Bioconjugate Chem. 2007, 18, 1450−1459
1450
Lung Delivery Studies Using siRNA Conjugated to TAT(48-60) and Penetratin Reveal Peptide Induced Reduction in Gene Expression and Induction of Innate Immunity Sterghios Athanasios Moschos,*,† Simon Wyn Jones,‡ Mark Michael Perry,† Andrew Evan Williams,† Jonas Sten Erjefalt,§ John James Turner,| Peter John Barnes,† Brian Stephen Sproat,⊥ Michael John Gait,| and Mark Andrew Lindsay† Biopharmaceutics Research Group, Airways Disease, National Heart and Lung Institute, Imperial College, London, UK, AstraZeneca R&D, Respiratory and Inflammation Research Area, Alderley Park, Macclesfield, Cheshire, UK, Department of Experimental Medical Science, Division of Vascular and Airway Research, Lund University, Lund, Sweden, Medical Research Council Laboratory of Molecular Biology, Cambridge, UK, and Integrated DNA Technologies, BVBA, Leuven, Belgium . Received March 8, 2007; Revised Manuscript Received May 31, 2007
The therapeutic application of siRNA shows promise as an alternative approach to small-molecule inhibitors for the treatment of human disease. However, the major obstacle to its use has been the difficulty in delivering these large anionic molecules in ViVo. In this study, we have investigated whether siRNA-mediated knockdown of p38 MAP kinase mRNA in mouse lung is influenced by conjugation to the nonviral delivery vector cholesterol and the cell penetrating peptides (CPP) TAT(48-60) and penetratin. Initial studies in the mouse fibroblast L929 cell line showed that siRNA conjugated to cholesterol, TAT(48-60), and penetratin, but not siRNA alone, achieved a limited reduction of p38 MAP kinase mRNA expression. Intratracheal administration of siRNA resulted in localization within macrophages and scattered epithelial cells and produced a 30-45% knockdown of p38 MAP kinase mRNA at 6 h. As with increasing doses of siRNA, conjugation to cholesterol improved upon the duration but not the magnitude of mRNA knockdown, while penetratin and TAT(48-60) had no effect. Importantly, administration of the penetratin or TAT(48-60) peptides alone caused significant reduction in p38 MAP kinase mRNA expression, while the penetratin-siRNA conjugate activated the innate immune response. Overall, these studies suggest that conjugation to cholesterol may extend but not increase siRNA-mediated p38 MAP kinase mRNA knockdown in the lung. Furthermore, the use of CPP may be limited due to as yet uncharacterized effects upon gene expression and a potential for immune activation.
INTRODUCTION The discovery of RNA interference (RNAi) and the application of short interference RNA (siRNA) for the knockdown of protein expression through mRNA degradation has revolutionized the area of functional genomics (1, 2). Thus, siRNA macromolecules composed of double-stranded RNA 21-23 nucleotides in length are now commonly used in cell-based studies to investigate gene function. Furthermore, a number of academic groups and biotechnology companies are investigating the utility of siRNA as a therapeutic approach in the treatment of diseases such as macular degeneration, hepatitis C infection, and cancer (3-6). Compared with small molecule inhibitors, the relatively large size and anionic charge of siRNA means that one of the key barriers to their in ViVo use is the availability of effective approaches for delivery both to specific tissues and across the plasma membrane. Since intravenous siRNA administration is subject to first-pass metabolism, unless a liver condition is being * Author to whom correspondence should be addressed: Sterghios A. Moschos, Ph.D., Biopharmaceutics Research Group, Airways Disease, National Heart and Lung Institute, Imperial College, Dovehouse Street, London, SW3 6LY, UK Tel: +44 2073528121 ext 3061; Fax: +44 2073528127; E-mail:
[email protected]. † Imperial College. ‡ AstraZeneca R&D. § Lund University. | Medical Research Council Laboratory of Molecular Biology. ⊥ Integrated DNA Technologies.
targeted (i.e., hepatitis C infection), therapeutic application is limited to tissues where siRNA localization for extended periods is possible, e.g., following intra-ocular injection for the treatment of macular degeneration. In the case of the lung, the structure of the tissue permits direct access to large numbers of cells within the branching airways and alveoli, an estimated surface area of 400 m2 in man. Importantly, the facility of topical delivery via intranasal, intratracheal, or aerosol administration suggests the lung as an ideal target organ for siRNA-based therapeutics. Indeed, studies have shown that siRNA-mediated attenuation of cytokine (7) and heme oxygenase-1 expression (8) during acute lung injury. Similarly, intranasal and intratracheal siRNA administration have been shown to prevent parainfluenza and respiratory syncytial virus (PIV and RSV, respectively) infection in mice (9-12) and severe acute respiratory syndrome (SARS) infection in rhesus monkeys (13). In the majority of these studies, cationic lipids (e.g., lipofectin) and polymers (e.g., PEI and dendrimers) have been employed to package and deliver the siRNA to the lung. However, generic application of these strategies is limited by drawbacks such as toxicity and siRNA-mediated induction of immune responses through Toll-like receptors (TLR) (14-16). In an attempt to circumvent these problems, we examined the utility of chemical conjugation of siRNA to the nonviral delivery vector cholesterol and the cell-penetrating peptides (CPP) penetratin and TAT(48-60) to improve siRNA-mediated mRNA knockdown in the mouse lung. Specifically, we attempted to target the constitutively expressed p38 mitogen-activated protein (MAP) kinase (also known as MAPK14). Activation of this protein is known
10.1021/bc070077d CCC: $37.00 © 2007 American Chemical Society Published on Web 08/21/2007
CPP and Cholesterol−siRNA Conjugates in Mouse Lung
to be important in the release of multiple pro-inflammatory mediators including tumor necrosis factor (TNF)-R and interleukin (IL)-1. Indeed, many pharmaceutical companies are developing small-molecule inhibitors that target p38 MAP kinase to be used in the treatment of a host of inflammatory diseases including rheumatoid arthritis, Crohn’s disease, chronic obstructive pulmonary disease, and psoriasis (17, 18). Chemical conjugation of siRNA to cholesterol has been shown to facilitate intracellular siRNA uptake in Vitro (19) and in ViVo (20). In the latter case, intravenous administration of cholesterol-conjugated siRNA was shown to silence endogenous apolipoprotein B (ApoB) gene expression in the liver and jejunum, resulting in decreased plasma levels of apoB protein and total cholesterol (20). Interestingly, a recent study has shown that the delivery of siRNA targeted to ApoB can be further increased ∼20-fold compared to cholesterol conjugation by formulation in stabilized nucleic acid lipid particles (SNALP) (21). Additional evidence of the utility of cholesterol for oligonucleotide delivery is provided in a recent report showing cholesterol-mediated delivery of 2′-O-methyl- and phosphorothioate-modified single-stranded RNA for the knockdown of microRNA expression in the liver, lung, kidney, heart, intestine, fat, skin, bone marrow, muscle, ovaries, and adrenal glands following intravenous injection (22). The CPP TAT(48-60) and penetratin are short cationic peptides derived from the HIV-1 TAT trans-activator protein (23, 24) and the insect Antennaedia homeoprotein (25) that have been extensively used for the in Vitro and in ViVo delivery of biologically active peptides and proteins (26, 27). Significantly, CPP have been shown to mediate uptake of a range of biological and nonbiological cargos, which has led to the suggestion that they may represent a universal, nontoxic approach for the delivery of oligonucleotides (28-31). Interestingly, although no studies have examined the utility of CPP for the in ViVo delivery of siRNA, this possibility is supported by reports showing penetratin-mediated delivery of siRNA and antisense into isolated neurons (32-34) and TAT(48-60)-siRNA conjugate-mediated knockdown of eGFP and CDK9 expression in HeLa cells (35). In this report, we demonstrate that intratracheal administration of siRNA achieved a limited attenuation of mRNA expression in the lung for an endogenous, constitutively expressed target, p38 MAP kinase. However, although conjugation to cholesterol, TAT(48-60), or penetratin facilitated knockdown of p38 MAP kinase mRNA in a mouse cell line, only cholesterol-siRNA conjugates were found to influence target gene mRNA levels in ViVo. Importantly, since both CPP inhibited p38 MAP kinase mRNA expression in ViVo, but not in Vitro, we document the existence of as yet uncharacterized CPP bioactivity. Moreover, the detection of innate immune response induction by penetratin-siRNA but not TAT(48-60)-siRNA conjugates suggests differential cellular uptake mechanisms between the two CPP.
EXPERIMENTAL METHODS siRNA Conjugation and Annealing. Initial screening studies were performed with pre-annealed and PAGE-purified siRNA obtained from Dharmacon, Inc. (Lafayette, USA), using the followingsequences: Assense,5′-GCACACUGAUGAUGAGAUGUU-3′; antisense, 5′-CAUCUCAUCAUCAGUGUGCUU-3′; Bssense, 5′-ACAUUCGGCUGACAUAAUUUU-3′; antisense, 5′-AAUUAUGUCAGCCGAAUGUUU-3′; Cssense, 5′-GGGAGGUGCCCGAACGAUAUU-3′; antisense, 5′-UAUCGUUCGGGCACCUCCCUU-3′; mismatch 1 (MM1)ssense, 5′CCGAGGUGGCGGAACGAUAUU; antisense, 5′-UAUCGUUCCGCCACCUCGGUU-3′; mismatch 2 (MM2)ssense, 5′-GCGAGCUGCGCGAAGGAUAUU-3′; antisense, 5′-UAUCCUUCGCGCAGCUCGCUU-3′.
Bioconjugate Chem., Vol. 18, No. 5, 2007 1451
The synthesis of disulfide-linked constructs was performed by Dr. Brian Sproat at Integrated DNA Technologies (Leuven, Belgium). Npys-activated C-terminal Cys containing TAT(4860 - grkkrrqrrrppqc) and penetratin (rqikiwfqnrrmkwkkc) peptides with N-terminal acetyl and C-terminal amide functions were obtained from American Peptide Company Inc. (Sunnyvale, USA) and conjugated to the 5′-end of the sense strand of sequence C (HS-(CH2)6-OP(O2-)-GGGAGGUGCCCGAACGAUAUidT) via disulfide exchange under denaturing conditions in the presence of urea. The two peptide-RNA conjugates were purified by preparative anion-exchange HPLC under denaturing conditions, desalted, and supplied as lyophilized sodium salts. The purity of the final products was determined by analytical anion-exchange HPLC and electrospray mass spectroscopy with deconvolution. For analytical HPLC, constructs were eluted through MonoQ 5/5 columns (Amersham Biosciences, Piscataway, NJ) with a linear gradient from 10% to 50% buffer B in buffer A + B during 30 min at a flow rate of 1 mL/min, with the effluent monitored by UV spectroscopy at 260 and 280 nm. For HS-(CH2)6-OP(O2-)-GGGAGGUGCCCGAACGAUAUidT, analytical HPLC buffer A consisted of 10 mM LiClO4, 20 mM Tris-HCl, 50 µM EDTA, and 8 M urea, pH 7.4; and buffer B was as buffer A with a [LiClO4] of 600 mM. For the penetratin and TAT(48-60) peptide-RNA conjugates, LiClO4 was substituted with NaCl at 10 mM and 1 M for buffers A and B, respectively. For Chol-(CH2)6-S-S-(CH2)6-O-P(O2-)-O-GGGAGGUGCCCGAACGAUAUidT, a linear gradient of 10% to 100% buffer B in A + B over 40 min elution at 1 mL/min was used, with buffers prepared in 20% v/v acetonatrile, pH 7.4, in the absence of urea, and 10 mM or 1 M NaCl (buffers A and B, respectively). The cholesterol-conjugated sense strand RNA was synthesized directly in solid phase using the commercially available cholesterol phosphoramidite coupled to a (CH2)6-SS-(CH2)6 linker at the 5′-end of the RNA. Mismatch studies in animals were performed with MM2-5′- H2N-CO-CH2-S-(CH2)6OP(O2)-GCGAGCUGCGCGAAGGAUAUidT-3′; antisense, 5′-UAUCCUUCGCGCAGCUCGCUidT-3′. For annealing, 240 nmol of lyophilized siRNA-sense strand or sense strand conjugates were resuspended at 240 µM concentrations in sterile Dulbecco’s phosphate buffered saline (PBS; Sigma, Poole, UK) and then mixed by pipetting with an equal volume of antisense strand (5′-UAUCGUUCGGGCACCUCCCUidT-3′) resuspended in PBS at equimolar concentrations, to give a final siRNA concentration of 1 nmol/µl. Annealing was performed by heating to 95 °C for 5 min on a Peltier element thermal cycler block followed by slow cooling over a period of 1 h. siRNA Construct Analysis and Quality Control. Annealing products were examined upon a precast 20% polyacrylamide Tris borate ethylenedinitrilotetraacetic acid (EDTA) gel (Invitrogen, Carlsbad, CA), RNA visualized by SybrGold staining as recommended by the manufacturer (Invitrogen), and documented using a computer-controlled UVP GelDoc-It Imagining System (Fisher) fitted with an ethidium bromide filter. Image analysis was performed using the UVP Labworks Image Acquisition and Analysis software version 4.6.00.0 (Media Cybernetics, Inc., Atlanta, GA). LPS content in dosing preparations was determined using the PyroGene Recombinant Factor C Endotoxin Detection System according to the manufacturer’s instructions (Cambrex Bio Science Wokingham Ltd, Wokingham, UK). To assess siRNA and siRNA conjugate susceptibility to RNases in a simulated lung microenvironment, stability studies were carried out in murine bronchoalveolar lavage (BAL) fluid. This was collected from three terminally anaesthetized male BALB/c mice (20-25 g) following exposure of the lungs by
1452 Bioconjugate Chem., Vol. 18, No. 5, 2007
three repeat lavages of 0.3 mL of RPMI media (Invitrogen). All collected media was pooled and stored at -20 °C. To assess siRNA stability in BAL fluid, annealed siRNA and siRNA constructs were incubated in excess volumes of 95% v/v murine BAL fluid at 37 °C. 20 µL volumes were removed at set time points, gel loading buffer II (Invitrogen) was quickly added to a final 1× concentration, and the mixture was snap-frozen in liquid nitrogen. Samples were thawed on ice, and 10 pmol quantities were analyzed by polyacrylamide gel electrophoresis (PAGE). In Vitro Cell Culture Studies. L929 cells were grown to 70% confluence in DMEM (Sigma) supplemented with 10% fetal calf serum, 1% penicillin/strepavidin/glutamine, and 5 mM nonessential amino acids (Invitrogen). On the day of transfection, cells were trypsinised and resuspended at 2 × 105 in media. siRNA, siRNA-Lipofectamine 2000 (Invitrogen) complexes prepared to the manufacturer’s instructions, or siRNA conjugates were diluted to 2× the final indicated concentration in OptiMEM (Invitrogen) and mixed with an equal volume of cell suspension to give a final serum concentration of 5% FCS. The cells were then plated into a 96-well plate in triplicate in a volume of 100 µL (1 × 104 cells/well) and incubated for 24 h at 37 °C before either RNA extraction or measurement of cell viability using the MTT assay (Sigma) was carried out. In ViWo Procedures. All in ViVo procedures were carried out under local ethics approval and in strict accordance to the 1986 Animals (Scientific Procedures) Act. Groups of 6-18 male BALB/c mice (20-25 g) were sedated with 4% Halothane in O2 and given the indicated dose of siRNA, mismatch, siRNA conjugates, TAT(48-60), penetratin, polyinosinic/polycytidylic acid (poly(I:C); Sigma), or LPS from Escherichia coli 0111: B4 (Sigma) in 20 µL volumes by intratracheal administration. Animals were sacrificed at the indicated time points using an overdose of pentobarbitone (200 mg/kg intraperitoneally). RNA Extraction and Determination of p38 MAP Kinase mRNA Expression. Cell culture samples were extracted using the Qiagen RNeasy mini kits according to the manufacturer’s instructions (Qiagen, Crawley, UK). Animal tissues were gently removed immediately after confirmation of death and stored in RNAlater according to the manufacturers’ instructions (Sigma). Total RNA was extracted by rotor/stator homogenization in Tri Reagent (Sigma) using an Ultraturrax T18 homogenizer (Fisher Scientific), followed by isopropanol precipitation of the aqueous phase and reconstitution in RNase-free water (Promega, Southampton, UK). Yield and purity were determined by spectrophotometric measurement of the absorbance at 260 nm and 280 nm. For the determination of p38 MAP kinase mRNA expression, mouse-specific Taqman primers and probes were obtained from the “Assay on Demand” service provided by Applied Biosystems (assay no. Mm00442497_m1, Applied Biosystems, Applera Corp., Warrington, UK). Real-time PCR was performed using the one-step Quanti-Tect RT-PCR Kit (Qiagen) in a MicroAmp 96-well reaction plate (Applied Biosystems). Each well contained 25 ng total RNA, 300 nM of forward and reverse transcription primers, and 125 nM Taqman probe in a reaction volume of 25 µL. All sample and nontemplate control reactions were performed in the ABI Prism 7700 Sequence Detection System (Applied Biosystems) in triplicate. Comparative slopes of the relationship between log[RNA] and Ct (gradient ) -3.3) for both the gene of interest and the endogenous control 18S (Applied Biosystems) indicated that the comparative Ct method (∆∆Ct ) could be used for the relative quantification of gene expression. Data were analyzed on the Prism version 4.03 statistic analysis package (GraphPad Software, Inc., San Diego, CA) using nonparametric analysis of variance followed by Tukey post-tests where appropriate.
Moschos et al.
Measurement of Cytokine Protein Expression. Lungs were gently removed immediately after confirmation of death and snap-frozen in liquid nitrogen, then stored at -80 °C. Frozen lung was homogenized in ice-cold RIPA buffer (25 µg/mL aprotinin, 10 µg/mL leupeptin, 10 µg/mL pepstatin A, 5 mM dithithreitol, 0.5 mM phenylmethylsulphonyl fluoride, 2 mM sodium orthovanadate, 1.25 mM sodium fluoride, 1 mM sodium pyrophosphate; Sigma) at a ratio of 1 mL per 100 mg tissue, using an Ultraturrax T18 homogenizer. The homogenates were then spun in a refrigerated (4 °C) tabletop microcentrifuge at 21 000 g for 20 min. The supernatants were removed and stored at -20 °C. Total protein content was determined by Bradford Assay (Bio-Rad, Hertfordshire, UK) according to the manufacturer’s instructions. Tissue tumor necrosis factor (TNF)-R, interleukin (IL)-12 p40 (DuoSet ELISA kits; R&D Systems Europe, Abingdon, UK), and interferon (IFN)-R (PBL laboratories, Piscataway, NJ) were measured by sandwich ELISA and normalized for total protein content. Histology. The 5′-end Cy3-labeled antisense strand (Dharmacon) was annealed to the appropriate sense strand, and 10 nmol of the resulting Cy3-labeled siRNA, penetratin-siRNA, TAT-siRNA, or cholesterol-siRNA or equimolar amounts of Cy3 alone were given by intratracheal administration. Whole lungs were collected 3 h later and fixed in 4% formaldehydesupplemented phosphate buffered saline (Sigma). After fixation, the samples were rinsed in 70% EtOH, dehydrated, and embedded in paraffin. Paraffin sections (3 µm, Leica microtome, Leica Microsystems, Milton Keynes, UK) were rehydrated, rinsed in Tris-buffered saline pH 7.6 (Sigma), and stained with the DNA-binding fluorochrome Hoechst 33342 (Sigma). After mounting in Aqua Perm mountant (484975 Life Sci. International), Cy3 (red channel) and Hoechst 33342 (green channel) were visualized on an epifluoresence microscope (Olympus BX10, Olympus Sveridge AB, Solna, Sweden) equipped with a high-resolution Olympus DP-50 digital camera (Olympus Sveridge AB) linked to a computerized image analysis system (Viewfinder Lite, v1, Pixera Co, and Image-Pro Plus v 4.5, Media Cybernetics). Cy3-siRNA positive cell phenotypes in the lung parenchyma alveolar macrophages were distinguished from structural alveolar cells by immunohistochemical visualization of the macrophage marker F4/80 (36). Briefly, after rehydration the slides were subjected to antigen retrieval through mild proteinase K digestion (Sigma). After blocking the nonspecific binding sites, sections were incubated with a monoclonal rat anti-murine F40/80 (dilution 1:50, clone CI: A3-1, Serotec Ltd, Oxford, UK) for 1 h. After repeated rinsing, the immunoreactivity was detected by an Alexa 448 conjugated goat anti-rat antibody (green channel).
RESULTS TAT(48-60), Penetratin, and Cholesterol-Mediated siRNA Knockdown of p38 MAP Kinase mRNA in a Mouse Cell Line. Initial studies were focused upon the identification of an optimum siRNA sequence for p38 MAP kinase mRNA knockdown. To this end, the concentration-dependent knockdown achieved by three siRNAs was determined in the L929 mouse fibroblast cell line at 24 h (Supporting Information Figure S1) following reverse transfection with Lipofectamine 2000. Thus, an efficacious sequence (C) was selected that gave a maximal knockdown of 87% and an EC50 of 139 pM when transfected into the cells with lipofectamine (Figure 1). As a negative control, we identified a four mismatch siRNA sequence that gave no significant knockdown except at the highest concentration of 100 nM, where we observed a p38 MAP kinase mRNA reduction of ∼20% (Figure 1). To facilitate the conjugation of TAT(48-60), penetratin, or cholesterol upon siRNA, the 5′end of the siRNA sense strand was modified with a C6-thiol
CPP and Cholesterol−siRNA Conjugates in Mouse Lung
Figure 1. Addition of the C6 linker to a p38 MAP kinase siRNA causes a shift in EC50 without affecting maximal knockdown. L929 cells were reverse-transfected with the indicated concentrations of siRNA (square), C6 linker modified siRNA (circle), or mismatch control (open triangle) using Lipofectamine 2000; the RNA was extracted at 24 h; p38 MAP kinase mRNA levels were determined by TaqMan RTPCR, normalized against 18S, and plotted as the percentile expression of lipofectamine-treated controls (means ( SEM of three independent experiments).
linker, providing a thiol group for disulfide conjugation with a cysteine residue on the CPP (Analytical HPLC and electrospray mass spectrograms available in Supporting Information Figure S2). C6-thiol linker-modified sense strands and CPP-sense strand conjugates were then annealed to the antisense strand to yield siRNA duplexes. To evaluate the impact of the conjugation of the C6-thiol linker group on the biological action of the siRNA, C6-thiol modified siRNA duplexes were transfected using lipofectamine 2000 in cultured L929 fibroblasts. Addition of the C6-thiol linker to the siRNA had no significant effect upon the magnitude of knockdown but caused a shift in the EC50 to 798 pM (Figure 1). Visual examination of CPP-siRNA constructs showed no precipitation, while separation on 20% polyacrylamide gels demonstrated the formation of discrete annealed products (Figure S2). In contrast, annealing of the cholesterol-siRNA gave a higher molecular weight product, suggesting the formation of higher-order structures. The biological action of siRNAs conjugated to TAT(4860), penetratin, or cholesterol was then examined in Vitro
Bioconjugate Chem., Vol. 18, No. 5, 2007 1453
following a 24 h incubation in the absence of any transfection reagent (i.e., Lipofectamine 2000). Figure 2 shows that equimolar concentrations of siRNA incubated in the absence of Lipofectamine 2000, TAT(48-60) peptide, or penetratin peptide had no effect upon p38 MAP kinase mRNA levels. In contrast, the TAT(48-60)-, penetratin-, and cholesterol-siRNA conjugates produced a small but significant knockdown of 36% ( 6%, 20% ( 3%, and 28% ( 7%, respectively, at 10 µM (Figure 2). Examination of all the constructs showed no significant cellular toxicity at 24 h (Supporting Information Figure S4). siRNA-Mediated mRNA Knockdown of p38 MAP Kinase in Mouse Lung. Examination of the relative levels of p38 MAP kinase expression in mouse tissues indicated constitutive expression in the lung (Supporting Information Figure S5). To ascertain the capacity of siRNA to down-regulate p38 MAP kinase mRNA levels, increasing doses of the C6-thiol linker-modified siRNA were administered intratracheally, and the effect upon p38 MAP kinase mRNA expression was determined over a 24 h period. From Figure 3, it can be seen that all doses of the linker-modified siRNA (50 nmol, 10 nmol, or 1 nmol siRNA) produced a significant (∼30-45%) mRNA knockdown at 6 h. However, this effect appeared transient, and only animals dosed with 50 nmol showed significantly attenuated gene expression at 12 h (30 ( 5%) and 24 h (20 ( 6%). Administration of 10 nmol mismatch control produced no significant down-regulation of p38 MAP kinase expression over the 24 h period (Figure 4). Effect of Conjugation to TAT(48-60), Penetratin and Cholesterol upon siRNA-Mediated mRNA Knockdown of p38 MAP Kinase in the Mouse Lung. We next investigated whether the duration and magnitude of p38 MAP kinase mRNA knockdown could be influenced by conjugation of the siRNA to TAT(48-60), penetratin, or cholesterol (Figure 4). TAT(48-60)-siRNA showed 20-30% knockdown at all time points, although this was only significant at 12 h. However, though this knockdown was comparable to that achieved by equimolar doses of unconjugated siRNA, administration of the TAT(48-60) peptide alone produced a comparable and statistically significant knockdown at all time points examined, suggesting the CPP as a modulator of p38 MAP kinase expression. Similarly, although the penetratin-siRNA conjugate appeared to show increased knockdown (47 ( 9%) at 6 h, the peptide alone also caused significant reduction (30 ( 7%) of p38 MAP kinase mRNA levels. In contrast, cholesterolconjugated siRNA increased the duration but not the magnitude of the response: significant reduction of p38 MAP kinase mRNA expression was seen both at 6 h (28 ( 9%) and at 12
Figure 2. Conjugation of cell penetrating peptides or cholesterol facilitates siRNA-mediated p38 MAP kinase knockdown in Vitro in the absence of transfection reagents. L929 cells were incubated for 24 h with the indicated concentrations of siRNA without Lipofectamine 2000, TAT(48-60) peptide (TAT), penetratin peptide (Pen), or siRNA conjugated to TAT(48-60), (TAT-siRNA), penetratin (Pen-siRNA) or cholesterol (Chol-siRNA) in the absence of transfection reagents; RNA was extracted; p38 MAP kinase mRNA levels were determined by Taqman RT-PCR, normalized to 18S, and plotted as the percentile expression of lipofectamine treated controls (means ( SEM of three independent experiments; p vs nontreated controls: *
