Loop-Mediated Isothermal Amplification Integrated on Microfluidic

Mar 10, 2010 - This work shows that loop-mediated isothermal amplification (LAMP) of nucleic acid can be integrated in an eight-channel microfluidic c...
0 downloads 0 Views 2MB Size
Download PDF
Anal. Chem. 2010, 82, 3002–3006

Loop-Mediated Isothermal Amplification Integrated on Microfluidic Chips for Point-of-Care Quantitative Detection of Pathogens Xueen Fang,†,‡ Yingyi Liu,‡ Jilie Kong,*,† and Xingyu Jiang*,‡ Department of Chemistry and Institutes of Biomedical Sciences, Fudan University, Shanghai 200433, P.R. China, and CAS Key Lab for Biological Effects of Nanomaterials and Nanosafety, National Center for Nanoscience and Technology, Beijing 100190, P.R. China This work shows that loop-mediated isothermal amplification (LAMP) of nucleic acid can be integrated in an eightchannel microfluidic chip for readout either by the naked eye (as a result of the insoluble byproduct pyrophosphate generating during LAMP amplification) or via absorbance measured by an optic sensor; we call this system microLAMP (µLAMP). It is capable of analyzing target nucleic acids quantitatively with high sensitivity and specificity. The assay is straightforward in manipulation. It requires a sample volume of 0.4 µL and is complete within 1 h. The sensitivity of the assay is comparable to standard methods, where 10 fg of DNA sample could be detected under isothermal conditions (63 °C). A real time quantitative µLAMP assay using absorbance detection is possible by integration of optical fibers within the chip. Pseudorabies virus (PRV) is the main pathogen of pseudorabies, which would infect pigs with high mortality. Effective PRV detection is very important in the surveillance and control of the acute infectious disease. Traditional methods for PRV detection includes virus isolation, immunohistological assays, and various polymerase chain reactions (PCRs), which either consume unacceptably long time or demand sophisticated instruments for routine and large-scale assays or point-of-care detection. Loop-mediated isothermal amplification (LAMP) is a method for the amplification of nucleic acids, which amplifies DNA/RNA under isothermal conditions (60-65 °C) with high specificity and sensitivity using a set of six specially designed primers and a Bst DNA polymerase.1 Without the need to accurately toggle the reaction mixture between different temperatures normally required for PCR, LAMP is a powerful tool for nucleic acid amplification and it has already been used widely in pathogen detection, such as human immunodeficiency virus (HIV),2 severe acute respiratory syndrome coronavirus (SARS-CoV),3 hepatitis * To whom correspondence should be addressed. E-mail: xingyujiang@ nanoctr.cn (X.J.); [email protected] (J.K.). † Fudan University. ‡ National Center for Nanoscience and Technology. (1) Notomi, T.; Okayama, H.; Masubuchi, H. Nucleic Acids Res. 2000, 28, E63. (2) Curtis, K. A.; Rudolph, D. L.; Owen, S. M. J. Virol. Methods 2008, 151, 264–270. (3) Hong, T. C.; Mai, Q. L.; Cuong, D. V. J. Clin. Microbiol. 2004, 4, 1956– 1961.

3002

Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

B virus (HBV),4 H5 avian influenza virus,5 and so forth. Although LAMP is more convenient and effective than technologies based on pathogen isolation, immunoassays, and PCRs, most of the methods for monitoring the process of LAMP are performed in macroscale tubes, often requiring at least tens to hundreds of microliters of solutions in polypropylene tubes, which severely limits the throughput/miniaturization of LAMP and the incorporation of LAMP into automated and integrated diagnostic systems. Recent developments in microfluidics technology have enabled applications related to lab-on-a-chip or micrototal analysis systems. They allow the manipulation of small volumes of liquids in microfabricated channels and in some cases microchannels to perform all analytical steps including sample pretreatment, reaction, separation, and detection on a small chip in an effective and automatic format.6-8 Microfluidics has been applied in many biological assays, such as electrophoresis,9 immunoassays,10-14 nucleic acid amplification analysis,15-17 cell manipulations18-21 and (4) Cai, T.; Lou, G. Q.; Yang, J.; Xu, D.; Meng, Z. H. J. Clin.Virol. 2008, 41, 270–276. (5) Imai, M.; Ninomiya, A.; Minekawa, H.; Notomi, T.; Ishizaki, T.; Tashiro, M.; Odagiri, T. Vaccine 2006, 24, 6679–6682. (6) Zheng, B.; Ismagilov, R. F. Angew. Chem., Int. Ed. 2005, 44, 2520–2523. (7) Whitesides, G. M. Nature 2006, 442, 368–373. (8) Wang, J. B.; Zhou, Y.; Qiu, H. W.; Huang, H.; Sun, C. H.; Xi, J. Z.; Huang, Y. Y. Lab Chip 2009, 9, 1831–1835. (9) Manz, A.; Harrison, D. J.; Verpoorte, E. M. J.; Fettinger, J. C.; Paulus, A.; Lu ¨ di, H.; Wider, H. M. J. Chromatogr. 1992, 593, 253–258. (10) Jiang, X. Y.; Ng, J. M. K.; Stroock, A. D.; Dertinger, S. K. W.; Whitesides, G. M. J. Am. Chem. Soc. 2003, 125, 5294–5295. (11) Yang, D. Y.; Niu, X.; Liu, Y. Y.; Wang, Y.; Gu, X.; Song, L. S.; Zhao, R.; Ma, L. Y.; Shao, Y. M.; Jiang, X. Y. Adv. Mater. 2008, 20, 4770–4775. (12) Liu, Y. Y.; Yang, D. Y.; Yu, T.; Jiang, X. Y. Electrophoresis 2009, 30, 3269– 3275. (13) Shi, M. H.; Peng, Y. Y.; Zhou, J.; Liu, B. H.; Huang, Y. P.; Kong, J. L. Biosens. Bioelectron. 2007, 22, 2841–2847. (14) Chen, H.; Jiang, C. M.; Yu, C.; Zhang, S.; Liu, B. H.; Kong, J. L. Biosens. Bioelectron. 2009, 24, 3399–3411. (15) Northrup, M. A.; Ching, M. T.; White, R. M.; Watson, R. T. Proc. Tranducers 1993, 924–926. (16) Schaerli, Y.; Wootton, R. C.; Robinson, T.; Stein, V.; Dunsby, C.; Neil, M. A. A.; French, P. M. W.; deMello, A. J.; Abell, C.; Hollfelder, F. Anal. Chem. 2009, 81, 302–306. (17) Huang, Y. Y.; Castrataro, P.; Lee, C. C.; Quake, S. R. Lab Chip 2007, 7, 24–26. (18) Sun, Y.; Liu, Y. Y.; Qu, W. S.; Jiang, X. Y. Anal. Chim. Acta 2009, 650, 98–105. (19) Chen, Z. L.; Li, Y.; Liu, W. W.; Zhang, D. Z.; Zhao, Y. Y.; Yuan, B.; Jiang, X. Y. Angew. Chem., Int. Ed. 2009, 48, 8303–8305. (20) Chen, Z.; Xie, S. B.; Shen, L.; Du, Y.; He, S. I.; Li, Q.; Liang, Z. W.; Meng, X.; Li, B.; Xu, X. D.; Ma, H. W.; Huang, Y. Y.; Shao, Y. H. Analyst 2008, 133, 1221–1228. 10.1021/ac1000652  2010 American Chemical Society Published on Web 03/10/2010

so forth. Among these assays, nucleic acid amplification-based microfluidics is an active research area. Combination of LAMP and microfluidic technology will miniaturize the LAMP detection system and facilitate the realization of point-of-care (POC) pathogen detection. In this study, we integrate the LAMP on a microfluidic chip, which we call microLAMP (µLAMP) to quantitatively detect target nucleic acids with high sensitivity, specificity, and rapidity. This device potentially enables LAMP assays to be highly portable for on-site analysis. MATERIALS AND METHODS Materials. Pseudorabies virus (PRV) derived from cell culture was provided by the Shanghai Entry-Exit Inspection and Quarantine Bureau (SHCIQ). Total PRV genomic DNA used as the positive model was extracted using the QlAamp DNA Blood Mini Kit (Qiagen GmbH, Germany). This virus was used as the model for the development of the µLAMP assay for the following reasons: (1) as a real world virus, this model is more complex and challenging than a synthetic sequence of nucleic acids and (2) the surveillance of PRV is particularly important in countries (e.g., China) where pork is the predominant source of meat. Microfluidic Chip Design and Fabrication. A poly(dimethylsiloxane) (PDMS) master with positive surface patterns was molded against a 60 mm × 60 mm poly(methyl methacrylate) (PMMA) glass fabricated by mechanical microfabrication. The PDMS replica was produced by soft lithography as the following: 19 The PDMS precursor mixture prepared at a weight ratio of base to curing agent of 10:1 was poured carefully on the master, placed under vacuum for ∼0.5 h to rid the bubbles, and cured at 80 °C for 2 h. The cured PDMS replica was gently peeled off the master, and the conically shaped inlet/outlet was drilled manually using a knife. (This kind of inlet/outlet was necessary for the convenient and accurate addition of the DNA sample and at the same time making the capillary force available to transport the LAMP reaction mixture into microchannel.) Finally, the replica was irreversibly sealed with a microscope glass slide by an O2 plasma to form a leak-proof µLAMP microchannel. The final dimension of the microchannel is 1 mm × 0.8 mm × 0.6 mm with a volume of ∼5 µL. Setup for Real-Time Quantitative Analysis. A detection length of 1.2 mm was used in the real-time turbidity absorbance detection system while the volume of the microchannel remained to be 5 µL. The optical detection unit including optical fibers (FU76F, Keyence Corporation, Osaka, Japan) and digital fiber optic sensor (FS-V31M, Keyence Corporation, Osaka) were applied in our system. The fiber optic sensor employs a high-intensity red light-emitting diode (LED) light at 640 nm and a phototransistor. The launching and collecting optical fibers with a 265 µm diameter core and 400 µm diameter cladding were inserted carefully into the fiber channels that oppose each other. The reduction of optical density was used to indicate the turbidity generation of the LAMP reaction:22,23 (21) Go´mez-Sjo ¨berg, R.; Leyrat, A. A.; Pirone, D. M.; Chen, C. S.; Quake, S. R. Anal. Chem. 2007, 79, 8557–8563. (22) Mori, Y.; Kitao, M.; Tomita, N.; Notomi, T. J. Biochem. Biophys. Methods 2004, 59, 145–157. (23) Lee, S. Y.; Huang, J. G.; Chuang, T. L.; Sheu, J. C.; Chuan, Y. K.; Holl, M.; Meldrum, D. R.; Lee, C. N.; Lin, C. W. Sens. Actuators, B 2008, 133, 493– 501.

optical density ) ln(I0/I1) = turbidity where I0 is the intensity of incident light and I1 is the intensity of transmitted light. Serial dilutions (10-fold) of PRV DNA ranging from 105 to 10 fg/µL were used as templates to evaluate the dynamics of LAMP amplification in microfluidic chips and establish standard curves for quantitative analysis. LAMP Amplification. The LAMP reaction was performed according to our previous work with minor modification.24 The whole volume of the system was 5 µL, which contained 1× ThermoPol buffer (New England Biolabs Inc.), 8.0 mM MgSO4, 0.8 M betaine (Sigma, Germany), 1.0 mM dNTPs (Invitrogen), 0.2 µM each of the outer primer (F3, CGCCTTCCTGCACTACG; B3, AGCGGGCCGTTGAAGA), 1.6 µM each of inner primer (FIP, AGAGGTGCACGGGGTAGAGCGGGCACGGTGTCCATC AA; BIP, GGACGTCAACCGGCTCGTGG CGCGGGTACACAAACTCCT), and 0.8 µM each of loop primer (LF, ACGCGCCACGCCTCGTGC; LB, CGACCCCTTCAACG CCAA), 0.32 U/µL of Bst polymerase (large fragment; New England Biolabs Inc.) with 0.4 µL of nucleic acid sample as a template. The amplification was performed at 63 °C in a laboratory water bath for 1 h. The detection result was determined directly by the naked eye or a fiber optic sensor according to the turbidity of the solution during LAMP amplification, which was then confirmed by agarose gel electrophoresis and restriction digestion with the Hinc II enzyme. Integrated Microfluidic LAMP Chip Operation. A sample containing 0.4 µL of nucleic acid was first introduced via the inlet. A reaction mixture for LAMP (prepared manually according to the system above) of 4.6 µL was drawn slowly into the microchannel by capillary force. The inlet and outlet were tightly sealed by uncured PDMS to form an integral microchamber for LAMP reaction. The whole microfluidic chip was incubated at 63 °C for 1 h using a water bath. The final results were analyzed by the naked eye or optical absorbance and confirmed by agarose gel electrophoresis. The presence of 0.1% Triton X-100 in the reaction mixture and the hydrophilicity of the PDMS replica (as a result of O2 plasma treatment) could help completely fill the microchamber without trapped air.25 RESULTS AND DISCUSSION Fabrication of Microchips for µLAMP. We constructed a PDMS-glass hybrid microfluidic chip with eight 5 µL microchannels (Figure 1). The microfluidic chip is easy to fabricate without using any precise valves or pumps. The LAMP reaction and readout could be simultaneously performed on the microchip. We prevented typical problems associated with the failure of DNA amplification in microchannels, such as bubble generation, reagent evaporation, cross contamination, by completely filling and sealing the microchamber with uncured PDMS in the conically shaped inlet/outlet while taking care to prevent entrapped gas. This method precludes any of the frequently encountered problems reported by researchers designing nucleic amplification microchannels.26 These advantages of µLAMP are most likely due to (24) Fang, X. E.; Xiong, W.; Li, J.; Chen, Q. J. Virol. Methods 2008, 151, 35–39. (25) Ramalingam, N.; San, T. C.; Kai, T. J.; Mak, M. Y. M.; Gong, H. Q. Microfluid. Nanofluid. 2009, 7, 325–336. (26) Shin, Y. S.; Cho, K.; Lim, S. H.; Chung, S.; Park, S. J.; Chung, C.; Han, D. C.; Chang, J. K. J. Micromech. Microeng. 2003, 13, 768–774.

Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

3003

Figure 1. Eight-channel PDMS-glass hybrid microfluidic chip for LAMP: (A) photograph and (B) schematic drawing of an eight-channel PDMS-glass hybrid microfluidic chip.

the fact that µLAMP does not require changes in temperature, a protocol that may bring about problems such as bubble generation in PDMS. In this respect, µLAMP is particularly compatible with PDMS. As an isothermal DNA amplification device, our µLAMP chip did not require a precise thermal cycling module. A water bath or heat block alone was sufficient for performing the µLAMP, which would be more acceptable in resource-poor settings. Sensitivity and Specificity of the µLAMP. During LAMP amplification, a large amount of byproduct, a white precipitate of magnesium pyrophosphate, appears, leading to a turbid reaction mixture, which could be directly observed by the naked eye.27 We incorporated this visual detection method in the µLAMP system. Such visual detection often suffers from low sensitivity in microchannels because of the short optical length. Lee et al. demonstrated the necessity of at least a volume of 25 µL in the microchamber for the turbidity detection. Zhang et al. presented a 10 µL volume LAMP microchamber for visual determination.28 In our system, we designed an optical length of 800 µm for turbidity detection of µLAMP while the reaction volume was reduced to 5 µL. The sensitivity of the µLAMP was evaluated by the naked eye visual analysis and standard agarose gel electrophoresis using a series of PRV DNA dilutions (10-2 to 10-8) as templates (original concentration of DNA sample was 10 ng/µL). We observed that the detection limit of the assay was 10 fg of DNA, 100-1000-fold more sensitive than the standard PCRs for PRV detection (Figure 2).24 The high sensitivity of our system was possibly attributable to the merits of Bst polymerase and loop-mediated mechanism of the amplification.1 Otherwise, the turbidity in the microchannels did not decrease simultaneously with reduction of the initial DNA copies, which made the naked eye detection more powerful and effective (Figure 2A). To demonstrate the specificity of µLAMP, we applied a Hinc II restriction enzyme digestion assay.24 Products of a band of predictable size of ∼108 bp were resolved on the gel after the Hinc II enzyme digestion assay, demonstrating that the target region of the nucleic acid was amplified specifically (Figure 3B, lane 2). To validate the specificity of µLAMP for PRV, we used viruses not targeted by the LAMP primers, namely, foot-and-mouth disease virus (FMDV), transmissible gastroenteritis of swine virus (TGEV), and porcine parvovirus (PPV) as control experiments. The result shows that µLAMP is highly specific and does not bring about cross-reaction from nontargeted viruses (Figure 3A). Moreover, the specificity of LAMP can be confirmed by the ladderlike pattern observed in gel electrophoresis (Figure 3B, lane 1).1,27 (27) Mori, Y.; Nagamine, K.; Tomita, N.; Notomi, T. Biochem. Biophys. Res. Commun. 2001, 289, 150–154. (28) Hataoka, Y.; Zhang, L. H.; Mori, Y.; Tomita, N.; Notomi, T.; Baba, Y. Anal. Chem. 2004, 76, 3689–3693. (29) Vanoirschot, J. T. J. Clin. Microbiol. 1991, 5–9.

3004

Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

Figure 2. Sensitivity of the µLAMP: (A) direct naked eye detection. Channels 1-5 show the white precipitate (channels appear white), while channels 6-8 do not (channels appear dark). (B) Sensitivity of the LAMP determined by standard agarose gel electrophoresis. (1-7) DNA sample located at 10-2 (105 fg/µL), 10-3 (104 fg/µL), . . . 0.10-7 (0.1 fg/µL) dilutions, respectively, and (8) negative control.

Figure 3. The specificity of the µLAMP: (A) specificity of the µLAMP determined by nontargetted viruses; (1-5) PRV, FMDV, TGEV, PPV, and negative control, respectively. (B) The specific amplification confirmed by the Hinc II enzyme; (M) DL2000 DNA marker, (1) ladderlike bands of µLAMP, (2) product of a band of predictable size of ∼108 bp determined by the Hinc II assay, (3) negative control.

Because of the very weak turbid signal of LAMP in the traditional PCR tube, many groups have developed other detection methods in recent years, such as various DNA staining methods, fluorescent LAMP primers,30 fluorescent metal indicators,31 and so forth. These methods typically rely on either complex equipment or sophisticated chemical synthesis. We can, however, easily observe the turbidity in the microchamber with the naked eye alone, which makes µLAMP suitable for integration into complex systems designed to be in a lab-on-a-chip format without having to resort to bulky equipments required in many complex methods. We ascribe the strong turbid signal in the microchamber to its larger depth-to-width ratio (DWR of the microchamber in our µLAMP and a typical PCR tube was 1.33 and 1.00, respectively). In a word, the µLAMP established in our study using the direct naked eye detection was highly sensitive, specific, and could be (30) Mori, Y.; Hirano, T.; Notomi, T. BMC Biotechnol. 2006, 6, 3. (31) Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Nat. Protoc. 2008, 3, 877– 882.

Table 1. Merits of µLAMP Compared with Other Techniques methods µLAMP PCR24 ELISA29 neutralization29,32,33

sensitivity specificity sample time 10 fg/µL 103 fg/µL ∼103 fg/µL low

high high low high

0.4 µL 2 µL 2 µL ∼50 µL

0.5-1 h 1.5-2 h 2-3 h 3 days

equipment water bath thermocycler ELISA reader biosafety lab

conducted together with the amplification in one step without using any detection reagents or equipment. The notable merits of the µLAMP were compared with other methods, including polymerase chain reaction (PCR), enzyme-linked immunosorbant assay (ELISA), and direct virus isolation assay, which were demonstrated in Table 1. We believe that this method has great potential for developing point-of-care devices. µLAMP for Quantitative Analysis. To further show that µLAMP can be easily expanded for more sophisticated assays, we demonstrate that the µLAMP system could also be applied for the quantitative analysis via measuring the absorbance of the reaction mixture. Absorbance assay is a flexible and robust technology commonly used in microfluidic chips.32 Because of the generation of turbidity in LAMP reaction, we performed the turbidity absorbance detection by integrating optical fibers in the microfluidic chip to realize real-time monitoring of the LAMP process and its quantitative analysis. We applied a single channel optical detection module with a 1.2 mm detection length to develop the quantitative µLAMP (Figure 4). We obtained values of threshold time (Tt, defined as the reaction time necessary for samples to reach sufficiently positive signals above the baseline during real-time amplification) of µLAMP by measuring absorbance. LAMPs from different initial concentrations of DNA template had different values of Tt, which can be related to the initial DNA concentration. Tt could be obtained by monitoring absorbance, which changes in real time as a result of the accumulation of precipitates.22 We used serial dilutions (10-fold) of DNA templates from 105 to 10 fg/µL to generate standard dynamic curves by the optical µLAMP chip system and corresponding Tt values (Figure 5 A). The log linear regression plot between template concentration and Tt shows a correlation coefficient of 0.9894, making the fiber optical µLAMP chip useful for quantitative DNA analysis (Figure 5 B).

Figure 4. Photograph (A) and schematic illustration (B) of the quantitative analysis unit.

Figure 5. Results from the optical absorbance assay: dynamic curves (A) and standard curve (B) of the real-time absorbance detection of the LAMP chip.

From the results shown in Figure 5, The LAMP amplification from the lowest sample concentration (10 fg/µL DNA) initiated a positive response at 46 min and then proceeded rapidly at an approximate exponential rate, reaching a maximum at 50 min. Experiments with high initial DNA concentrations exhibited fast positive responses in reaching the maximum. All curves decreased slightly after the maximum time. We attribute this observation to the following reasons: (1) precipitation and aggregation of magnesium pyrophosphate and (2) adsorption of pyrophosphates on the microchannel surface. This decay in turbidity absorbance does not affect the accuracy of the quantitative analysis because of the prominence of the emergence of the Tt. Compared with other known methods for detecting viruses, µLAMP is relatively fast, and virus isolation33 and immunohistological methods34 for detecting PRV are both time-consuming, requiring at least 2-3 days, while PCR assays also required 2-3 h to finish the amplification.35-37 By contrast, in our system, LAMPs from detectable DNA samples could all be accomplished within 60 min (with higher concentrations of samples requiring even less time, see Figure 5. This time was comparably short among various methods. The whole diagnostic process from the sample arrival to the final result readout could be accomplished within less than 2 h. Although fluctuations could not be avoided between runs in this homemade single channel optical detection system, the emergence of new technologies, such as integrated optical waveguides in microfluidics or optofluidics, may bring us the hope (32) Myers, F. B.; Lee, L. P. Lab Chip 2008, 8, 2015–2031. (33) Pensaert, M. B.; Kluge, J. P. In Virus Infections of Porcines; Pensaert, M. B., Ed.; Elsevier: Amsterdam, The Netherlands, 1989; pp 39-65. (34) Ducatelle, R.; Coussement, W.; Hoorens, J. Res. Vet. Sci. 1982, 32, 294– 302. (35) Osorio, F. A. In First International Symposium on the Eradication of Pseudorabies Aujeszky’s Disease Virus; Morrison, R. B., Ed.; Elsevier: Saint Paul, MN 1991; pp 17-32. (36) Balasch, M. J.; Segale, P. J. Vet. Microbiol. 1998, 60, 99–106. (37) Lee, C. S.; Moon, H. J.; Yang, J. S. J. Virol. Methods 2007, 139, 39–43.

Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

3005

in realizing multichannel detection, which may achieve increasingly accurate real-time quantitative analysis in one experiment.38,39 The combination of the turbidity-based readout of LAMP and the optical fiber incorporation in the microfluidic chip would be an attractive area and bring us a fascinating future to achieve a POC quantitative nucleic acid analytical device which could be used to survey and combat epidemics, such as SARS, tuberculosis, or influenza A (H1N1) and so forth. CONCLUSIONS In this study, we integrated an isothermal DNA amplification, LAMP, on a microfluidic chip and fabricated a multichannel microfluidic system for parallel detection of pathogens. The readout could either be a naked-eye determination or a compact real-time absorbance detection device. The µLAMP presented here allows the direct analysis of a sample of 0.4 µL of interested DNA in less than 1 h with a detection limit of 10 fg/µL. (38) Balslev, S.; Jorgensen, A. M.; Bilenberg, B.; Mogensen, K. B.; Snakenborg, D.; Geschke, O.; Kutter, J. P.; Kristensen, A. Lab Chip 2006, 6, 213–217. (39) Keea, J. S.; Poenarb, D. P.; Neuzil, P.; Yobas, L. Sens. Actuators, B 2008, 134, 532–538.

3006

Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

The combination of LAMP and microfluidics will perform diagnostics in a parallel, multiple, high-throughput, and integrated format. The technology presented here will eventually facilitate the realization of POC devices that can be used anywhere, by anyone to assay for agents that are associated with epidemics. ACKNOWLEDGMENT We are grateful for the kind help from the colleagues in our groups, particularly Wanshun Ma for his help in chip fabrication and Wenying Pan, Bo Yuan, and Yi Zhang for their assistance in image illustration. We thank Dr. Hui Chen for her helpful advice in the manuscript revision. We acknowledge the National Science Foundation of China (2Grants 0945001, 20890020, 20890022, 2009ZX10605, and 90813032), the Human Frontier Science Program, the Chinese Academy of Sciences (Grant KJCX2-YW-M15), and the Ministry of Science & Technology (Grants 2007CB714502, 2009CB930001, and 2009ZX10004-505) for financial support. Received for review January 9, 2010. Accepted March 3, 2010. AC1000652