Magnetic enhancement of chondrogenic differentiation of

Article Cite This: ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX

pubs.acs.org/journal/abseba

Magnetic Enhancement of Chondrogenic Differentiation of Mesenchymal Stem Cells Jianghong Huang,†,‡,§ Yujie Liang,†,⊥,∥ Zhiwang Huang,‡,§ Pengchao Zhao,# Qian Liang,‡,§ Yonglong Liu,‡,§ Li Duan,‡,§ Wei Liu,‡,§ Feiyan Zhu,‡,§ Liming Bian,# Jiang Xia,*,⊥ Jianyi Xiong,*,‡,§ and Daping Wang*,‡,§

Downloaded via UNIV AUTONOMA DE COAHUILA on April 5, 2019 at 15:30:23 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

‡

Shenzhen National Key Department of Orthopedics and §Shenzhen Key Laboratory of Tissue Engineering, Shenzhen Laboratory of Digital Orthopedic Engineering, Shenzhen Second People’s Hospital (The First Hospital Affiliated to Shenzhen University), Shenzhen 518035, China ⊥ Department of Chemistry, The Chinese University of Hong Kong, Shatin, Hong Kong SAR, China ∥ Shenzhen Kangning Hospital, Shenzhen Mental Health Center, Shenzhen, Guangdong Province, China # Department of Biomedical Engineering, The Chinese University of Hong Kong, Shatin, Hong Kong SAR, China S Supporting Information *

ABSTRACT: Pulsed electromagnetic field therapy, or pulsed signal therapy, has shown efficacy in treating many illnesses, including knee osteoarthritis. Although the mechanism is not fully understood, magnetic therapy is broadly welcomed because of its safe and noninvasive nature. At the cellular and molecular level, remote control of the cell fate by the magnetic field also has profound applications in both basic science and translational research. Here we demonstrate the use of pulsed electromagnetic field, one of the most benign and noninvasive extracellular cues, as a novel method to control specific chondrogenic differentiation of mesenchymal stem cells (MSCs). Chondrogenesis of transplanted MSCs inside the joint is considered one of the future therapies to rebuild the damaged cartilage. Here we show that pulsed electromagnetic field promotes chondrogenic differentiation of MSCs, and such a promoting effect can be drastically enhanced by the combined use of a magnetic hydrogel as the cell growth matrix. The magnetic hydrogel, synthesized by chemical cross-linking of gelatin and β-cyclodextrin and by embedding Fe3O4 magnetic nanoparticles in the hydrogel network, supports adhesion, growth, and proliferation of MSCs. Pulsed electromagnetic field boosts chondrogenesis of MSCs grown on the magnetic hydrogel, manifested by enhanced toluidine blue staining; higher expression of collagen II protein; and upregulation of collagen II, aggrecan, and SOX9 genes. Therefore, our work presents a robust method for chondrogenesis of MSCs using magnetic field as the external cue. KEYWORDS: pulse electromagnetic field, bone marrow mesenchymal stem cell, magnetic hydrogel, chondrogenesis, cartilage regeneration Pulsed electromagnetic field therapy, or pulsed signal therapy, has been considered a safe and effective treatment of knee osteoarthritis and has been used in thousands of patients.5−7 Although the mechanism is still poorly understood, the beneficial effects of the pulsed electromagnetic field (PEMF) on fracture healing and pain reduction for patients with osteoarthritis and other bone disorders have been shown in clinical trials.8−15 It was suggested that the clinical effects of PEMF may be explained by the change of the extracellular matrix of skeletal tissues and the progenitor cells such as mesenchymal stem cells.16−19 Moreover, the electromagnetic field treatment has been found to enhance cell differentiation.8−10 More specifically PEMF promotes the osteo-

1. INTRODUCTION Adult cartilage has only limited regenerative capability, and when left untreated cartilage disorders may result in progression to osteoarthritis. There are no known drugs today that can retard or reverse the progress of osteoarthritis. Surgical interventions including autologous and matrix-assisted chondrocyte implantation are often used,1 but whether surgical therapies can effectively prevent or delay the development of osteoarthritis is still in debate. Stem-cell-based interventions have attracted increasing attention recently, supported by an exponential growth in the number of published studies in this area.2,3 Specifically, mesenchymal stem cells, a type of multipotent stem cells isolated from sources such as bone marrow, can differentiate down osteogenic, chondrogenic, myogenic, and tenogenic lineages, and are used widely in the orthopedic and tissue engineering communities.4 © XXXX American Chemical Society

Received: January 5, 2019 Accepted: March 28, 2019 Published: March 28, 2019 A

DOI: 10.1021/acsbiomaterials.9b00025 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX

Article

ACS Biomaterials Science & Engineering

centrifuge) at 40 °C, GPTMS was added subsequently as a crosslinker and 20 mg Fe3O4 magnetic nanoparticles (20−30 nm) added as embedment. Continuous stirring gives a hydrogelation precursor mixture. The precursor solution was then poured into a mold and freeze-dried to form a hydrogel material. The hydrogel materials were soaked in distilled water for 1 day to remove non-cross-linked monomers prior to use. 2.3. Magnetic and Rheological Tests of the Hydrogel. The magnetic hydrogel plus a constant static magnetic field of 100 mT was used for the superparamagnetic function test of the material at a distance of 20 mm between the gel and the magnet. To measure the rheological properties of the hydrogels, the gelation solution was injected onto the surface of the mold or tissue to assess the rate of gelation. A tube tilt method was used to measure the gelation time of the sample, and the test tube containing 2 mL of the gel sample was tilted every 30 s until the sample stopped flowing. For rheology study of flow and deformation of materials, the sample was placed on a rheometer to measure the gelation point of the hydrogel material and the storage moduli G′. 2.4. Cell Cultures. All the procedures used here were approved by the animal experimentation and ethics committee of Shenzhen Second People’s Hospital. BMSCs from bone marrow were acquired from male rats at age of 3 months. Briefly, rat bone marrow cavity was punctured at the left femur trochanter, and bone marrow was extracted using a syringe containing heparin. The extracted bone marrow was placed into a 10 mL centrifuge tube, and PBS was added to a final volume of 5 mL. The bone marrow solution was centrifuged at 135 rcf (1200 rpm) for 10 min, and the supernatant was discarded. The pellet was washed twice with PBS, followed by centrifugation at 94 rcf (1000 rpm). Then cells were resuspended and grown in MesenGro Medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin and 10% MesenGro Supplement and 10 ng/mL of basic fibroblast growth factor (bFGF) in a CO2 incubator containing 5% CO2 at 37 °C. After being incubated for 3 days, the BMSCs of passage 3 were used for further experiments. For chondrogenic differentiation experiment we used serum-free chondrogenic medium, which consisted of DMEM (4.5 g/L glucose), 1% ITS supplement, 100 nM dexamethasone, 0.17 mM L-ascorbic acid-2-phosphate, 1 mM sodium pyruvate, 0.35 mM L-proline. The chondrogenic induction medium used here contains 10 ng/mL TGFβ1, 40 mg/mL proline, 0.1 mM dexamethasone, 50 mg/mL ascorbate and 1% Insulin-Transferrin-Selenium Supplement obtained from Cyagen Biosciences (California, USA). Costar 6-well plates (3516) with hydrophilic and negatively charged surface optimized for cell attachment and growth have been used for the cell cultures. The hydrogel materials were coated on the surface of the wells to provide substratum for cell cultures. The control is blank cell plates without hydrogel coating. 2.5. Scanning Electron Microscopy (SEM) and Histological Analysis. The morphology of the hydrogels was characterized using a field-emission scanning electron microscopy (MIRA3 TESCAN). After air-drying at room temperature, the samples were gold-coated using an ion sputtering device and observed under the electron microscopy. SEM images of BMSCs seeded on hydrogels were also obtained. BMSC cultures were added onto the surface of raw hydrogel materials and incubated for 4 h to allow the cells to attach to the surface before socking in culture medium. After 1 week of incubation, the cell cultures on hydrogels were washed twice with PBS, fixed with 2.5% glutaraldehyde at 4 °C for 2 h, and then dehydrated progressively with ethanol. After critical-point drying with CO2 and metal spraying, the adhesion of cells on the hydrogel was observed under SEM. For histological analysis, the cell/hydrogel cultures were fixed in 2.5% glutaraldehyde for 16 h, through a series of gradient ethanol to dehydrate, embedded in paraffin wax, cut into 5 μm thick sections, then were the samples were stained with hematoxylin and eosin. 2.6. LIVE/DEAD Viability Assay. The viability of cells seeded onto the hydrogels was evaluated by Live/Dead cell staining kit purchased from Tianjin Wei Kai Biological Engineering Co., Ltd. (Tianjin, China), and performed according to the manufacturer’s

genesis process and also chondrogenic differentiation of stem cells derived from bone marrow,20−23 umbilical cord Wharton jell,21 and synovial fluid.24 Tissue engineering scaffolds are an indispensable component to support the adhesion, growth and differentiation of stem cells and to construct tissue engineered cartilage.25−27 The scaffold serves as a temporary replacement of the damaged tissue, and also a favorable matrix that allow seeded cells to grow, proliferate, differentiate, and maintain the physiological phenotype. Self-shaping hydrogel materials can fill in the cavities of the damaged tissue with variable shape and size, and seeded cells can thereby evenly distribute inside scaffolding materials in a three-dimensional environment that mimics extracellular matrix of the joints. Also with high water content, the hydrogel can support the exchange of nutrients and cellular metabolites that are necessary for cell growth. We envision that combining a contact-free magnetic field stimulant and contact-based growth-promoting hydrogel materials can result in a significant increase in the chondrogenic differentiation of stem cells. This hypothesis is backed up by a series of recent discoveries in our lab. For example, diphasic magnetic Fe2O3/n-HA/PLLA nanocomposite hydrogel was found to be biocompatible with bone marrow mesenchymal stem cells (BMSCs)28 and promote specific differentiation BMSCs of under the exposure to low frequency PEMF.29 Another magnetic hydrogel n-HA/Fe2O3/PVA also showed good biocompatibility and beneficial effects in cartilage tissue engineering.30 Yet, a combined benefit of PEMF and a magnetic hydrogel has not been quantitatively measured. Here we report the synthesis of gelatin-based hydrogel with crosslinked β-cyclodextrin and embedded magnetic nanoparticles, and show that this hydrogel material supports the adhesion and proliferation of rat BMSCs, and the combination with pulsed magnetic field treatment significantly promotes chondrogenic differentiation of BMSCs.

2. MATERIALS AND METHODS 2.1. Reagents and Apparatus. Gelatin, β-cyclodextrin (β-CD) and magnetic nanoparticles (Fe3O4) were purchased from Xincheng Biotechnology Co., Ltd. (Shenzhen, China). CCK-8 Cell Proliferation Assay Kit was purchased from Beyotime Co., Ltd. (Shanghai, China). DAPI, 4′,6-diamidino-2-phenylindole dihydrochloride, and Alexa Fluor 555 were purchased from Invitrogen (Massachusetts, USA). The primary antibody of type II collagen was purchased from Abcam (Cambridge, UK). Dulbecco’s modified Eagle’s high glucose medium, fetal bovine serum, and trypsin were purchased from Thermo Fisher Scientific (USA). MesenGro, supplement, and basic fibroblast growth factor (bFGF) was obtained from the StemRD (California, USA). An alkaline phosphatase detection kit and a Coomassie brilliant blue protein assay kit were purchased from the Major Biotech (Shanghai, China). Reverse transcriptase was from Takara (Dalin, China). Trizol was provided by the Invitrogen (ThermoFisher, USA). Fe3O4 nanoparticles (20−30 nm) were purchased from Aladdin (Shanghai, China). The simultaneous mechanical testing machine CTM4000 and infrared spectrometer were located at Shenzhen Vocational and Technical College, and electron microscope was conducted by MIRA3 TESCAN, at Tsinghua University. The electromagnetic field generator was purchased from GE (Boston, USA), and the inverted phase contrast microscope was purchased from OLYMPUS (Tokyo, Japan). A pulsed magnetic therapy device was purchased form Haomai Medical Device Inc., Hebei, China. For PEMF treatment, cells were exposed to the magnetic field for 20 min at a magnetic strength of 100 mT and a frequency of 40−70 Hz. 2.2. Preparation of Magnetic Hydrogels. Briefly, gelatin (100 mg) and β-cyclodextrin (100 mg) were dissolved in 2 mL of ultrapure water. Under constant stirring at 15 rcf (400 rpm in our benchtop B


Article


Figure 1. Characterization of the magnetic hydrogel. (A) Macroscopic photographs of magnetic GCF and nonmagnetic GC hydrogels. (B) FTIR spectra of the GCF and GC hydrogels. (C, D) Frequency and strain sweep studies of GCF and GC hydrogels. (E, F) SEM images of (E) GC and (F) GCF hydrogel. 2.8. Immunohistochemical Staining. To evaluate the chondrogenesis of BMSCs, we stained the cell cultures with toluidine blue (Sigma-Aldrich) to detect proteoglycan in the extracellular matrix. To detect the expression level of collagen II protein, the cell/hydrogel cultures were fixed with 4% paraformaldehyde for 10 min, then permeabilized with 0.25% Triton X-100 for 10 min and blocked with 3% BSA for 60 min. Subsequent incubation with type II collagenspecific antibody (ab34712, 1:100, Abcam, Cambridge, USA) and Alexa Fluor555 conjugated secondary antibody allows the staining of type II collagen. Nuclei were counterstained with DAPI. The tissues were then cut into thick sections and were visualized using Laser Scanning Confocal Microscopy (ZEISS, Germany). 2.9. Reverse Transcription and Real Time PCR. Total RNA from BMSCs were extracted using TRIzol reagent following the manufacturer’s instructions (Thermo Fisher). The total RNA preparation was reverse transcribed to cDNA using an RT-PCR system for first-strand cDNA synthesis (Takara, China). Real-time PCR was carried out for 40 cycles of amplification: 95 °C for 15 s and 60 °C for 60s using SYBR Premix EX Taq (Takara, China) on Stratagene Real-Time PCR system (Applied Biosystems, Grand Island, NY, USA). GAPDH was used as an internal control for quantification and relative gene expression of SOX9, Col2A1 and aggrecan was calculated using the 2-ΔΔCT formula. Each sample was analyzed in triplicate. For aggrecan (NM_022190), the following primers were used: forward: AGGATGGCTTCCACCAGTGT, backward: GGCATAAAAGACCTCACCCTCC. For ColII gene (NM_012929.1), the forward primer was TCCTAAGGGTGCCAATGGTGA, and the backward primer was AGGAC-

instructions. Briefly, 1 mm thick discs of hydrogels were cut on a tissue slicer to be fit in the 24-well cell culture plate with smooth hydrogel surface. The discs were soaked in 75% ethanol overnight for sterilization and then washed by PBS for three times. The sterilized samples were immersed in the culture medium for 24 h. The medium was subsequently removed, and the cells prepared above were seeded onto the hydrogels and incubated at 37 °C with a concentration of 5 × 104 cells per sample. The seeded cell and hydrogel materials were treated with or without PEMF. After cultured for 7 days, the samples were incubated in 400 μL culture medium with 2 μM Calcein-AM (staining live cells) and 4 μM Ethidium homodimer-1 (staining for dead cells) for 45 min, then examined under a Leica DM16000B microscope. Images were captured using a Leica DFC550 digital camera and analyzed using a Leica LAS V4.6 software. 2.7. Cell Proliferation Assay. Proliferation of the BMSCs grown on the different materials was determined by cell counting kit-8 CCK8 (purchased from Beyotime, Shanghai, China). Hydrogel materials were cut by a tissue slicer into 3 mm thick discs. BMSCs of 3 × 103 in 200 μL suspension were seeded in the hydrogel discs in 96-well plates and incubated for 1, 3, 7, and 14 days in DMEM containing 10% FBS. As a control group, BMSCs of the same density were seeded on 96well plates only without hydrogel coating. After incubation, cells were collected, rinsed in Hank’s salt solution, and then incubated with 100 μL fresh DMEM containing 10% CCK-8 solution and 10% FBS at 37 °C in a 5% CO2 humidified incubator at 37 °C for 4 h. ODs at 450 nm were measured using a thermo-plate microplate reader (Rayto Life and Analytical Science Co. Ltd., Germany). Error bars represent SDs of the means of three independent experiments. C


Article


Figure 2. Attachment and morphology of BMSCs cultured in scaffolds. SEM images of BMSCs grown on (A) coarse GC hydrogel and (B) GCF hydrogel. Scale bar, 50 μm. (C, D) H&E staining of BMSCs grown on (C) GC hydrogel and (D) GCF hydrogel. CAACTTTGCCTTGAGGAC. For SOX9 gene (NM_080403), the forward primer used was ACTTCCGCGACGTGGACATC, and the backward primer was TGTAGGAGACCTGGCCGTG. For GAPDH gene (NM_017008) as the control, the forward and backward primers were ACCACAGTCCATGCCATCAC and TCCACCACCCTGTTGCTGTA respectively. 2.10. Statistical Analysis. Data were expressed as means ± standard error of at least three independent experiments. A statistical difference was performed by Students t test using the GraphPad Prism version 6.01 Software (GraphPad Software, San Diego, CA). A value of p < 0.05 was considered statistically significant.

100%, while the storage modulus (G′) of GC hydrogel decreased significantly (from 990 pa to 213 pa, with increased strains from 1% to 100%, indicating that the GCF hydrogel can withstand a lager deformation (Figures 1C, D). Surface micromorphology analysis using scanning electron microscope (SEM) showed that both the magnetic GCF and nonmagnetic GC hydrogels have uneven surface with similar morphology (Figure 1E, F). We then measured the mechanical properties of the magnetic hydrogels. After compression, both hydrogel materials can restore the shape, indicating that the incorporation of the magnetic nanocomposite does not affect the elastic property of the hydrogel network. The GCF hydrogel also responded to the attractive force of an external magnet: at a distance shorter than 20 mm, the nanocomposite hydrogel was attracted to the magnet within 1 s (Figure S1). 3.2. Adhesion, Growth, and Proliferation of BMSCs in the Magnetic Hydrogel. Bone marrow stem cells (BMSCs) from rats were isolated and purified for this experiment. We first proved that the BMSCs we acquired maintained the multilineage differentiation potential. Chondrogenic stimulation of the cells differentiated the cells into chondrocytes, indicated by positive acidic proteoglycans in toluidine blue staining (Figure S2A). Adipogenic induction differentiated the BMSCs into adipocytes, showed by the formation of lipid-rich vacuoles in Oil Red O staining (Figure S2B). Alizarin red staining identifies mineralized nodules, indicating successful osteogenic induction (Figure S2C). Spindle and polygonal shape of morphology is also observed, confirming the successful isolation and culturing of BMSCs (Figure S2D). BMSCs were then seeded and grown on the two hydrogel materials. The morphology of adhered BMSCs on the surface of hydrogels was revealed by scanning electron microscope (SEM) (Figure 2A) and Hemotoxylin and Eosin (H&E) staining (Figure 2B). Both GC and GCF hydrogels supported the attachment and adhesion of BMSCs, and BMSCs exhibited

3. RESULTS AND DISCUSSION 3.1. Synthesis and Characterization of Gelatin-Based Magnetic Hydrogel. The supramolecular magnetic gelatin/ β-cyclodextrin (CD)/Fe3O4 (GCF) hydrogel was synthesized according to the protocol shown in the Materials and Methods, and concomitantly the nonmagnetic gelatin/β-CD (GC) hydrogel without the incorporation of magnetic nanoparticles was synthesized as a control. The two different hydrogel materials showed similar appearance, except that the GCF hydrogel had a dark red color due to Fe3O4 magnetic nanoparticles whereas the GC hydrogel is transparent (Figure 1A). Infrared spectrum of the GCF hydrogel showed characteristic vibration bands MTh−O−MOh (ν1 ≈ 600−550 cm−1), where MTh and MOh correspond to the metal occupying tetrahedral and octahedral positions respectively,31 consistent with the presence of magnetic particles (Fe3O4) in the hydrogel (Figure 1B). Frequency sweeps showed that the GCF hydrogels possessed slightly lower storage modulus (G′) and loss modulus (G″) than GC hydrogels, and both GCF and GC hydrogels behaved independently of frequency. The GCF and GC hydrogels were subsequently subjected to an increasing shear strain from 0.1 to 300%. The storage modulus (G′) of GCF hydrogel remained steady even when the strain reached D


Article


Figure 3. Growth and proliferation of BMSCs on hydrogels. (A) GCF hydrogel showed minimal cytotoxicity to BMSCs in live−dead staining assay. BMSCs cells were grown on sliced hydrogel materials or the surface of cell culture plates with or without magnetic field for 14 days before dye staining. (B) Proliferation of BMSCs cells grown on scaffold or treatment with or without PEMF at day 1, 5, 7, and 14. Error bars represent the SD of the means of the values from three independent experiments. *p < 0.05; **p < 0.01.

Figure 4. Magnetic field together with the hydrogel scaffold promotes chondrogenesis of BMSCs, as detected by toluidine staining and immunohistochemical staining for type II collagen. BMSCs (1 × 106) were seeded and incubated in 6-well culture plates on sliced hydrogel materials or the surface of the cell culture plates for 14 days before imaging. Scale bar, 100 μm.

well-defined microfilaments and cytoskeletons on the hydrogels. The unsliced raw hydrogel materials have coarse surface,

which caused uneven distribution of the cells: cells tend to cluster on the concave surface and avoid convex surface E


Article


Figure 5. Magnetic field together with the hydrogel scaffold promotes chondrogenesis of BMSCs cells, as detected by increased expression of chondrogenesis-specific markers. (A−C) Quantification of mRNA level of collagen II (A), aggrecan (B), and SOX9 (C) of BMSCs grown on different substrates with and without magnetic field by real-time PCR. a, BMSCs grown on tissue culture plates; b, BMSCs grown on sliced GC hydrogel; c, BMSCs grown on sliced GCF hydrogel. Real-time PCR reactions were carried out after culturing the cells with scaffolds for 14 days. n = 3; *, p < 0.05; **, p < 0.01. (D) Confocal images showing increased expression level of collagen II (red) of BMSCs promoted by PEMF after cultured on GCF hydrogel for 21 days. Scale bar: 50 μm.

(Figure 2B). The cytocompatibility of the hydrogel materials was evaluated using the cell counting kit-8 (CCK-8) and the Live/Dead cell assay, in which the live cells were stained with green fluorescence and the dead cells in red. In this experiment, hydrogel materials were sliced into think discs with smooth surface for even distribution. Cells attached on both hydrogels stayed alive for at least 14 days. Pulsed electromagnetic field (PEMF) also did not affect the viability of the cells (Figure 3A). Moreover, PEMF significantly promoted cell proliferation on all three cellular matrixes, with the most pronounced promoting effect on GCF hydrogels (Figure 3B). For example, at day 14, the number of cells (measured by the absorption at 450 nm) on GCF hydrogels upon PEMF treatment grew almost three times the density of cells on GCF hydrogel in the absence of PEMF. The promoting effect of electromagnetic field was also observed on GC hydrogels, with about twice more cell proliferation, but unnoticeable on the control material. Altogether, magnetic field ubiquitously improves BMSC proliferation, this effect can be promoted by a gelatin-based hydrogel, and magnetic gelatin-based hydrogel showed the strongest promoting effect. The magnetic nanocomposite embedded in the gelatin hydrogel thereby d. 3.3. Hydrogel Together with PEMF Promotes Chondrogenesis. Next, we examined specific differentiation, namely chondrogenesis, of BMSCs grown on different hydrogel materials in the presence and absence of PEMF. Using toluidine blue staining as an indicator of chondrogenesis, the cell culture grown on GCF hydrogel under a simultaneous PEMF treatment showed significantly more intense stains than the other groups. Immunohistochemical staining of the type II

collagen also showed the same effect: cells grown on GCF hydrogel under a simultaneous PEMF treatment showed denser and broader signals when compared with the control (Figure 4). The effect of the magnetic field is not noticeable if BMSCs were grown in the absence of the hydrogel, and noticeable but much less pronounced when BMSCs were grown on the nonmagnetic GC hydrogel. Next, we employed real-time PCR to quantify the gene expression level of chondrogenesis marker in different groups. Quantitative analysis of the gene expression of SOX9, COLII, and aggrecan were measured and normalized. Consistently, at day 14, BMSCs in the GCF hydrogel under PEMF showed significantly higher level of these maker genes as compared to BMSC cultures in the absence of PEMF treatment (Figure 5A−C). Consistently, GCF hydrogel plus PEMF gave the highest expression level of all three marker genes. Immunohistostaining demonstrated significantly higher level of type II collagen in the BMSC cultures on GCF hydrogel treated with PEMF than other cell cultures, showing that the differentiated BMSCs encapsulated in the GCF hydrogel treated with PEMF produced higher level chondrogenic extracellular matrix (ECM) in the periphery of the cells (Figure 5D). Altogether, these results indicated that GCF hydrogel combined with PEMF treatment can effectively promote chondrogenesis of BMSCs.

4. CONCLUSION Scaffold materials not only act as a temporary substitute for tissue repair but also provide a friendly environment for adhesion, growth, proliferation, and differentiation of seeded cells. Among all sorts of scaffold materials developed for F



■

cartilage repair, gelatin hydrogels showed favorable biocompatibility, solubility, and promotion of cell adhesion.32,33 Gelatin is a nontoxic, biodegradable, and soluble protein derived from collagen and can promote cell adhesion, proliferation and stem cell differentiation.34 Gelatin-based hydrogel therefore retains the property of collagen and provide a 3D framework for cells.32 Cyclodextrin has also been reported to promote cell differentiation, and as a host molecule, β-cyclodextrin can bind with smaller proteins such as growth factors or drugs for promoting cell growth and differentiation.35−38 γ-Glycidoxypropyltrimethoxysilane (GPTMS) is a silane-coupling agent, which has epoxy and methoxysilane groups.39 In our system, the epoxy group of the GPTMS primarily reacted with the amino groups on the gelatin protein, and hydration of the trimethoxy groups on the GPTMS formed pendent silanol groups (SiOH) through an acid catalyzed reaction. Then Si− O−Si bonds were formed through condensation of two SiOH during the condensation reaction, providing interchain covalent bonds to result in a cross-linked structure. The SiOH and Si−O−Si groups derived from GPTMS also favor cell attachment and proliferation, as silicate ions play an positive role in promoting cell differentiation.40 Therefore, we incorporated β-cyclodextrin molecules to the gelatin framework through the host−guest interaction between the aromatic side chains of the gelatin and the cyclodextrin cavity. The inclusion of cyclodextrin stabilizes the hydrogel structure and adds a carbohydrate component into the hydrogel structure to better mimic the extracellular matrix for better cell adhesion. Integrating magnetic nanoparticles into the porous scaffold structure has been shown to produce a hybrid scaffold material that promotes the proliferation and adhesion of BMSCs.41−44 On the other hand, we and others have reported that a lowfrequency electromagnetic field could promote BMSC osteogenic differentiation29 or chondrogenic differentiation45 and affect chondrocyte morphology.46 Although the mechanism is not yet fully understood, the effect of PEMF on chondrogenic differentiation may be due to enhanced cell−cell interaction and increased nutrient perfusion.21,17 Therefore, in this study, we combined all three functional elements and achieved an added effect on both cell proliferation and chondrogenesis of BMSCs. Our results indicated that the three components, gelatin hydrogel, magnetic nanoparticles, and the magnetic field resulted in an enhanced effect than single components, and led to pronounced chondrogenic differentiation of BMSCs. A contact-based scaffold material is thereby enhanced by a noncontacting benign and noninvasive stimulus in specific guidance of stem cell signals. This finding will be applicable to cartilage repair in animal studies and will eventually inspire or impact the clinical treatment of articular cartilage defects.

■

Article

AUTHOR INFORMATION

Corresponding Authors

*Email: [email protected]. *Email: [email protected]. *Email: [email protected]. ORCID

Liming Bian: 0000-0003-4739-0918 Jiang Xia: 0000-0001-8112-7625 Author Contributions †

J.H. and Y.L. contributed equally to the work. J.H. and Y.L. performed most of the experiments. Z.H. and P.Z. helped on characterization. Q.L., Y.L., L.D. and F.Z. supported the experiments. L.B. contributed to the discussion. J. Xia wrote the paper. J. Xiong and D.W. designed the experiments. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors acknowledge funding from Guangdong Province Science and Technology Project (Grants 2017A020215116 and 2015A030401017), Shenzhen Overseas High-Level Talents Innovation Funds Peacock Plan Project (KQTD2017033110083813), Shenzhen R & D funding project (JCYJ20160301111338144, JCYJ20170306092315034, JCYJ20160429185235132), Guangdong Province Medical Research Fund Project (Grant A2017189), Health and Family Planning Commission of Shenzhen Municipality project (SZXJ2018035), fund for HighLevel Medical Discipline Construction of Shenzhen University (Grant 2016031638), CRF Project C5031-14E (to J.X.).

■

REFERENCES

(1) Perera, J.; Gikas, P.; Bentley, G. The present state of treatments for articular cartilage defects in the knee. Ann. R. Coll. Surg. Engl. 2012, 94, 381. (2) Paschos, N. K.; Sennett, M. L. Update on mesenchymal stem cell therapies for cartilage disorders. World J. Orthop. 2017, 8, 853. (3) Park, Y. B.; Ha, C. W.; Rhim, J. H.; Lee, H. J. Stem Cell Therapy for Articular Cartilage Repair: Review of the Entity of Cell Populations Used and the Result of the Clinical Application of Each Entity. Am. J. Sports Med. 2018, 46, 2540. (4) Samsonraj, R. M.; Raghunath, M.; Nurcombe, V.; Hui, J. H.; van Wijnen, A. J.; Cool, S. M. Concise Review: Multifaceted Characterization of Human Mesenchymal Stem Cells for Use in Regenerative Medicine. Stem Cells Transl. Med. 2017, 6, 2173. (5) Iannitti, T.; Fistetto, G.; Esposito, A.; Rottigni, V.; Palmieri, B. Pulsed electromagnetic field therapy for management of osteoarthritis-related pain, stiffness and physical function: clinical experience in the elderly. Clin. Interventions Aging 2013, 8, 1289. (6) Bagnato, G. L.; Miceli, G.; Marino, N.; Sciortino, D.; Bagnato, G. F. Pulsed electromagnetic fields in knee osteoarthritis: a double blind, placebo-controlled, randomized clinical trial. Rheumatology (Oxford, U. K.) 2016, 55, 755. (7) Ganesan K, K.; Gengadharan, A. C.; Balachandran, C.; Manohar, B. M.; Puvanakrishnan, R. Low frequency pulsed electromagnetic field–a viable alternative therapy for arthritis. Indian J. Exp. Biol. 2009, 47, 939. (8) Schwartz, Z.; Simon, B. J.; Duran, M. A.; Barabino, G.; Chaudhri, R.; Boyan, B. D. Pulsed electromagnetic fields enhance BMP-2 dependent osteoblastic differentiation of human mesenchymal stem cells. J. Orthop. Res. 2008, 26, 1250. (9) Jansen, J. H.; van der Jagt, O. P.; Punt, B. J.; Verhaar, J. A.; van Leeuwen, J. P.; Weinans, H.; Jahr, H. Stimulation of osteogenic differentiation in human osteoprogenitor cells by pulsed electro-

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsbiomaterials.9b00025. Attractive response of the magnetic hydrogel to a magnet and specific differentiation of BMSCs from rats (PDF) G


Article

ACS Biomaterials Science & Engineering magnetic fields: an in vitro study. BMC Musculoskeletal Disord. 2010, 11, 188. (10) Xu, H.-Y.; Gu, N. Magnetic responsive scaffolds and magnetic fields in bone repair and regeneration. Front Mater. Sci. 2014, 8, 20. (11) Ciombor, D. M.; Aaron, R. K. The role of electrical stimulation in bone repair. Foot Ankle Clin 2005, 10, 579. (12) Boopalan, P.; Arumugam, S.; Livingston, A.; Mohanty, M.; Chittaranjan, S. Pulsed electromagnetic field therapy results in healing of full thickness articular cartilage defect. Int. Orthop. 2011, 35, 143. (13) Ö zgücļ ü, E.; Ç etin, A.; Ç etin, M.; Calp, E. Additional effect of pulsed electromagnetic field therapy on knee osteoarthritis treatment: a randomized, placebo-controlled study. Clin. Rheumatol. 2010, 29, 927. (14) Aaron, R. K.; Ciombor, D. M.; Simon, B. J. Treatment of nonunions with electric and electromagnetic fields. Clin. Orthop. Relat. Res. 2004, 419, 21. (15) Schmidt-Rohlfing, B.; Silny, J.; Woodruff, S.; Gavenis, K. Effects of pulsed and sinusoid electromagnetic fields on human chondrocytes cultivated in a collagen matrix. Rheumatol. Int. 2008, 28, 971. (16) Liu, H.; Abbott, J.; Bee, J. A. Pulsed electromagnetic fields influence hyaline cartilage extracellular matrix composition without affecting molecular structure. Osteoarthritis Cartilage 1996, 4, 63. (17) Aaron, R. K.; Boyan, B. D.; Ciombor, D. M.; Schwartz, Z.; Simon, B. J. Stimulation of growth factor synthesis by electric and electromagnetic fields. Clin. Orthop. Relat. Res. 2004, 419, 30. (18) Liu, H.; Lees, P.; Abbott, J.; Bee, J. A. Pulsed electromagnetic fields preserve proteoglycan composition of extracellular matrix in embryonic chick sternal cartilage. Biochim. Biophys. Acta, Gen. Subj. 1997, 1336, 303. (19) Chen, C.-H.; Lin, Y.-S.; Fu, Y.-C.; Wang, C.-K.; Wu, S.-C.; Wang, G.-J.; Eswaramoorthy, R.; Wang, Y.-H.; Wang, C.-Z.; Wang, Y.H.; Lin, S.-Y.; Chang, J.-K.; Ho, M.-L. Electromagnetic fields enhance chondrogenesis of human adipose-derived stem cells in a chondrogenic microenvironment in vitro. J. Appl. Physiol. 2013, 114, 647. (20) Mayer-Wagner, S.; Passberger, A.; Sievers, B.; Aigner, J.; Summer, B.; Schiergens, T. S.; Jansson, V.; Müller, P. E. Effects of low frequency electromagnetic fields on the chondrogenic differentiation of human mesenchymal stem cells. Bioelectromagnetics 2011, 32, 283. (21) Esposito, M.; Lucariello, A.; Costanzo, C.; Fiumarella, A.; Giannini, A.; Riccardi, G.; Riccio, I. Differentiation of human umbilical cord-derived mesenchymal stem cells, WJ-MSCs, into chondrogenic cells in the presence of pulsed electromagnetic fields. In Vivo 2013, 27, 495. (22) Ross, C. L.; Siriwardane, M.; Almeida-Porada, G.; Porada, C. D.; Brink, P.; Christ, G. J.; Harrison, B. S. The effect of low-frequency electromagnetic field on human bone marrow stem/progenitor cell differentiation. Stem Cell Res. 2015, 15, 96. (23) Elliott, J.; Smith, R.; Block, C. Time-varying magnetic fields: effects of orientation on chondrocyte proliferation. J. Orthop. Res. 1988, 6, 259. (24) Ongaro, A.; Pellati, A.; Setti, S.; Masieri, F. F.; Aquila, G.; Fini, M.; Caruso, A.; De Mattei, M. Electromagnetic fields counteract IL1β activity during chondrogenesis of bovine mesenchymal stem cells. J. Tissue Eng. Regener. Med. 2015, 9, No. E229. (25) O’Brien, F. J. Biomaterials & scaffolds for tissue engineering. Mater. Today 2011, 14, 88. (26) Zhao, P.; Gu, H.; Mi, H.; Rao, C.; Fu, J.; Turng, L.-S. Fabrication of scaffolds in tissue engineering: A review. Front Mech. Eng. 2018, 13, 107. (27) Ghassemi, T.; Shahroodi, A.; Ebrahimzadeh, M. H.; Mousavian, A.; Movaffagh, J.; Moradi, A. Current Concepts in Scaffolding for Bone Tissue Engineering. Arch. Bone Joint Surg. 2018, 6, 90. (28) Huang, J.; Liu, W.; Liang, Y.; Li, L.; Duan, L.; Chen, J.; Zhu, F.; Lai, Y.; Zhu, W.; You, W.; Jia, Z.; Xiong, J.; Wang, D. Preparation and biocompatibility of diphasic magnetic nanocomposite scaffold. Mater. Sci. Eng., C 2018, 87, 70. (29) Huang, J.; Wang, D.; Chen, J.; Liu, W.; Duan, L.; You, W.; Zhu, W.; Xiong, J.; Wang, D. Osteogenic differentiation of bone marrow

mesenchymal stem cells by magnetic nanoparticle composite scaffolds under a pulsed electromagnetic field. Saudi Pharm. J. 2017, 25, 575. (30) Huang, J.; Liang, Y.; Jia, Z.; Chen, J.; Duan, L.; Liu, W.; Zhu, F.; Liang, Q.; Zhu, W.; You, W.; Xiong, J.; Wang, D. Development of Magnetic Nanocomposite Hydrogel with Potential Cartilage Tissue Engineering. ACS Omega 2018, 3, 6182. (31) Birsan, C.; Predoi, D.; Andronescu, E. IR and thermal studies of iron oxide nanoparticles in a bioceramic matrix. J. Optoelectron. Adv. Mater. 2007, 9, 1821. (32) Salamon, A.; van Vlierberghe, S.; van Nieuwenhove, I.; Baudisch, F.; Graulus, G.-J.; Benecke, V.; Alberti, K.; Neumann, H.G.; Rychly, J.; Martins, J. C.; Dubruel, P.; Peters, K. Gelatin-Based Hydrogels Promote Chondrogenic Differentiation of Human Adipose Tissue-Derived Mesenchymal Stem Cells In Vitro. Materials 2014, 7, 1342. (33) Liu, M.; Zeng, X.; Ma, C.; Yi, H.; Ali, Z.; Mou, X.; Li, S.; Deng, Y.; He, N. Injectable hydrogels for cartilage and bone tissue engineering. Bone Res. 2017, 5, 17014. (34) Lu, S.; Lee, E. J.; Lam, J.; Tabata, Y.; Mikos, A. G. Evaluation of Gelatin Microparticles as Adherent-Substrates for Mesenchymal Stem Cells in a Hydrogel Composite. Ann. Biomed. Eng. 2016, 44, 1894. (35) Tan, L.; Li, J.; Liu, Y.; Zhou, H.; Zhang, Z.; Deng, L. Synthesis and characterization of β-cyclodextrin-conjugated alginate hydrogel for controlled release of hydrocortisone acetate in response to mechanical stimulation. J. Bioact. Compat. Polym. 2015, 30, 584. (36) Grier, W. K.; Tiffany, A. S.; Ramsey, M. D.; Harley, B. A. C. Incorporating β-cyclodextrin into collagen scaffolds to sequester growth factors and modulate mesenchymal stem cell activity. Acta Biomater. 2018, 76, 116. (37) Liu, C.; Zhang, Z.; Liu, X.; Ni, X.; Li, J. Gelatin-based hydrogels with β-cyclodextrin as a dual functional component for enhanced drug loading and controlled release. RSC Adv. 2013, 3, 25041. (38) Shi, X.; Li, W.; Liu, H.; Yin, D.; Zhao, J. β-Cyclodextrin induces the differentiation of resident cardiac stem cells to cardiomyocytes through autophagy. Biochim. Biophys. Acta, Mol. Cell Res. 2017, 1864, 1425. (39) Tonda-Turo, C.; Gentile, P.; Saracino, S.; Chiono, V.; Nandagiri, V. K.; Muzio, G.; Canuto, R. A. Comparative analysis of gelatin scaffolds crosslinked by genipin and silane coupling agent. Int. J. Biol. Macromol. 2011, 49, 700. (40) Liu, Y.-L.; Su, Y.-H.; Lai, J.-Y. In situ crosslinking of chitosan and formation of chitosan−silica hybrid membranes with using γglycidoxypropyltrimethoxysilane as a crosslinking agent. Polymer 2004, 45, 6831. (41) Dobson, J. Remote control of cellular behaviour with magnetic nanoparticles. Nat. Nanotechnol. 2008, 3, 139. (42) Ho, V. H.; Müller, K. H.; Barcza, A.; Chen, R.; Slater, N. K. Generation and manipulation of magnetic multicellular spheroids. Biomaterials 2010, 31, 3095. (43) Bock, N.; Riminucci, A.; Dionigi, C.; Russo, A.; Tampieri, A.; Landi, E.; Goranov, V. A.; Marcacci, M.; Dediu, V. A novel route in bone tissue engineering: magnetic biomimetic scaffolds. Acta Biomater. 2010, 6, 786. (44) Wei, Y.; Zhang, X.; Song, Y.; Han, B.; Hu, X.; Wang, X.; Lin, Y.; Deng, X. Magnetic biodegradable Fe3O4/CS/PVA nanofibrous membranes for bone regeneration. Biomed. Mater. 2011, 6, 055008. (45) Son, B.; Kim, H. D.; Kim, M.; Kim, J. A.; Lee, J.; Shin, H.; Hwang, N. S.; Park, T. H. Physical Stimuli-Induced Chondrogenic Differentiation of Mesenchymal Stem Cells Using Magnetic Nanoparticles. Adv. Healthcare Mater. 2015, 4, 1339. (46) Jahns, M.; Lou, E.; Durdle, N. G.; Bagnall, K.; Raso, V. J.; Cinats, D.; Barley, R.; Cinats, J.; Jomha, N. The effect of pulsed electromagnetic fields on chondrocyte morphology. Med. Biol. Eng. Comput. 2007, 45, 917.

H


Magnetic enhancement of chondrogenic differentiation of

Recommend Documents