABSTRACT: Lonicera caerulea berry polyphenols (LCBP) are known to reduce cholesterol accumulation. Currently, it is unknown whether LCBP can activate Sirtuin 1 (SIRT1) to regulate the formation of RAW264.7 macrophage foam cells. In this study, the effect of LCBP on lipid accumulation in macrophages was evaluated. Fluorescently labeled ox-LDL and 25-NBD cholesterol were used to detect the ox-LDL uptake and cholesterol outflow rate from macrophages. Gene silencing was performed using siRNA to detect changes in the expression of the ATP-binding cassette transporter A1 (ABCA1), sterol regulatory element-binding protein 2 (SREBP2), and SIRT1 proteins using Western blotting, and changes in the expression of miR-33 were detected by real-time polymerase chain reaction. The results showed that treatment with 80 μg/mL LCBP significantly inhibited the accumulation of lipids in RAW264.7 macrophages induced by ox-LDL and reduced intracellular cholesterol levels by activating SIRT1 to enhance the expression of ABCA1, a cholesterol efflux gene, but not independent effect. Of the three key LCBP components investigated, chlorogenic acid was found to activate SIRT1 and regulate the expression of the cholesterol-related factors ABCA1, SREBP2, and miR-33; cyanidin-3-glucoside and catechins were effective to a lesser extent. Our results suggest a novel hypolipidemic mechanism of LCBP. KEYWORDS: LCBP, SIRT1 activator, microRNA, siRNA, macrophage foam

■

INTRODUCTION For many years, epidemiological studies have confirmed that cholesterol, especially low-density lipoprotein cholesterol (LDL-C), is an independent risk factor for atherosclerosis (AS).1 AS is a common cause of heart, brain, kidney, and peripheral vascular diseases that seriously endanger human health. In late stages of AS, intimal hyperplasia can form plaques. Foam cells formed by the phagocytosis of a large number of lipids in macrophages are a major component of AS plaques. These foam cells are also a key factor leading to plaque instability and acute cardiovascular events.2,3 Therefore, it is of great significance to promote cholesterol efflux and prevent ox-LDL uptake in macrophages to inhibit foam cell formation and delay the development and instability of AS plaques. The efflux of macrophage cholesterol is mainly mediated by ATP-binding cassette transporters A1 (ABCA1) and G1 (ABCG1). ABCA1 mediates the efflux of cholesterol and phospholipids from macrophages to apolipoprotein A-I (apoAI). The ABCA1 gene has a highly conserved miR-33 binding site in its 3′-untranslated region (UTR) and is directly regulated by miR-33.4 miR-33a is located in the 16th intron region of its host gene, sterol regulatory element-binding protein 2 (SREBP2), and is cotranscribed with SREBP2. SREBP2 is known to regulate intracellular cholesterol uptake and synthesis.5,6 As a well-studied member of the Sirtuin family, Sirtuin 1 (SIRT1) is an important regulator of lipid homeostasis. SIRT1 can not only deacetylate histone proteins but also can deacetylate many important transcription factors and regu© 2019 American Chemical Society

latory proteins, thereby regulating a variety of biological functions.7 SREBP is a protein family containing key regulatory proteins of lipids; cholesterol synthesis research has found that SREBP2 can be deacetylated by SIRT1.8 In recent years, the epigenetic effects of plant polyphenols have attracted increasing attention, especially in terms of their role in the regulation of the SIRT1 pathway.9,10 Polyphenol extract from the brown alga Ecklonia cava affects lipid metabolism by upregulating the expression of SIRT1 and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1α).11 Dietary supplementation with raspberry polyphenols has been shown to improve insulin signaling and reduce obesity in mice fed a high-fat diet (HFD) by activating the AMP kinase (AMPK)/SIRT1 pathway.12 Lonicera caerulea berry polyphenol (LCBP) is a natural polyphenol derived from L. caerulea L., a deciduous shrub of the Lonicera family. The fruits are small blue-purple berries that are rich in phenolic acids, flavonoids, anthocyanins, and other active substances known to promote human health.13−15 Recent studies have shown that L. caerulea berries are beneficial in terms of antioxidant activity, lipid-lowering effects, swelling prevention, and radiation resistance,16−18 and their main active ingredient is polyphenol. Our previous study showed that LCBP could decrease the cholesterol levels of rats fed a high-fat and -cholesterol diet, inhibit the expression of Received: Revised: Accepted: Published: 7157

April 2, 2019 May 30, 2019 May 30, 2019 May 30, 2019 DOI: 10.1021/acs.jafc.9b02045 J. Agric. Food Chem. 2019, 67, 7157−7166

Article

Journal of Agricultural and Food Chemistry

mg/mL. The contents of total cholesterol (A111−1, Nanjing Jiancheng Biological Engineering Research Institute, Nanjing, China) and free cholesterol (BC1890, Solarbio, Beijing, China) in each group were determined according to the manufacturers’ instructions. Oil O Staining and Fluorescence Microscopic Observation. Cells were cultured as described in section 2.2 and 2.7 for 24 h. The medium was discarded and the cells were washed twice with PBS. Next, 4% paraformaldehyde was added and cells were fixed at room temperature for 20 min. The cells were then stained with oil red O for 15 min, washed twice with PBS, and observed under a fluorescence microscope (400 × ) (IX53, Olympus, Tokyo, Japan). Fluorescence Microscopic Observation. Cells were cultured as described in Cell Culture and Cytotoxicity and siRNA and Cell Transfection sections for 24 h. Then the cells were incubated with 10 mg/L Dil-ox-LDL (Yiyuan Biotechnology) at 4 °C for 4 h, followed by washing three times with PBS and imaging under a fluorescence microscope (400×). siRNA and Cell Transfection. miR-33 gene silencing was conducted using an miR-33−5p inhibitor. Cells were separated into the control group (normal cells), negative control group (unrelated sequence fragment), and miR-33−5p inhibitor groups. Three interfering fragments and one unrelated sequence fragment were designed for the mouse SREBP2 gene (Jintuosi Biotechnology Co., Wuhan, China). Cells were divided into the nontransfection (normal control) group, negative control group, interference group 1, interference group 2, and interference group 3. The interference fragment sequences used are listed in Table 1.

miR-33 and SREBP2, and promote the expression of ABCA1, thereby increasing cholesterol efflux and reducing cholesterol synthesis.19 However, whether LCBP can activate SIRT1 to affect the expression of miR-33 to increase ABCA1-mediated cholesterol efflux and reduce cholesterol aggregation in cells has not been reported. In this study, siRNA was used to further explore whether LCBP would promote ABCA1-mediated cholesterol efflux by activating SIRT1 expression and silencing miR-33 expression in RAW264.7 macrophages.

■

MATERIALS AND METHODS

Sample Preparation. Wild L. caerulea berries were obtained from Baishan City, Jilin Province, China and stored at −60 °C before extraction and analysis. The polyphenols were extracted with 80% acidic ethanol (0.1% HCl), purified using resin (D101, Sigma-Aldrich, St. Louis, MO, USA) at 4 °C, and component identification was performed using liquid chromatography−tandem mass spectrometry (LC−MS/MS) as described previously.19 Cyanidin-3-glucoside, (+)-catechin, and chlorogenic acid accounted for 43.7%, 26.3%, and 11.6% of the total polyphenols, respectively. Several results from our previous study will also be described here.19 Cell Culture and Cytotoxicity. RAW264.7 macrophages (Wanleibio, Shenyang, China) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (F8067, Sigma-Aldrich) at 37 °C and 5% CO2 (HF-90, Lishen Co., Shanghai, China). Cells were separated into the following treatment groups to determine the effect of LCBP on SIRT1 activation: (1) Control, untreated cells; (2) ox-LDL, 50 mg/L ox-LDL (Yiyuan Biotechnology, Guangzhou, China) was added to cells, followed by incubation for 24 h; (3) ox-LDL + LCBP, 50 mg/L ox-LDL + 80 μg/mL LCBP was added to cells, followed by incubation for 24 h; (4) ox-LDL + SIRT1 inhibitors, cells were pretreated with 10 μM of the SIRT1 inhibitor EX-527 (HY-15452, MedChem Express, Monmouth Junction, NJ, USA) for 1 h, DMEM medium replaced with a new one followed by the addition of 50 mg/L ox-LDL and incubation for 24 h; and (5) ox-LDL + LCBP + SIRT1 inhibitors, cells were pretreated with 10 μM EX-527 for 1 h, DMEM medium replaced with a new one followed by the addition of 50 mg/L ox-LDL + 80 μg/mL LCBP, and incubation for 24 h. The viability of RAW264.7 macrophages treated with 0−200 μg/ mL LCBP for 24 h was determined by an MTT assay. In addition, cells were separated into the following treatment groups to determine the effect of LCBP on SIRT1 activation: (1) Control, untreated cells; (2) ox-LDL, 50 mg/L ox-LDL was added to cells, followed by incubation for 24 h; (3−6) ox-LDL + C-3-G/catechin/CA/Res, 50 mg/L ox-LDL + 20 μmol/L cyanidin-3-glucoside/catechin/chlorogenic acid/resveratrol, respectively (Yuanye, Shanghai, China), was added to cells, followed by incubation for 24 h. Resveratrol was used as a positive control. The dose was selected based on previous studies.20,21 Cellular Cholesterol Efflux. Cells were incubated with 1 μg/mL NBD-cholesterol (Sigma-Aldrich) for 12 h and washed with PBS three times. Cells were incubated for 6 h in serum-free DMEM containing 50 μg/mL ApoA1 (SRP4693, Sigma-Aldrich) and 50 μg/ mL ox-LDL. RIPA buffer (WLA016a, Wanleibio) was added to the cells in each group and centrifuged at 12 000 × g for 10 min to remove cell fragments. Next, the cell effluents and cell lysates were collected. The fluorescence intensity (FI) values of fluorescein-labeled proteins were measured at an excitation wavelength of 469 nm and an emission wavelength of 537 nm using a microplate reader (M200PRO, Tecan, Männedorf, Switzerland) on 96-well black plates. Cholesterol Quantification. Cells from each group were cultured as described in Cell Culture and Cytotoxicity and siRNA and Cell Transfection sections for 24 h and then removed from the culture medium. PBS was added to the cell precipitates, and ultrasonic crushing was performed in an ice bath. The supernatant was centrifuged at 421 × g for 10 min, and the protein content was determined. The final protein concentration was standardized to 5

Table 1. siRNA Sequences and Associated Target Genes name

sequence (5′−3′)

miR-33−5p inhibitor miR-33−5p NCa SREBP2 siRNA-1

GUGCAUUGUAGUUGCAUUGCA CAGUACUUUUGUGUAGUACAA GCUACAGUUUGUCAGCAAUTT AUUGCUGACAAACUGUAGCTT CAACCUCAGAUCAUUAAGATT UCUUAAUGAUCUGAGGUUGTT GGCCAUUGAUUACAUCAAATT UUUGAUGUAAUCAAUGGCCTT UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT

SREBP2 siRNA-2 SREBP2 siRNA-3 SREBP2 NCa a

NC: negative control.

Transfection was performed at a cell density of 70%, with two solutions prepared as follows. Solution 1: 100 μL of Opti-MEM (31985, Gibco, NY, USA) + 6 μL of lipofectamine 2000 (11668−019, invitrogen, CA, USA) were mixed at room temperature for 5 min. Solution 2: 100 μL of optimization solution + 5 μL of miR-33−5p inhibitor or negative control, or SREBP2 interference fragment were mixed and left at room temperature for 5 min. The two solutions were then mixed and left at room temperature for 20 min. The mixture was slow dripped into the cells, and tubes were shaken gently. The cells were then incubated at 37 °C and 5% CO2 for 24 h. The sequence of interference group 2 was selected for subsequent experiments. The experimental groups were as follows. (1) OL group: 50 mg/L ox-LDL-treated cells. (2) OLMI group: ox-LDL-treated cells transfected with miR-33−5p inhibitor. (3) OLSI group: ox-LDLtreated cells transfected with SREBP2-interfering fragments. (4) OLMIE group: cells transfected with miR-33−5p inhibitor were pretreated with 10 μM EX-527 for 1 h, followed by the addition of 50 mg/L ox-LDL. (5) OLSIE group: cells transfected with SREBP2interfering fragments were pretreated with 10 μM EX-527 for 1 h, followed by treatment with 50 mg/L ox-LDL. (6) OLMIL group: cells transfected with miR-33−5p inhibitor were pretreated with 50 mg/L ox-LDL + 80 μg/mL LCBP. (7) OLSIL group: cells transfected with SREBP2-interfering fragments were treated with 50 mg/L ox-LDL + 80 μg/mL LCBP. (8) OLMILE group: cells transfected with miR7158

DOI: 10.1021/acs.jafc.9b02045 J. Agric. Food Chem. 2019, 67, 7157−7166

Article

Journal of Agricultural and Food Chemistry 33−5p inhibitor were pretreated with 10 μM EX-527 for 1 h, followed by treatment with 50 mg/L ox-LDL + 80 μg/mL LCBP. (9) OLSILE group: cells transfected with SREBP2-interfering fragments were pretreated with 10 μM EX-527 for 1 h, followed by treatment with 50 mg/L ox-LDL + 80 μg/mL LCBP. Cells were incubated for 24 h before analysis. Real-Time PCR (RT-PCR). miRNA and mRNA quantification were performed using RT-PCR as previously described.19 A total RNA extraction kit (RP1201, BioTeke, Beijing, China) was used to extract sample RNA for reverse transcription to obtain cDNA, and then PCR was performed at a volume of 20 μL according to the manufacturer’s instructions. The reaction conditions were as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 30 s, with a final elongation step at 4 °C for 5 min. After the reaction, a fluorescence quantitative PCR instrument (Exicycler 96, BIONEER, South Korea) was used for analysis based on the 2−△△CT method.22 The TaqMan miRNA Reverse Transcription System kit (BioTeke) was used to analyze the expression of mi-R33. Primer sequences are shown in Table 2.

(WLA004, Wanleibio). Total protein was then added at 30 μg per well. Protein was isolated by SDS-PAGE, and proteins were transferred to PVDF membranes. Membranes were blocked using 5% skimmed milk powder at 25 °C for 1 h. Thereafter, primary antibodies were added and incubated at 4 °C overnight. The membrane was then washed, and a horseradish peroxidase (HRP)labeled second antibody was added at room temperature for 2 h. Next, the ECL chemiluminescence reagent was added and images were captured with a Gel imager (WD-9413B, LIUYI, Beijing, China) to detect signal reaction products. The following primary antibodies were used: SIRT1 (WL00599, Wanleibio), SREBP2 (14508−1-AP, Proteintech, Beijing, China), ABCA1 (BA1541−2, Boster, Beijing, China). Sheep antirabbit IgG-HRP (WLA023, Wanleibio) was used as a secondary antibody, with β-actin as the internal reference antibody (WL01845, Wanleibio). The results were expressed as the average relative expression ratio of each gene band to β-actin.23 Statistical Analysis. Data were expressed as the mean ± standard deviation (SD) and analyzed by Tukey’s multiple comparison test. All experiments were performed in triplicate. Graphs were produced using OriginPro 8.6 software (OriginLab Corp., Northampton, MA, USA). Values of p < 0.05 or p < 0.01 were considered statistically significant. Regression analysis and F tests were computed using SPSS v. 17.0 (IBM SPSS Statistics, IBM, Armonk, NY, USA).

Table 2. Primers for RT-PCR name

sequence (5′−3′)

Tm (°C)

size

SIRT1 F SIRT1 R SREBP2 F SREBP2 R ABCA1 F ABCA1 R β-actin F β-actin R miR-33−5p F miR-33−5p R U6 F U6 R

TCAGAGTTGCCACCAACAC TACTGGAACCAACAGCCTTA GCAAAGGTCAAGGATGAAC AGTACACTGCGGCCCGAGC GCTCCTCCCTGTTTTTGAA AAGACACGGTGCTGCTACT CACTGTGCCCATCTACGAGG TAATGTCACGCACGATTTCC CGGGTGCATTGTAGTTGCATT GTGCAGGGTCCGAGGTATTC GCTTCGGCAGCACATATACT GTGCAGGGTCCGAGGTATTC

54.0 53.3 52.4 63.3 55.0 52.7 58.6 56.8 61.0 59.2 55.6 59.2

241

■

RESULTS LCBP Dose Determination. The toxic effect of LCBP on the activity of RAW264.7 macrophages cells is shown in Figure 1B. There were no toxic effects at a dose of up to 80 μg/mL (p > 0.05). The effect of different doses of LCBP on lipid accumulation in RAW264.7 macrophages treated with ox-LDL is shown in Figure 1A. The results of oil red O staining showed that ox-LDL treatment led to excessive lipid accumulation in the cells, while LCBP treatment reduced lipid content in the cells in a dose-dependent manner. Total cholesterol in the cells was measured (Figure 1C), and LCBP treatment was found to significantly reduce the total cholesterol levels (48%, p < 0.01). Western blotting was used to detect the expression of SIRT1 in the cells (Figure 1D). LCBP intervention was found to increase the expression of SIRT1 (p < 0.01) in a dose-

185 114 155 58 134

Western Blotting. Total protein was extracted from cells using a whole protein extraction kit (WLA019, Wanleibio), and the protein concentration was determined using a bicinchoninic acid (BCA) assay

Figure 1. Determination of the optimal dose of Lonicera caerulea berry polyphenols (LCBP) for the treatment of RAW264.7 macrophages. (A) Oil O staining was used to observe the effect of different doses LCBP on cellular lipid deposition. (B) Effects of LCBP on cell viability (p < 0.05). (C) Effects of different doses of LCBP on cholesterol deposition in cells. (D) Effects of different doses of LCBP on SIRT1 activation in cells. The data are expressed as the mean ± standard deviation (n = 5 per group). Different letters indicate significant differences (p < 0.01). 7159


Article


Figure 2. Lonicera caerulea berry polyphenol (LCBP) activates SIRT1 to regulate cholesterol accumulation in macrophages. (A) Oil O staining was used to observe the effect of LCBP on cellular lipid deposition in the presence of SIRT1 inhibitors. (B) Effect of LCBP on cholesterol efflux rate in cells in the presence of SIRT1 inhibitors. (C) Fluorescence microscopy was used to observe the effect of LCBP on the endocytosis of ox-LDL in the presence of SIRT1 inhibitors. (D) Effects of LCBP on the expression of cholesterol metabolism-related genes in the presence of SIRT1 inhibitors. (E) Effects of LCBP on SIRT1 activation in cells in the presence of SIRT1 inhibitors. LCBP was administered at 80 μg/mL in all groups. The data are expressed as mean ± standard deviation (n = 3 per group). Different letters indicate significant differences (p < 0.01).

observed under a fluorescence microscope (Figure 2C). After the inhibition of SIRT1, the ability of macrophages to engulf ox-LDL increased, even exceeding that of the model group. RT-PCR (Figure 2D) showed that while LCBP up-regulated the expression of SIRT1 and ABCA1, the expression of SREBP2 and miR-33 decreased. After treatment with SIRT1 inhibitors, the expression of SREBP2 and miR-33 in cells was up-regulated, and ABCA1 expression was down-regulated compared to the LCBP alone treatment group (p < 0.01). The results of Western blotting were consistent with these findings (Figure 2E). Selection of SREBP2 siRNA Sequence. To further detect whether the regulation of ABCA1, SREBP2, and miR-33 by LCBP were affected by SIRT1, siRNA was used to silence miR-33 and SREBP2 expression. Figure 3A shows that the interfering fragment of miR-33 significantly inhibited its expression and reduced its activity. All three interfering fragments of SREBP2 significantly inhibited SREBP2 gene

dependent manner. The LCBP treatment with 20, 40, and 80 μg/mL increased SIRT1 expression by 70%, 93%, and 170%, respectively, compared with the model group. Therefore, a dose of 80 μg/mL LCBP was selected for further experiments. LCBP Activates SIRT1 To Regulate miR-33 Expression and Cholesterol Efflux. Compared to the LCBP alonetreated group, addition of an SIRT1 inhibitor led to increased intracellular lipid content to levels even higher than those in the ox-LDL group (Figure 2A). Furthermore, total cholesterol and free cholesterol in the SIRT1 inhibitor group were increased (Table 3) to levels higher than those in the model group (p < 0.01). Interestingly, after treatment with SIRT1 inhibitor + LCBP, cholesterol accumulation decreased, but free cholesterol was still higher than in the LCBP group (p < 0.01). Cholesterol efflux experiments also showed that the cholesterol efflux rate was reduced 36% by the addition of SIRT1 inhibitors compared to the ox-LDL group (p < 0.01) (Figure 2B). The endocytosis of ox-LDL by cells in each group was 7160


Article


was down-regulated compared to those in cells where miR-33 and SREBP2 alone were silenced (p < 0.01). The cholesterol efflux rate was significantly decreased, while the total cholesterol and free cholesterol in the cells were increased (p < 0.01). LCBP was shown to significantly reverse this effect (p < 0.01). Upon silencing miR-33 and SREBP2 gene expression, SIRT1 gene and protein expression was significantly upregulated (p < 0.01) (Figure 4C,D), consistent with the expression trend of ABCA1, indicating that SIRT1 expression was inversely correlated to miR-33 and SREBP2 expression. Different Effects of Major Components of LCBP on SIRT1 Activation and Cholesterol Accumulation. Using resveratrol as a positive control, the effect of the major polyphenols of LCBP; cyanidin-3-glucoside, catechin, and chlorogenic acid; on SIRT1 activation and cholesterol accumulation was investigated, as shown in Figure 5. The results of oil red O staining and fluorescence microscopy showing the endocytosis of ox-LDL in each group (Figure 5A,B) showed that, at the same dose (20 μmol/L), each polyphenol monomer and resveratrol significantly reduced the ester drop and endocytosis of ox-LDL in each group and that catechin was slightly less effective than the other factors in reducing the endocytosis of ox-LDL. The levels of total cholesterol and free cholesterol in the cells are shown in Figure 5C. The monomer phenol in each group significantly reduced the level of total cholesterol (p < 0.01). Compared to the resveratrol group, there was no significant difference in the effect of chlorogenic acid in reducing total cholesterol (p > 0.05). However, catechin was less effective than resveratrol in reducing total cholesterol in macrophages (p < 0.01). The total cholesterol content of the catechin group was higher than that of the resveratrol group by 61.9% and had no significant effect on free cholesterol (p > 0.05). The free cholesterol levels were not significantly different after treatment with either cyanidin3-glucoside or chlorogenic acid (p > 0.05). Further studies on the regulation of cholesterol-related genes (Figure 5D) showed that each monomer phenol significantly up-regulated the expression of ABCA1 and SIRT1, and down-regulated the expression of SREBP2 and miR-33 (p < 0.01). The factors were ranked as follows in terms of their ability to activate SIRT1 expression and regulate SREBP2, miR-33, and ABCA1 expression: chlorogenic acid > cyanidin-3-glucoside > catechin (p < 0.01). Compared to the resveratrol group (20 μmol/L), treatment with 80 μg/mL LCBP showed no significant differences in the regulation of cholesterol-related genes (p > 0.05).

Table 3. Effect of Total Cholesterol and Free Cholesterol Levels in RAW264.7 Cells Treated with LCBP To Activate SIRT1a total cholesterol (mmol/g prot) Control ox-LDL ox-LDL + LCBP ox-LDL + EX-527 ox-LDL + LCBP + EX-527

0.13 0.42 0.25 0.51 0.30

± ± ± ± ±

0.02d 0.03b 0.04c 0.04a 0.05c

free cholesterol (mmol/g prot) 0.07 0.23 0.14 0.30 0.19

± ± ± ± ±

0.01d 0.03b 0.03c 0.02a 0.02b

Data are expressed as the mean ± standard deviation (n = 5 per group). Different letters indicate significant differences in the same column (p < 0.01). Control, untreated cells. ox-LDL, cells treated with oxidized low-density lipoprotein (ox-LDL). ox-LDL + LCBP, cells treated with ox-LDL + Lonicera caerulea berry polyphenols (LCBP). ox-LDL+ SIRT1 inhibitors, cells pretreated with EX-527 and treated with ox-LDL. ox-LDL + LCBP + SIRT1 inhibitors, cells pretreated with EX-527 and treated with ox-LDL + LCBP. a

and protein expression (Figure 3B,C) (p < 0.01). This result indicates that the above interfering fragments could be used for subsequent experiments. The second interfering fragment showed the best silencing effect and was therefore selected for subsequent experiments. Regulation of SIRT1 by LCBP Affects Expression of miR-33 and Cholesterol Efflux. After inhibiting the gene expression of miR-33, SREBP2, and SIRT1, the effects of LCBP on cholesterol accumulation in macrophages were further observed (Figure 4 and Table 4). The results of oil red O staining (Figure 4A) showed that compared to ox-LDL in the model group, silencing the expression of miR-33 and SREBP2 significantly reduced lipid accumulation, which was further reduced after the addition of LCBP. After inhibition of SIRT1, ester drops further increased significantly. After LCBP addition, ester drops decreased significantly but were still higher than those in the miR-33- and SREBP2-silenced group. Our analysis of macrophage ox-LDL endocytosis showed consistent results with those of oil red O staining (Figure 4B). Our measurement of the cholesterol efflux rate (Table 4) showed that silencing miR-33 and SREBP2 expression alone increased cholesterol efflux and reduced the total cholesterol and free cholesterol levels in cells (p < 0.01). After the addition of LCBP, the expression of miR-33 and SREBP2 was downregulated, while the expression of ABCA1 was up-regulated (Figure 4C,D) (p < 0.01). This increased cholesterol efflux and reduced the total cholesterol and free cholesterol content of the cells (p < 0.01). Furthermore, after silencing miR-33, SREBP2, and SIRT1 simultaneously, the expression of miR-33 and SREBP2 was up-regulated and the expression of ABCA1

Figure 3. Selection of interfering fragment sequences for siRNA transfection. (A) Effect of miR-33-interfering fragment on the expression of the miR-33 gene. NC, negative control; MI, inhibitory fragment of miR-33. (B) Effects of SREBP2-interfering fragments on the expression of SREBP2. S1, S2, and S3 are three interfering segment sequences. (C) Effects of SREBP2-interfering fragments on the expression of SREBP2 protein. The data are expressed as mean ± standard deviation (n = 3 per group). Different letters indicate significant differences (p < 0.01). 7161


Article


Figure 4. LCBP activates SIRT1 to regulate cholesterol accumulation in macrophages. (A) Oil O staining was used to observe the effect of LCBP on cellular lipid deposition after silencing the expression of the miR-33, SREBP2, and SIRT1 genes. (B) Fluorescence microscopy was used to observe the effect of LCBP on the endocytosis of ox-LDL after silencing the expression of miR-33, SREBP2, and SIRT1. (C, D) Effects of LCBP on the expression of cholesterol metabolism-related (C) genes or (D) proteins after silencing the expression of miR-33, SREBP2, and SIRT1. LCBP was administered at 80 μg/mL for all experiments. The data are expressed as mean ± standard deviation (n = 3 per group). Different letters indicate significant differences (p < 0.01). OL, oxidized low-density lipoprotein (ox-LDL)-treated cells. OLMI, ox-LDL + miR-33−5p inhibitor. OLSI, ox-LDL + SREBP2-interfering fragments. OLMIE, ox-LDL + miR-33−5p inhibitor +10 μM EX-527. OLSIE, ox-LDL + SREBP2-interfering fragments + EX-527. OLMIL, ox-LDL + miR-33−5p inhibitor + Lonicera caerulea berry polyphenols (LCBP). OLSIL, ox-LDL + SREBP2interfering fragments + LCBP. OLMILE, ox-LDL + miR-33−5p inhibitor + EX-527 + LCBP. OLSILE, ox-LDL + SREBP2-interfering fragments + EX-527 + LCBP.

■

DISCUSSION Many studies have shown that macrophages play a very important role in the progression of AS.2,24 Macrophage endocytosis of ox-LDL and the gradual formation of foam cells are key steps in the development of AS.24,25 The lipid content

in macrophages is mainly regulated by two factors. One is the ability of macrophages to absorb ox-LDL, and the other is cholesterol efflux in the cell.26 In this experiment, LCBP was observed to significantly reduce the accumulation and cellular foaming of macrophages. The results are similar to the 7162


Article


cotranscribed with SREPB2 and jointly regulates intracellular cholesterol homeostasis.34 This study confirmed that LCBP simultaneously down-regulated the expression of miR-33 and SREBP2, similar to the results of previous studies. MiR-33a-5p can directly bind to the 3′-UTR of its target gene ABCA1, inhibit the translation of the protein, and thus regulate cholesterol efflux.35 In terms of the levels of transcription and post-transcriptional modifications, the expression and activity of ABCA1 in macrophages was shown to be closely regulated.36 Once the expression of ABCA1 is inhibited, lipids accumulate in macrophages and form foam cells.5,6,37 In this experiment, we found that LCBP inhibited the expression of miR-33 and its host SREBP2 and also up-regulated the expression of ABCA1. To further investigate the role of LCBP in activating SIRT1 to promote ABCA1 expression and cholesterol efflux, it was found that SREBP2, miR-33, and ABCA1 expression were regulated by SIRT1. When SIRT1 was inhibited, the role of LCBP in the up-regulation of ABCA1, the down-regulation of miR-33 and its host SREBP2, and cholesterol efflux were weakened. LCBP also promoted cholesterol efflux by up-regulating ABCA1 expression after the simultaneous transfection of inhibitors of SIRT1, miR-33, and SREBP2 in cells. Therefore, the results confirmed that SIRT1 plays a major regulatory role in regulating ox-LDLmediated cholesterol accumulation in RAW264.7 macrophages. LCBP did not affect SIRT1 independently, but had regulatory effects on the expression of the cholesterol-related genes ABCA1, SREBP2, and miR-33. The activation of SIRT1 was found to enhance the regulation of ABCA1, SREBP2, and miR-33 by LCBP and to reduce the accumulation of cholesterol in cells. Through high-performance liquid chromatography (HPLC)electrospray ionization (ESI)-MS/MS in our previous study,38 it was shown that the three main monomer components of LCBP are cyanidin-3-glucoside, catechin, and chlorogenic acid. Resveratrol is a well-known activator of SIRT139 that has been widely studied. Cyanidin-3-glucoside, derived from black soybeans, can activate SIRT1 to ameliorate the symptoms of type 2 diabetes.40 Chlorogenic acid protects against ox-LDLinduced oxidative damage and mitochondrial dysfunction by modulating SIRT1 in endothelial cells.41 Catechins also activate the SIRT1 pathway.42 In this study, it was found that of the three monomeric phenols, catechins had the weakest effect in activating SIRT1 and regulating the cholesterol-related genes ABCA1, SREBP2, and miR-33. Chlorogenic acid showed the strongest effect. This study confirmed that LCBP is also a good activator of SIRT1. In summary, in the regulation of ox-LDL-mediated RAW264.7 macrophage cholesterol accumulation, LCBP activated SIRT1 and further stimulated the down-regulation of miR-33 and SREBP2 expression, up-regulation of ABCA1 expression, reduction of macrophage cholesterol content, inhibition of foam cell formation, and regulation of the cholesterol metabolism balance. LCBP-stimulated activation of SIRT1 expression was found to play a major role in cholesterol reduction. LCBP did not affect SIRT1 activity independently. The activation of SIRT1 enhanced the regulation of ABCA1, SREBP2, and miR-33 by LCBP and reduced the accumulation of cholesterol in cells. In addition, silencing miR-33 and SREPB2 was shown to activate SIRT1 expression; the mechanism controlling this interaction needs further study. Three main monomers phenols; cyanidin-3-glucoside, catechins, and chlorogenic acid; were found to activate these

Table 4. Effect of Total Cholesterol, Free Cholesterol Levels, and Cholesterol Efflux Rate in RAW264.7 Cells Transfected with siRNAa cholesterol efflux rate (%) OL OLMI OLSI OLMIE OLSIE OLMIL OLSIL OLMILE OLSILE

11.11 26.18 18.92 11.78 8.81 33.94 30.94 18.56 25.95

± ± ± ± ± ± ± ± ±

0.87d 1.19b 1.01c 0.67d 0.32e 1.81a 1.61a 0.87c 0.37b

total cholesterol (mmol/g prot) 0.41 0.26 0.26 0.36 0.37 0.12 0.13 0.30 0.30

± ± ± ± ± ± ± ± ±

0.05a 0.03b 0.04b 0.04a 0.04a 0.03c 0.03c 0.03ab 0.04ab

free cholesterol (mmol/g prot) 0.26 0.16 0.16 0.23 0.23 0.10 0.10 0.18 0.18

± ± ± ± ± ± ± ± ±

0.02a 0.01b 0.02b 0.02a 0.02a 0.01c 0.01c 0.02b 0.02b

a Data are expressed as mean ± standard deviation (n = 5 per group). Different letters indicate significant differences in the same column (p < 0.01). OL, oxidized low-density lipoprotein (ox-LDL)-treated cells. OLMI, ox-LDL + miR-33−5p inhibitor. OLSI, ox-LDL + SREBP2interfering fragments. OLMIE, ox-LDL + miR-33−5p inhibitor +10 μM EX-527. OLSIE, ox-LDL + SREBP2-interfering fragments + EX527. OLMIL, ox-LDL + miR-33−5p inhibitor + Lonicera caerulea berry polyphenols (LCBP). OLSIL, ox-LDL + SREBP2-interfering fragments + LCBP. OLMILE, ox-LDL + miR-33−5p inhibitor + EX527 + LCBP. OLSILE, ox-LDL + SREBP2-interfering fragments + EX-527 + LCBP.

pomegranate peel polyphenols in inhibiting the lipid accumulation effect.2 SIRT1 is a member of a group of histone deacetylases that is dependent on nicotinamide adenine dinucleotide (NAD+). SIRT1 has complex physiological functions and is involved in regulating glucose and lipid metabolism, inflammation, oxidative stress, cell aging, apoptosis, and other processes. It also plays an important regulatory role in the occurrence and development of AS.27 SIRT1 can up-regulate liver X receptor (LXR) expression through the deacetylation of its K432 residue, promote ABCA1-mediated reverse cholesterol transport, reduce intracellular lipid deposition, and inhibit the formation of foam cells derived from mononuclear macrophages.28 This study confirmed that LCBP could up-regulate the gene and protein expression of SIRT1 and ABCA1 (p < 0.01). This is consistent with previous reports showing that curcumin29 and tanshindiol C30 can up-regulate ABCA1 through SIRT1. However, our results also showed that SIRT1 inhibitors attenuated the effect of LCBP treatment and its effect on the expression of SREBP2, miR-33, and ABCA1 in cells. At present, many studies have found that plant polyphenol monomers and extracts can regulate the expression of lipidrelated enzymes by up- or down-regulating the expression of cholesterol metabolism-related miRNAs, leading to the regulation of blood lipid metabolism.31,32 However, the types and levels of these changes in miRNA expression tend to be significantly different from exposure to different phenolic compounds.33 Our previous study found that LCBP inhibited the expression of miR-33 and miR-122 in the liver, further affecting the expression of their target genes ABCA1 and FAS, respectively.19 The miR-33 family is made up of miRNA molecules that were found to be closely related to lipid metabolism in the current study. miR-33a is located in the 16th intron region of SREPB2, and its host gene (SREBP2) controls intracellular cholesterol uptake and synthesis. miR-33a is 7163


Article


Figure 5. Effects of LCBP active compounds on cholesterol accumulation in macrophages. (A) Oil O staining was used to observe the effect of three active compounds of LCBP on cellular lipid deposition. (B) Fluorescence microscopy was used to observe the effect of three active compounds of LCBP on endocytosis of ox-LDL. (C) Effect of three active compounds of LCBP on cholesterol content in cells. (D) Effects of three active compounds of LCBP on the expression of cholesterol metabolism-related genes. The components in the above experiment were administered at 20 μmol/L. Different letters indicate significant differences (p < 0.01). C-3-G, cyanidin-3-glucoside; CA, chlorogenic acid; Res, resveratrol. Resveratrol was used as a positive control. The data are expressed as mean ± standard deviation (n = 3 per group). Different letters indicate significant differences (p < 0.01).

■

effects. Our findings provide a theoretical basis for the practical use of LCBP to treat AS. However, the direct subsequence effects of LCBP-regulated SIRT1, such as deacetylation of LXR K432 and changes in the LXR protein level, are not yet understood and require further study.

■

REFERENCES

(1) Rudolf, J.; Lewandrowski, K. B. Cholesterol, Lipoproteins, Highsensitivity C-reactive Protein, and Other Risk Factors for Atherosclerosis. Clin. Lab Med. 2014, 34, 113−127. (2) Zhao, S.; Li, J.; Wang, L.; Wu, X. Pomegranate peel polyphenols inhibit lipid accumulation and enhance cholesterol efflux in raw264.7 macrophages. Food Funct. 2016, 7, 3201−3210. (3) Wu, X.; Li, C.; Mariyam, Z.; Jiang, P.; Zhou, M.; Zeb, F.; Haq, I.; Chen, A.; Feng, Q. Acrolein-induced atherogenesis by stimulation of hepatic flavin containing monooxygenase 3 and a protection from hydroxytyrosol. J. Cell. Physiol. 2019, 234, 475−485. (4) Vega-Badillo, J.; Gutiérrez-Vidal, R.; Hernández-Pérez, H. A.; Villamil-Ramírez, H.; León-Mimila, P.; Sánchez-Muñoz, F.; MoránRamos, S.; Larrieta-Carrasco, E.; Fernández-Silva, I.; MéndezSánchez, N.; Tovar, A. R.; Campos-Pérez, F.; Villarreal-Molina, T.; Hernández-Pando, R.; Aguilar-Salinas, C. A.; Canizales-Quinteros, S. Hepatic miR-33a/miR-144 and their target gene ABCA1 are associated with steatohepatitis in morbidly obese subjects. Liver Int. 2016, 36, 1383−1391. (5) Najafi-Shoushtari, S. H.; Kristo, F.; Li, Y.; Shioda, T.; Cohen, D. E.; Gerszten, R. E.; Naar, A. M. MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science 2010, 328, 1566−1569.

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. ORCID

Suwen Liu: 0000-0001-9273-1801 Funding

This work was funded by the Hebei Normal University of Science and Technology (2018YB006) and the Science and Technology Support Program of Hebei in China (No. 18227137D). Notes

The authors declare no competing financial interest. 7164


Article

Journal of Agricultural and Food Chemistry (6) Rayner, K. J.; Suarez, Y.; Davalos, A.; Parathath, S.; Fitzgerald, M. L.; Tamehiro, N.; Fernandez-Hernando, C. MiR-33 contributes to the regulation of cholesterol homeostasis. Science 2010, 328, 1570− 1573. (7) Hung, C.; Chan, S.; Chu, P.; Tsai, K. Quercetin is a potent antiatherosclerotic compound by activation of SIRT1 signaling under oxLDL stimulation. Mol. Nutr. Food Res. 2015, 59, 1905−1917. (8) Ponugoti, B.; Kim, D. H.; Xiao, Z.; Smith, Z.; Miao, J.; Zang, M.; Wu, S.; Chiang, C.; Veenstra, T. D.; Kemper, J. SIRT1 deacetylates and inhibits SREBP-1C activity in regulation of hepatic lipid metabolism. J. Biol. Chem. 2010, 285, 33959−33970. (9) Ayissi, V. B.; Ebrahimi, A.; Schluesenner, H. Epigenetic effects of natural polyphenols: A focus on SIRT1-mediated mechanisms. Mol. Nutr. Food Res. 2014, 58, 22−32. (10) Sarubbo, F.; Ramis, M. R.; Kienzer, C.; Aparicio, S.; Esteban, S.; Miralles, A.; Moranta, D. Chronic silymarin, quercetin and naringenin treatments increase monoamines synthesis and hippocampal Sirt1 levels improving cognition in aged rats. J. Neuroimmune Pharm. 2018, 13, 24−38. (11) Eo, H.; Jeon, Y. J.; Lee, M.; Lim, Y. Brown alga ecklonia cava polyphenol extract ameliorates hepatic lipogenesis, oxidative stress, and inflammation by activation of AMPK and SIRT1 in high-fat dietinduced obese mice. J. Agric. Food Chem. 2015, 63, 349−359. (12) Xing, T.; Kang, Y.; Xu, X.; Wang, B.; Du, M.; Zhu, M.-J. Raspberry supplementation improves insulin signaling and promotes brown-like adipocyte development in white adipose tissue of obese mice. Mol. Nutr. Food Res. 2018, 62, 1701035. (13) Wang, Y.; Li, B.; Ma, Y.; Zhang, Q.; Meng, X.; et al. Lonicera caerulea, berry extract attenuates lipopolysaccharide induced inflammation in BRL-3A cells: Oxidative stress, energy metabolism, hepatic function. J. Funct. Foods 2016, 24, 1−10. (14) Małodobry, M.; Bieniasz, M.; Dziedzic, E. Evaluation of the yield and some components in the fruit of blue honeysuckle (Lonicera caerulea var. edulis Turcz. Freyn.). Folia Hortic. 2010, 22, 45−50. (15) Celli, G. B.; Ghanem, A.; Brooks, M. S. L. Haskap berries (Lonicera caerulea L.)a critical review of antioxidant capacity and health-related studies for potential value-added products. Food Bioprocess Technol. 2014, 7, 1541−1554. (16) Wang, Y.; Li, B.; Lin, Y.; Ma, Y.; Zhang, Q.; Meng, X. Effects of Lonicera caerulea, berry extract on lipopolysaccharide-induced toxicity in rat liver cells: Antioxidant, anti-inflammatory, and antiapoptotic activities. J. Funct. Foods 2017, 33, 217−226. (17) Wu, S.; Yano, S.; Hisanaga, A.; He, X.; He, J.; Sakao, K.; Hou, D. X. Polyphenols from Lonicera caerulea L. berry attenuate experimental nonalcoholic steatohepatitis by inhibiting proinflammatory cytokines productions and lipid peroxidation. Mol. Nutr. Food Res. 2017, 61, 1600858. (18) Vostálová, J.; Galandáková, A.; Palíková, I.; Ulrichová, J.; Doležal, D.; Lichnovská, R.; Vrbková, J.; Svobodová, A. R. Lonicera caerulea fruits reduce UVA-induced damage in hairless mice. J. Photochem. Photobiol., B 2013, 128, 1−11. (19) Liu, S.; Wu, Z.; Guo, S.; Meng, X.; Chang, X. Polyphenol-rich extract from wild Lonicera caerulea berry reduces cholesterol accumulation by mediating the expression of hepatic miR-33 and miR-122, HMGCR, and CYP7A1 in rats. J. Funct. Foods 2018, 40, 648−658. (20) Wu, C.; Luan, H.; Zhang, X.; Wang, S.; Zhang, X.; Sun, X.; Guo, P. Chlorogenic acid protects against atherosclerosis in apoE−/− mice and promotes cholesterol efflux from RAW264.7 macrophages. PLoS One 2014, 9, No. e95452. (21) Wu, S.; He, X.; Wu, X.; Qin, S.; He, J.; Zhang, S.; Hou, D. Inhibitory effects of blue honeysuckle (Lonicera caerulea L) on adjuvant-induced arthritis in rats: Crosstalk of anti-inflammatory and antioxidant effects. J. Funct. Foods 2015, 17, 514−523. (22) Livak, K. J.; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods (Amsterdam, Neth.) 2001, 25, 402− 408.

(23) Zou, B.; Ge, Z. Z.; Zhang, Y.; Du, J.; Xu, Z.; Li, C. M. Persimmon Tannin accounts for hypolipidemic effects of persimmon through activating of AMPK and suppressing NF-kappa B activation and inflammatory responses in High-Fat Diet Rats. Food Funct. 2014, 5, 1536−1546. (24) Rader, D. J.; Puré, E. Lipoproteins, macrophage function, and atherosclerosis: beyond the foam cell? Cell Metab. 2005, 1, 223−230. (25) Bobryshev, Y. V. Monocyte recruitment and foam cell formation in atherosclerosis. Micron 2006, 37, 208−222. (26) Li, D.; Wang, D.; Wang, Y.; Ling, W.; Feng, X.; Xia, M. Adenosine monophosphate-activated protein kinase induces cholesterol efflux from macrophage-derived foam cells and alleviates atherosclerosis in apolipoprotein E-deficient mice. J. Biol. Chem. 2010, 285, 33499−33509. (27) Stein, S.; Matter, C. Protective roles of SIRT1 in atherosclerosis. Cell Cycle 2011, 10, 640−647. (28) Zeng, H. T.; Fu, Y. C.; Yu, W.; Lin, J. M.; Zhou, L.; Liu, L.; Wang, W. SIRT1 prevents atherosclerosis via liver-X receptor and NFκB signaling in a U937 cell model. Mol. Med. Rep. 2013, 8, 23−28. (29) Lin, X.; Liu, M.; Hu, H.; et al. Curcumin enhanced cholesterol efflux by upregulating ABCA1 expression through AMPK-SIRT1-LXR alpha signaling in THP-1 macrophage-derived foam cells. DNA Cell Biol. 2015, 34, 561−572. (30) Yang, Y.; Li, X.; Peng, L.; An, L.; Sun, N.; Hu, X.; Zhou, P.; Xu, Y.; Li, P.; Chen, J. Tanshindiol C inhibits oxidized low-density lipoprotein induced macrophage foam cell formation via a peroxiredoxin 1 dependent pathway. Biochim. Biophys. Acta, Mol. Basis Dis. 2018, 1864, 882−890. (31) Su, D.; Zhang, R.; Hou, F.; Chi, J.; Huang, F.; Yan, S.; Liu, L.; Deng, Y.; Wei, Z.; Zhang, M. Lychee pulp phenolics ameliorate hepatic lipid accumulation by reducing miR-33 and miR-122 expression in mice fed a high-fat diet. Food Funct. 2017, 8 (29), 808−815. (32) Baselga-Escudero, L.; Bladé, C.; Ribas-Latre, A.; Casanova, E.; Salvadó, M. J.; Arola, L.; Arola-Arnal, A. Grape seed proanthocyanidins repress the hepatic lipid regulators miR-33 and miR-122 in rats. Mol. Nutr. Food Res. 2012, 56, 1636−1646. (33) Milenkovic, D.; Jude, B.; Morand, C. MiRNA as molecular target of polyphenols underlying their biological effects. Free Radical Biol. Med. 2013, 64, 40−51. (34) Marquart, T. J.; Allen, R. M.; Ory, D. S.; Baldán, A. miR-33 links SREBP-2 induction to repression of sterol transporters. Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 12228−12232. (35) Laffont, B.; Rayner, K. J. microRNAs in the pathobiology and therapy of atherosclerosis. Can. J. Cardiol. 2017, 33, 313−324. (36) Lv, Y.; Yin, K.; Fu, Y.; Zhang, D.; Chen, W.; Tang, C. Posttranscriptional regulation of ATP-binding cassette transporter A1 in lipid metabolism. DNA Cell Biol. 2013, 32, 348−358. (37) Rayner, K. J.; Esau, C. C.; Hussain, F. N.; McDaniel, A. L.; Marshall, S. M.; Gils, J. M.; Ray, T. D.; Sheedy, F. J.; Goedeke, L.; Liu, X.; Khatsenko, O. G.; Kaimal, V.; Lees, C. J.; Fernandez-Hernando, C.; Fisher, E. A.; Temel, R. E.; Moore, K. J. Inhibition of miR-33a/b in non-human primates raises plasma HDL and lowers VLDL triglycerides. Nature 2011, 478, 404−407. (38) Liu, S.; Xu, Q.; Li, X.; Wang, Y.; Zhu, J.; Ning, C.; Chang, X.; Meng, X. Effects of high hydrostatic pressure onphysicochemical properties, enzymes activity, and antioxidant capacities ofanthocyanins extracts of wild Lonicera caerulea berry. Innovative Food Sci. Emerging Technol. 2016, 36, 48−58. (39) He, Y.; Zeng, H. Z.; Yu, Y.; Zhang, J. S.; Zeng, X. N.; Gong, F. T.; Duan, X. P.; Liu, Q.; Yang, B. Resveratrol improved the progression of chronic prostatitis via the downregulation of c-kit/ SCF by activating Sirt1. J. Agric. Food Chem. 2017, 65, 5668−5673. (40) Matsukawa, T.; Inaguma, T.; Han, J.; Villareal, M. O.; Isoda, H. Cyanidin-3-glucoside derived from black soybeans ameliorate type 2 diabetes through the induction of differentiation of preadipocytes into smaller and insulin-sensitive adipocytes. J. Nutr. Biochem. 2015, 26, 860−867. 7165


Article

Journal of Agricultural and Food Chemistry (41) Tsai, K. L.; Hung, C. H.; Chan, S. H.; Hsieh, P. L.; Ou, H. C.; Cheng, Y. H.; Chu, P. M. Chlorogenic Acid Protects Against oxLDLInduced Oxidative Damage and Mitochondrial Dysfunction by Modulating SIRT1 in Endothelial Cells. Mol. Nutr. Food Res. 2018, 62, 1700928. (42) Giovannini, L.; Bianchi, S. Role of nutraceutical SIRT1 modulators in AMPK and mTOR pathway: Evidence of a synergistic effect. Nutrition 2017, 34, 82−96.

7166


Lonicera caerulea Berry Polyphenols Activate SIRT1, Enhancing

Recommend Documents