Manipulation of a Single Circulating Tumor Cell Using Visualization of

Subscriber access provided by UNIV OF CAMBRIDGE

Article

Simple and rapid manipulation of a single circulating tumor cell using visualization of hydrogel encapsulation towards single-cell whole-genome amplification Tomoko Yoshino, Tsuyoshi Tanaka, Seita Nakamura, Ryo Negishi, Masahito Hosokawa, and Tadashi Matsunaga Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.6b01475 • Publication Date (Web): 14 Jun 2016 Downloaded from http://pubs.acs.org on June 15, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Figure 1. (A) Schematic diagram of the experimental proce-dure for cell entrapment on the microcavity array to encap-sulate cells by the PEGDA hydrogel. 1: Introduction of the blood sample onto the microcavity array and filtration; 2: Introduction of PEGDA; 3: Exposure of laser light (λ＝405 nm) using a ×100 objective lens; 4: Washing out of any unpo-lymerized PEGDA; 5: Collection of the hydrogel attached on the cover glass. (B) Light radiation setup for the photopolyme-rization of PEGDA on the microcavity array. 181x181mm (600 x 600 DPI)

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. (A) Photographs of the PEGDA hydrogels on a cover glass (24 × 60 mm), which were photopolymerized by confocal microscopy. (B) SEM image of the photopolymerized PEGDA hydrogel, and (C) the corresponding schematic illustration. 119x98mm (600 x 600 DPI)


Page 2 of 13

Page 3 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. (A) SEM images of PEGDA hydrogels when the focal point plane was shifted to 50, 70, and 90 µm from the midpoint of the height (X). Scale bars: 50 µm. (B) Percentages of the lengths of the upper and lower parts. The height (X) was defined as 100%. 140x112mm (600 x 600 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4. (A) Fluorescent microscopic image of a CellTracker Orange-stained NCI-H1975 cell and CellTracker Green-stained HCC827 cells on the microcavity array recovered from the CTC sample. (B) Fluorescent microscopic image of the bottom face of the PEGDA hydrogel with a stained NCI-H1975 cell. 75x32mm (600 x 600 DPI)


Page 4 of 13

Page 5 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. SEM images of the PEGDA hydrogel photopolymeri-zed by confocal microscopy. (A) Single NCIH1975 cell encap-sulated on the PEGDA hydrogel. (B) Enlarged image of (A). (C) Empty PEGDA hydrogel. Scale bar: 40 µm. 171x255mm (600 x 600 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 6. Genetic analysis of a single leukocyte and single HCC827 cell prepared by hydrogel encapsulation. (A) Fluo-rescent microscopic images of a leukocyte and HCC827 cell. (B) Sanger sequencing of the EGFR gene in the leukocyte or HCC837 cell. 118x88mm (600 x 600 DPI)


Page 6 of 13

Page 7 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Simple and rapid manipulation of a single circulating tumor cell using visualization of hydrogel encapsulation towards single-cell whole-genome amplification Tomoko Yoshino*, Tsuyoshi Tanaka, Seita Nakamura, Ryo Negishi, Masahito Hosokawa and Tadashi Matsunaga Division of Biotechnology and Life science, Institute of Engineering, Tokyo University of Agriculture and Technology, 224-16, Naka-cho, Koganei, Tokyo, 184-8588, Japan. Circulating Tumor Cell, Single-cell analysis. ABSTRACT: Genetic characterization of circulating tumor cells (CTCs) could guide the choice of therapies for individual patients, and also facilitate the development of new drugs. We previously developed a CTC recovery system using a microcavity array, which demonstrated highly efficient CTC recovery based on differences in cell size and deformability. However, the CTC recovery system lacked an efficient cell manipulation tool suitable for subsequent genetic analysis. Here, we resolve this issue and present a simple and rapid manipulation method for single CTCs using a photopolymerized hydrogel, polyethylene glycol diacrylate (PEGDA), which is useful for subsequent genetic analysis. First, PEGDA was introduced into the cells entrapped on the microcavity array. Then, excitation light was projected onto the target single cells for encapsulation of each CTC by confocal laserscanning microscope. The encapsulated single CTCs could be visualized by the naked eye and easily handled with tweezers. The single CTCs were only partially encapsulated on the PEGDA hydrogel, which allowed for sufficient whole-genome amplification and accurate genotyping. Our proposed methodology is a valuable tool for the rapid and simple manipulation of single CTCs, and is expected to become widely utilized for analyses of mammalian cells and microorganisms in addition to CTCs.

Introduction Circulating tumor cells (CTCs) are rare cells found in the peripheral blood of patients with a wide range of solid tumors. The number of CTCs has been shown to be a useful clinical parameter for predicting cancer patient prognosis and the therapeutic effects of anticancer drugs.1-3 Thus, CTCs are well recognized as an accessible and valuable biomarker for cancer diagnosis and are a potential target for drug discovery. Recently, not only the number of CTCs but also the cell characteristics such as their genome and transcriptome have been analyzed to obtain further clinical information.4 For example, genetic mutation of CTCs can indicate mutation in primary or metastatic tumor tissues.5 Furthermore, the cultivation of CTCs is expected to open a new avenue for the development of novel drugs for metastatic cancer. However, as CTCs are extremely rare (with approximately one tumor cell observed in 5 × 109 blood cells)6,7, new techniques for their efficient recovery from blood samples and manipulation at the single-cell level are required to enable subsequent genetic analysis. Several techniques for the efficient recovery of CTCs have been intensively studied. The immunomagnetic separationbased assay is widely used, and one of them, CellSearch system (Velidex, Raritan, NJ), has been approved by the Food & Drug Administration for the diagnosis of breast, prostate, and colon cancers.8 Magnetic particles with an epithelial cell adhesion molecule (EpCAM) antibody against epithelial tumor cell markers have also been employed for CTC recovery. However, the assay protocol of the EpCAM-based approach has a limitation for application to various types of tumor cells be-

cause the expression level of EpCAM varies among tumor types. Recently various antibodies against cell surface markers, but not EpCAM, were reported and applied to recovery of low EpCAM-expressing CTCs9-11. Furthermore, not only immunomagnetic separation-based assay but also size and/or deformability-based assay formats have been developed12,13. The latter assay format can be applied to various types of tumor cells for the recovery. In general, blood cells are smaller in size and show higher deformability compared with epithelial tumor cells14,15. CTC recovery can be attained using a microfilter 16,17, microfluidic device18,19, dielectrophoresis20 and according to cell density21. In this way, physical-based recovery can be used to detect CTCs that cannot be detected with a biomarker-based recovery method such as EpCAM. On the other hand, the subsequent analyses of each CTC, such as mutations of genomic DNA or expression of target mRNA, are generally lacking because of the difficulty and timeconsuming procedures involved in the handling and manipulation of CTCs at the single-cell level. Recently, genetic mutation analyses from single CTCs have been reported. CTCs were recovered using CellSearch or other CTC enrichment methods, and were manipulated at the single-cell level using micromanipulation22, fluorescence activated cell sorting 23, laser capture microdissection24, dielectrophoresis25, microfluidic device26, 27. In most of these reports, blood samples of advanced cancer patients were used because these methodologies require a large number of CTCs for isolation and analysis.28, 29 These techniques for the isolation of single CTCs are quite labor-intensive and time-consuming,



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

and therefore it is hard to apply the recovered CTCs to the subsequent genetic analysis required without loss of cells. Cutting-edge technologies for manipulation of single-cells, such as optical tweezers 30, optical-image driven dielectrophoresis 31 or a microfluidic system, C1 system (Fluidigm)32, have been intensively developed, the application to CTCs was still limited. For example, DEPArray system (Silicon Biosystems, Bologna, Italy) is a semi-automated single-cell isolation system based on dielectrophoretic force33. Single-cells isolated by DEPArray could be subjected to whole-genome amplification (WGA) and subsequent genetic analysis. However, applied sample volume of cell suspension is up to 14 µL, and it could give rise to large dead volume34. As a result, not all of the CTCs are utilized for the WGA reaction. Therefore, efficient technique for both cell recovery and cell manipulation was required for genetic analyses of single CTCs. We have developed an efficient CTC recovery system using a microcavity array, which demonstrated highly efficient recovery of cancer cells based on differences in cell size and deformability.35 The sizes and shapes of the microcavities were designed to specifically capture tumor cells, allowing for blood cells to flow through during the whole blood filtration process.36 A recent clinical study revealed that the use of a microcavity array might be superior to the CellSearch System for detecting CTCs in patients with non small-cell lung cancer (NSCLC) and small-cell lung cancer.37 In particular, the numbers of NSCLC patients identified as CTC positive by the microcavity array system were much greater than those by the CellSearch system. Furthermore, an automated CTC recovery system using a microcavity array was developed with the aim of subsequent high-throughput analysis, and showed high assay accuracy and high efficiency for cell recovery.38 The automated system has demonstrated that 10 cancer cells spiked in 1 ml of healthy blood were recovered with 10 ± 1 cells. This automated system enables integration of CTCs from a blood sample onto the small squares of the microcavity array without requiring any pretreatments, and the CTCs can be readily identified by staining using fluorescence-labeled antibodies. However, techniques for the efficient manipulation of individual CTCs are still required for application of genetic analysis at the single-CTC level. Therefore, in this study, we demonstrate a novel CTC manipulation method using a photopolymerized hydrogel, polyethylene glycol diacrylate (PEGDA). First, the polymerization conditions for CTCs to become entrapped on the microcavity array were examined with confocal laser-scanning microscopy. Then, the effect of the PEGDA hydrogel on WGA and genotyping from single CTCs was investigated. Our proposed method allows for the rapid and simple manipulation of single CTCs recovered from blood samples, and enabled sufficient WGA and accurate genotyping without any contamination of neighbor cells.

Experimental Preparation of CTC samples Two NSCLC cell lines, NCI-H1975 and HCC827, were used in this study. These cells were cultured in RPMI 1640 medium containing 2 mM L-glutamine (Sigma-Aldrich, Irvine, UK), 10% (v/v) fetal bovine serum (Invitrogen Corp., Carlsbad, CA), and 1% (v/v) penicil-

Page 8 of 13

lin/streptomycin (Invitrogen Corp.) for 3–4 days at 37°C with 5% CO2 supplementation. Immediately prior to each experiment, cells grown to confluence were trypsinized and re-suspended in phosphate-buffered saline (PBS) containing 0.5% bovine serum albumin (BSA) and 2 mM ethylenediaminetetraacetic acid (EDTA). NSCLC cell concentration was determined by a direct cell count using a hemocytometer, and cell suspension was diluted to final concentration of 1 × 104 cells/ml. Then, 10 µl of cell suspension (approximately 100 cells) was spiked into 1 mL of whole blood, and used as model CTC samples. All human blood samples were collected from healthy donors at Tokyo University of Agriculture and Technology in accordance with Institutional Review Board procedures. Blood samples were collected in a collection tube with EDTA to prevent coagulation and were used within 12 h. CTC recovery and detection on microcavity array A microcavity array made of nickel by electroforming (Optonics Precision Co. Ltd.) was used for cell entrapment (Fig. 1(A) & Fig. S1(A)). The circle pore was fabricated with a diameter of 8 µm for entrapment of the CTCs. The distance between microcavities was 125 µm, with a total of 3,969 cavities arranged in each 63 × 63 array. The CTC recovery device with the microcavity array was fabricated in the same manner as reported previously (Fig. S1(B)).39 The NSCLC cells-spiked PBS (0.5% BSA, 2 mM EDTA) or whole blood samples (CTC samples) were introduced into the CTC recovery device. Subsequently, negative pressure was applied to the samples using a peristaltic pump, which was connected to the vacuum line. The sample (1 mL) was passed through the microcavity array at a flow rate of 100–300 µL/min. To remove any remaining cells from the microcavity array, 1 mL of PBS (0.5% BSA, 2 mM EDTA) was passed through the microcavity array at a flow rate of 200 µL/min for 10 min. Subsequently, cell fixation solution and cell staining solution were dropped onto and passed through the microcavity array using a peristaltic pump soon after washing. The entrapped cells were fixed with 4% paraformaldehyde in PBS throughout the microcavity array for 15 min, and then washed with 1 mL of PBS (0.5% BSA, 2 mM EDTA) at a flow late of 200 µL/min. The cells was subsequently permeabilized with 0.2% Triton X-100 in PBS (0.5% BSA, 2 mM EDTA) for 15 min, followed by another washing step with 1 mL of PBS (0.5% BSA, 2 mM EDTA) at a flow late of 200 µL/min. To identify CTCs and leukocytes, 600 µL of cell staining solution containing Hoechst 33342, anti-cytokeratin antibody (Alexa Fluor 488-AE1/AE3, eBioscience, San Diego, CA; & FITC-CK3-6H5, Miltenyi Biotec, Auburn, CA), and phycoerythrin-labeled anti-CD45 antibody (BD Biosciences, San Diego, CA) were dropped onto the microcavity array and incubated for 30 min. Finally, the array was washed with 1 mL of PBS (0.5% BSA, 2 mM EDTA) to remove excess antibodies. Images of the whole cell-arrayed area were obtained using a fluorescence microscope (BX53; Olympus Corporation, Tokyo, Japan) integrated with a computer-operated motorized stage, WU, NIBA, and WIG filter sets, and a

2


Page 9 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cooled digital camera (Retiga EXi Aqua; QImaging Corporation). The Lumina Vision acquisition software (Mitani Corporation, Tokyo, Japan) was used to acquire the images. Cells showing a round to oval morphology, a visible nucleus (Hoechst 33342 positive), and that were positive for cytokeratin and negative for CD45 were scored as cancer cells. Hydrogel encapsulation of CTCs on the microcavity array The procedure for hydrogel-assisted collection of CTCs from the microcavity array is illustrated in Fig. 1(A). After cell entrapment on the microcavity array, PEGDA (Mn=250, 575, 700, 750; Sigma-Aldrich) solution with a 2-hydroxy-2-methylpropiophenone photoinitiator (5% for PEGDA Mn=250 and 575; 1% for PEGDA Mn=700 and 750) was introduced onto the CTC recovery device and covered with an oblong cover glass (24 × 60 mm; Matsunami Glass, Osaka, Japan). The height of the reservoir for PEGDA was controlled by lamination with spacer tapes (approximately 100 µm in height). A confocal laser-scanning microscope (FV1000-D IX81; Olympus Corporation) was used for photopolymerization of the PEGDA hydrogel. The light at 405 nm (1.4 mW) was focused through the objective lens (UPLSAPO100XO, Olympus Corporation) and projected onto the target cells (Fig. 1(B)). First, the focal point was set at the midpoint of the distance between the microcavity array and the cover glass, and was then gradually shifted by changing the height (X in Fig. 1(B)). The array of the photopolymerized hydrogels was collected by peeling off the cover glass from the microcavity array, and each hydrogel was transferred to 200-µL polymerase chain reaction (PCR) tubes using tweezers for subsequent genetic analysis. Scanning electron microscopy (SEM) The PEGDA hydrogels were first fixed with 2% glutaraldehyde and 2% paraformaldehyde in 30 mM HEPES buffer (pH 7.4) for 60 min at 4°C. Subsequently, the hydrogels were dehydrated with 30 mM HEPES buffer and a graded ethanol series of 25%, 50%, 75%, 90%, and 100%. The 100% ethanol was replaced with 1,1,1,3,3,3hexamethyldisilazane, incubated for 5 min, and air-dried. Finally, the hydrogels were coated with gold by sputtering using the E-1010 ion sputter (HITACHI, Ltd., Tokyo, Japan) and observed using SEM (VE-9800; KEYENCE Corp., Osaka, Japan). WGA from single-cells Single-cells encapsulated on the hydrogels were subjected to WGA using the PicoPLEXTM WGA Kit (New England BioLabs Inc., Beverly, MA, USA). According to the manufacture’s protocol, 12 cycles of based preamplification steps and 14 cycles of amplification steps were carried out. Besides, we also carried out additional 3 round of pre-amplification (15 cycles) and amplification (17 cycles) steps to improve the yield of WGA products. WGA products were purified using the QIAquick PCR Purification kit (QIAGEN, Hilden, Germany). The final DNA concentration was determined on a NanoDrop spectrometer (Nd-1000; Thermo Fisher Scientific, Waltham,

MA, USA). To assess amplification bias, nine genes (PIK3CA, MSH2, CAT, P53, ADCYAP1, PMS2, C6orf195, PTEN) were selected for PCR testing. Primer designs were based on previous study40. PCR was carried out in a 50 µL mixture containing 1µL of WGA products as a template, 0.3 µM of each primer, 0.2 mM of each dNTP, 5 µL of 10× TaKaRa Ex Taq buffer, and 1.25 U of TaKaRa Ex Taq (TaKaRa). All PCRs were performed using the following conditions: 3 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at 56°C, and 1 min at 72°C followed by 2 min at 72°C. PCR products were analyzed by electrophoresis. The success rate of PCR amplification was evaluated in five repeated trials. Single cells were also isolated from the microcavity array using a micropipette made from a glass capillary with a micromanipulator system (Pico-Pipet, Altair Co., Tokyo, Japan) as a control. The manipulator was manually operated, and the recovered cells were transferred into 200-µL PCR tubes. PCR and DNA sequencing for genotyping Part of the human epidermal growth factor receptor (EGFR)-coding region was amplified by PCR using amplified genomic DNA from single cells as a template (PyroMark PCR kit (QIAGEN, Hilden, Germany)) with the following forward and reverse primers: EGFR exon19-F, 5′- GCAATATCAGCCTTAGGTGCGGCTC-3′; and EGFR exon19-R, 5′CATAGAAAGTGAACATTTAGGATGTG -3′. PCR products were purified using QIAquick PCR Purification kit, and the lengths were analyzed using the Agilent DNA 1000 kit (Agilent Biotechnology, Santa Clara, CA, USA). HCC827 cells have an EGFR-deletion mutation (del E746-A750: deletion of 15 bp in exon 19)41, so that the length of PCR products from HCC827 cells (356 bp for del E746-A750 genotyping) is shorter than that of the wild type (371 bp) (leukocyte and NCI-H1975). PCR products were further sequenced on the ABI PRISM 3130 DNA Sequencer (Applied Biosystems, Inc., Foster City, CA, USA), and the EGFR mutations in the isolated cells were confirmed. Results and discussion Characterization of PEGDA hydrogel photopolymerized by confocal microscopy Prior to cell encapsulation, the morphologies of PEGDA hydrogels without cells were analyzed. Fig. 2(A) shows photographs of the PEGDA hydrogels on the cover glass, which were photopolymerized by confocal microscopy. The photopolymerized hydrogel was attached on the cover glass after collecting it from the CTC recovery device (see also Fig. 1(A)-5). The complete hydrogel could be visualized on the cover glass, and each hydrogel could be readily handled in order to peel it away from the surface using tweezers. Fig. 2(B) shows a typical SEM image of the photopolymerized PEGDA hydrogel when the focal point was set at the midpoint of the distance between the microcavity array and cover glass (height (X) in Fig. 1(B)). The PEGDA hydrogel was shaped like a goblet, as expected. The upper and lower parts are regarded as a cone of light, and the constricted part is regarded as

3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

the focal point plane with the ×100 objective lens (Fig. 2(C)). The height of the hydrogel was 333 ± 15 µm, and the diameter of the top and bottom faces was 227 ± 35 µm. In order to confirm the generation of the desired shapes of the hydrogels, the theoretical and experimentally observed angles of incidence (θ2 in Fig. 2(C)) were compared. The theoretical angles of incidence were estimated according to Snell’s law (1): sinθ1/sinθ2 = n1/n2

(1)

Where θ1 is the angle of incidence in air, θ2 is the angle of incidence in the hydrogel, n1 is the refractive index of air (1.0), and n2 is the refractive index of the hydrogel (1.47). The refractive index of PEGDA was assumed to be the same as that of the cover glass (1.50). The observed angle (40.7 ± 3.5°) closely matched the theoretical angle (41.1 ± 0.0°). These results indicate that the hydrogels were photopolymerized from the light radiation conferred by confocal microscopy. Based on these results, various shapes of the hydrogels were successfully prepared by shifting the focal point plane from the midpoint of the height (X) to the upper side (Fig. 3(A)). When the distance from the midpoint increased, the diameter of the bottom face also increased, resulting in a larger bottom face to top face ratio (Fig. 3(B)). Furthermore, the shapes of the hydrogels could be varied by changing the height (X) (Fig. S2) as well as by shifting the focal point plane. These morphological variations of the hydrogels could be applied for recognition of specific cell types so that encapsulation could be targeted according to the shape of the hydrogel. Earlier studies has demonstrated high throughput generation of various shapes of the photopolymerized hydrogels bearing over a million unique barcodes based on continuous-flow lithography42, 43. These methodologies will be useful for us to ensure the morphological variations of the hydrogels in the future. On the other hand, the area of the hydrogel reserved for the target cell on the microcavity array should be minimized for single-cell manipulation to avoid contamination of neighbor cells. Furthermore, the diameters of both faces should be less than 250 µm, because the distance between microcavities was 125 µm in this study. Therefore, the hydrogels with a diameter of less than 250 µm for both faces were used in order to minimize the area of the hydrogel reserved for the target cell for the subsequent cell encapsulation experiments. Microcavity array-based encapsulation of single-cells using PEGDA hydrogel The mixture of NCI-H1975 and HCC827 cells was tested in the CTC recovery device for entrapment on the microcavity array, and then hydrogel encapsulation of only NCI-H1975 cells on the microcavity array was performed in the same manner. In this experiment, NCIH1975 cells were stained with CellTracker Orange, and HCC827 cells were stained with CellTracker Green (Fig. 4(A)). The fluorescent microscopic image of the bottom face of the hydrogel revealed successful encapsulation of a single NCI-H1975 cell (Fig. 4(B)). Fig. 5 shows the

Page 10 of 13

SEM images of hydrogels with and without a single cancer cell. Small holes were formed in the central positions both in the presence and absence of a cell. The sphere at the center of the bottom face was expected to be the target cell (arrows in Fig. 5(B)). The circular bump observed at the center of the bottom face may have been formed from the dimple mold of the microcavity (Fig. S1(A)). These results indicate that each cancer cell was only partially encapsulated on the PEGDA hydrogel. After peeling the hydrogel from the cover glass, some cancer cells were maintained at the bottom face of the hydrogel, while other cells remained on the microcavity array. The cell transfer onto the hydrogel was affected by the exposure time of light used for the photopolymerization and molecular weight of PEGDA. In case of PEGDA (Mn=700), the cell transfer rate was 66.7% at an exposure time of 90 sec, and was enhanced up to 95% by prolonging the exposure time to 180 sec (3 min). Cell transfer rate also depended on the molecular weight of PEGDA, and increased from 75% for Mn=250 to 97% for Mn=750 (Fig. S3). Furthermore, the solidification of PEGDA Mn=250 was much slower than that of PEGDA Mn=700 as previously reported44. In our experimental condition, PEGDA Mn=250 and Mn =575 were not completely solidified. PEGDA Mn=700 was used in the following experiments. It takes only few seconds to transfer a visible hydrogel to the tube by tweezer. Given that simultaneous photopolymerization with multiple cells can be attained by laser beam splitting45, high-throughput cell encapsulation using a hydrogel should be able to be completed within 3 min. Therefore, our proposed approach will have a great advantage in rapid cell manipulation over conventional method, such as micromanipulation. Furthermore, NCI-H1975-spiked blood samples were tested in the CTC recovery device to focus specifically on removal of leukocytes from the surface. NCI-H1975 cells were preliminarily stained with CellTracker Green. Cancer cells were completely recovered from the blood samples on the microcavity array at less than 150 µL/min of flow rare when 100 cancer cells spiked into 1 ml whole blood were used (Fig. S4). Previous study revealed that NSCLC cell lines (A549, HCC827, NCI-H358, NCIH441, and PC-14 cells) were recovered from cell-spiked blood samples at more than 97 % using the microcavity array (10,000 cavities) at 200 µL/min of flow rate35. The same tendency was observed in this study, although newly designed microcavity array (3,969 cavities) was used for cell encapsulation without any contamination of neighboring cells. Based on these results, CTC recovery was performed at a flow rate of 150 µL/min in the subsequent experiments. WGA from a single cancer cell encapsulated on hydrogel NCI-H1975 cells (100 cells) in 1 mL PBS were introduced into the CTC recovery device, and recovered on the microcavity array. The recovered cells were then encapsulated on the hydrogel at an exposure time of 3 min, and subjected to the WGA. Table 1 shows DNA yields obtained by the WGA from single-cells. Single-cells isolated by micromanipulation were used as a comparison. Ge-

4


Page 11 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nome amplification was successfully carried out in all single-cells encapsulated on the hydrogel. The DNA yield of single cells encapsulated on the hydrogel was reduced to 84% (2.6 ± 0.1 µg, n = 5) compared to the DNA yield obtained from single-cells (3.1 ± 0.2 µg; n = 5) isolated by micromanipulation when standard protocol according to the manufacture’s instruction was used (Preamplification: 12 & Amplification: 14). The DNA yield in the presence of hydrogel could be improved by increasing the amplification cycles (Pre-amplification: 15 & Amplification: 17). The yield was the same level with that of single-cell samples isolated by micromanipulation (3.2 ± 0.3 µg; n = 5). In addition, a single cell completely encapsulated “in” the hydrogel was prepared for comparison to the situation of “on” the hydrogel, as follows: PEGDA solution (0.5 µL) was dropped on the bottom face of the hydrogel, and was then polymerized again by light irradiation to fully encapsulate the cell in the hydrogel. The results showed that genome amplification from the single cell “in” the hydrogel sample was significantly suppressed (0.5 ± 0.0 µg, n = 3). These results indicate that each cancer cell “on” the hydrogel was not completely encapsulated by the hydrogel, and that part of the cell was exposed to the environment. This property may exert an advantage for sufficient genome amplification from single cells on the hydrogel. Furthermore, to assess the bias of WGA, the coverage of WGA was evaluated based on the success rate of PCR amplification of 9 fragments (multiple loci) from WGA samples using 9 different primer sets (Table S1). Thus we concluded PEGDA hydrogel have no critical effects on whole genome amplification. It should be noted that currently commercialized WGA kits still have several problems, i.e. poor genetic representation of the entire genome and a relatively high failure rate 46. Therefore, the whole genome sequencing of single-cells should be performed in the near future to more precisely evaluate the genomic representation of the genome. Genotyping of HCC827 cell encapsulated on hydrogel To further confirm the successful cell manipulation and genome amplification, the genotype of amplified genomic DNA obtained from single cells was investigated by DNA sequencing. HCC827 cells, which have the mutation del E756-A750 in the EGFR gene41, were used as the model cancer cell line. HCC827 cells (100 cells) were spiked in human whole blood (1 mL) from a healthy donor, recovered, and encapsulated on the microcavity array according to the same procedure described above. Cells that were positively stained for the nucleus and cytokeratin, and negative for CD45 were scored as cancer cells, and cells staining positive for the nucleus and CD45, and negative for cytokeratin were scored as leukocytes (Fig. 6(A)). Among them, 5 cancer cells and 6 leukocytes were randomly selected for hydrogel encapsulation, and used for the WGA. After WGA, the resulting DNA was subjected to PCR amplification using EGFR gene-specific primers followed by DNA sequencing. Electrophoresis of the PCR products and DNA sequencing could detect the EGFR (del E756-A750) mutation from the HCC827 samples (n = 5) and EGFR wild type

from the leukocytes (n = 6) (Fig. 6(B)). The genotype was successfully detected in all of the single-cell samples (n = 11 in total) isolated by PEGDA hydrogel. These results demonstrated that the method allows for accurate singlecell manipulation and genome amplification without any contamination of neighboring cells. Conclusions In conclusion, a simple and rapid CTC manipulation method was developed using PEGDA hydrogel encapsulation of single CTCs entrapped on a microcavity array. The encapsulated CTCs could be visualized and easily handled with tweezers, thereby facilitating the subsequent genetic analysis. The hydrogels could be photopolymerized in 3 min by changing the light radiation with confocal microscopy, which maintained the minimum exclusive area without any contamination of neighboring cells. Simultaneous photopolymerization against multiple cells by laser-beam splitting will allow for high-throughput cell encapsulation at the same time. Furthermore, different morphological varieties of the hydrogels could be applied for specific cell recognition by encapsulation according to the shape of the hydrogel. Each cancer cell was only partially encapsulated on the PEGDA hydrogel, resulting in sufficient WGA and accurate genotyping from a single CTC. This proposed cell manipulation technique is expected to be widely utilized for other mammalian cells and microorganisms as well as for CTCs.

ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website. Supporting information (PDF)

AUTHOR INFORMATION Corresponding Author * Give contact information for the author(s) to whom correspondence should be addressed. E-mail: [email protected];

Present Addresses †If an author’s address is different than the one given in the affiliation line, this information may be included here.

Author Contributions The manuscript was written through contributions of all authors.

ACKNOWLEDGMENT We wish to thank Hitachi Chemical Company, Ltd. for advice on experimental design. This research is supported by CREST, JST. These authors contributed equally to this work.

REFERENCES (1) Nagrath, S.; Sequist, L. V.; Maheswaran, S.; Bell, D. W.; Irimia, D.; Ulkus, L.; Smith, M. R.; Kwak, E. L.; Digumarthy, S.; Muzikansky, A.; Ryan, P.; Balis, U. J.; Tompkins, R. G.; Haber, D. A.; Toner, M. Nature 2007, 450, 1235-1239.

5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(2) Cristofanilli, M.; Budd, G. T.; Ellis, M. J.; Stopeck, A.; Matera, J.; Miller, M. C.; Reuben, J. M.; Doyle, G. V.; Allard, W. J.; Terstappen, L. W. New England Journal of Medicine 2004, 351, 781-791. (3) Hou, J. M.; Krebs, M. G.; Lancashire, L.; Sloane, R.; Backen, A.; Swain, R. K.; Priest, L. J.; Greystoke, A.; Zhou, C.; Morris, K.; Ward, T.; Blackhall, F. H.; Dive, C. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 2012, 30, 525-532. (4) Powell, A. A.; Talasaz, A. H.; Zhang, H.; Coram, M. A.; Reddy, A.; Deng, G.; Telli, M. L.; Advani, R. H.; Carlson, R. W.; Mollick, J. A.; Sheth, S.; Kurian, A. W.; Ford, J. M.; Stockdale, F. E.; Quake, S. R.; Pease, R. F.; Mindrinos, M. N.; Bhanot, G.; Dairkee, S. H.; Davis, R. W.; Jeffrey, S. S. PloS one 2012, 7, e33788. (5) Mathiesen, R. R.; Fjelldal, R.; Liestol, K.; Due, E. U.; Geigl, J. B.; Riethdorf, S.; Borgen, E.; Rye, I. H.; Schneider, I. J.; Obenauf, A. C.; Mauermann, O.; Nilsen, G.; Christian Lingjaerde, O.; Borresen-Dale, A. L.; Pantel, K.; Speicher, M. R.; Naume, B.; Baumbusch, L. O. International journal of cancer. Journal international du cancer 2012, 131, E405-415. (6) Rolle, A.; Gunzel, R.; Pachmann, U.; Willen, B.; Hoffken, K.; Pachmann, K. World journal of surgical oncology 2005, 3, 18. (7) Racila, E.; Euhus, D.; Weiss, A. J.; Rao, C.; McConnell, J.; Terstappen, L. W. M. M.; Uhr, J. W. Proceedings of the National Academy of Sciences of the United States of America 1998, 95, 4589-4594. (8) Allard, W. J.; Matera, J.; Miller, M. C.; Repollet, M.; Connelly, M. C.; Rao, C.; Tibbe, A. G.; Uhr, J. W.; Terstappen, L. W. Clinical Cancer Research 2004, 10, 6897-6904. (9) Nair, S. V.; Witek, M. A.; Jackson, J. M.; Lindell, M. A.; Hunsucker, S. A.; Sapp, T.; Perry, C. E.; Hupert, M. L.; BaeJump, V.; Gehrig, P. A.; Wysham, W. Z.; Armistead, P. M.; Voorhees, P.; Soper, S. A. Chem Commun (Camb) 2015, 51, 3266-3269. (10) Kirby, B. J.; Jodari, M.; Loftus, M. S.; Gakhar, G.; Pratt, E. D.; Chanel-Vos, C.; Gleghorn, J. P.; Santana, S. M.; Liu, H.; Smith, J. P.; Navarro, V. N.; Tagawa, S. T.; Bander, N. H.; Nanus, D. M.; Giannakakou, P. PloS one 2012, 7, e35976. (11) Ozkumur, E.; Shah, A. M.; Ciciliano, J. C.; Emmink, B. L.; Miyamoto, D. T.; Brachtel, E.; Yu, M.; Chen, P. I.; Morgan, B.; Trautwein, J.; Kimura, A.; Sengupta, S.; Stott, S. L.; Karabacak, N. M.; Barber, T. A.; Walsh, J. R.; Smith, K.; Spuhler, P. S.; Sullivan, J. P.; Lee, R. J.; Ting, D. T.; Luo, X.; Shaw, A. T.; Bardia, A.; Sequist, L. V.; Louis, D. N.; Maheswaran, S.; Kapur, R.; Haber, D. A.; Toner, M. Science translational medicine 2013, 5, 179ra147. (12) Lin, H. K.; Zheng, S.; Williams, A. J.; Balic, M.; Groshen, S.; Scher, H. I.; Fleisher, M.; Stadler, W.; Datar, R. H.; Tai, Y. C.; Cote, R. J. Clinical cancer research : an official journal of the American Association for Cancer Research 2010, 16, 50115018. (13) Desitter, I.; Guerrouahen, B. S.; Benali-Furet, N.; Wechsler, J.; Janne, P. A.; Kuang, Y.; Yanagita, M.; Wang, L.; Berkowitz, J. A.; Distel, R. J.; Cayre, Y. E. Anticancer Res 2011, 31, 427441. (14) Cook, A. M.; Evans, S. A.; Lane, I. F.; Jones, J. G. British journal of haematology 1998, 102, 952-956. (15) Mohamed, H.; McCurdy, L. D.; Szarowski, D. H.; Duva, S.; Turner, J. N.; Caggana, M. IEEE transactions on nanobioscience 2004, 3, 251-256.

Page 12 of 13

(16) Xu, T.; Lu, B.; Tai, Y. C.; Goldkorn, A. Cancer research 2010, 70, 6420-6426. (17) Zheng, S.; Lin, H. K.; Lu, B.; Williams, A.; Datar, R.; Cote, R. J.; Tai, Y. C. Biomedical microdevices 2011, 13, 203-213. (18) Mohamed, H.; Murray, M.; Turner, J. N.; Caggana, M. Journal of chromatography. A 2009, 1216, 8289-8295. (19) Kim, M. S.; Sim, T. S.; Kim, Y. J.; Kim, S. S.; Jeong, H.; Park, J. M.; Moon, H. S.; Kim, S. I.; Gurel, O.; Lee, S. S.; Lee, J. G.; Park, J. C. Lab on a chip 2012, 12, 2874-2880. (20) Morimoto, A.; Mogami, T.; Watanabe, M.; Iijima, K.; Akiyama, Y.; Katayama, K.; Futami, T.; Yamamoto, N.; Sawada, T.; Koizumi, F.; Koh, Y. PloS one 2015, 10, e0130418. (21) Gross, M. E.; Dorff, T. B.; Quinn, D. I.; Agus, D. B.; Luttgen, M.; Bethel, K.; Kolatkar, A.; Kuhn, P. Convergent Science Physical Oncology 2015, 1, 015002. (22) Ni, X.; Zhuo, M.; Su, Z.; Duan, J.; Gao, Y.; Wang, Z.; Zong, C.; Bai, H.; Chapman, A. R.; Zhao, J.; Xu, L.; An, T.; Ma, Q.; Wang, Y.; Wu, M.; Sun, Y.; Wang, S.; Li, Z.; Yang, X.; Yong, J.; Su, X. D.; Lu, Y.; Bai, F.; Xie, X. S.; Wang, J. Proceedings of the National Academy of Sciences of the United States of America 2013, 110, 21083-21088. (23) Magbanua, M. J.; Sosa, E. V.; Scott, J. H.; Simko, J.; Collins, C.; Pinkel, D.; Ryan, C. J.; Park, J. W. BMC cancer 2012, 12, 78. (24) Ran, R.; Li, L.; Wang, M.; Wang, S.; Zheng, Z.; Lin, P. P. Analytical and bioanalytical chemistry 2013, 405, 7377-7382. (25) Huang, S. B.; Wu, M. H.; Lin, Y. H.; Hsieh, C. H.; Yang, C. L.; Lin, H. C.; Tseng, C. P.; Lee, G. B. Lab on a chip 2013, 13, 1371-1383. (26) Yeo, T.; Tan, S. J.; Lim, C. L.; Lau, D. P.; Chua, Y. W.; Krisna, S. S.; Iyer, G.; Tan, G. S.; Lim, T. K.; Tan, D. S.; Lim, W. T.; Lim, C. T. Scientific reports 2016, 6, 22076. (27) Swennenhuis, J. F.; Tibbe, A. G.; Stevens, M.; Katika, M. R.; van Dalum, J.; Duy Tong, H.; van Rijn, C. J.; Terstappen, L. W. Lab on a chip 2015, 15, 3039-3046. (28) Lohr, J. G.; Adalsteinsson, V. A.; Cibulskis, K.; Choudhury, A. D.; Rosenberg, M.; Cruz-Gordillo, P.; Francis, J. M.; Zhang, C. Z.; Shalek, A. K.; Satija, R.; Trombetta, J. J.; Lu, D.; Tallapragada, N.; Tahirova, N.; Kim, S.; Blumenstiel, B.; Sougnez, C.; Lowe, A.; Wong, B.; Auclair, D.; Van Allen, E. M.; Nakabayashi, M.; Lis, R. T.; Lee, G. S.; Li, T.; Chabot, M. S.; Ly, A.; Taplin, M. E.; Clancy, T. E.; Loda, M.; Regev, A.; Meyerson, M.; Hahn, W. C.; Kantoff, P. W.; Golub, T. R.; Getz, G.; Boehm, J. S.; Love, J. C. Nature biotechnology 2014, 32, 479-484. (29) Heitzer, E.; Auer, M.; Gasch, C.; Pichler, M.; Ulz, P.; Hoffmann, E. M.; Lax, S.; Waldispuehl-Geigl, J.; Mauermann, O.; Lackner, C.; Hofler, G.; Eisner, F.; Sill, H.; Samonigg, H.; Pantel, K.; Riethdorf, S.; Bauernhofer, T.; Geigl, J. B.; Speicher, M. R. Cancer research 2013, 73, 2965-2975. (30) MacDonald, M. P.; Spalding, G. C.; Dholakia, K. Nature 2003, 426, 421-424. (31) Chiou, P. Y.; Ohta, A. T.; Wu, M. C. Nature 2005, 436, 370372. (32) Pollen, A. A.; Nowakowski, T. J.; Shuga, J.; Wang, X.; Leyrat, A. A.; Lui, J. H.; Li, N.; Szpankowski, L.; Fowler, B.; Chen, P.; Ramalingam, N.; Sun, G.; Thu, M.; Norris, M.; Lebofsky, R.; Toppani, D.; Kemp, D. W., 2nd; Wong, M.; Clerkson, B.; Jones, B. N.; Wu, S.; Knutsson, L.; Alvarado, B.; Wang, J.; Weaver, L. S.; May, A. P.; Jones, R. C.; Unger, M. A.; Kriegstein, A. R.; West, J. A. Nature biotechnology 2014, 32, 1053-1058.

6


Page 13 of 13

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(33) Fabbri, F.; Carloni, S.; Zoli, W.; Ulivi, P.; Gallerani, G.; Fici, P.; Chiadini, E.; Passardi, A.; Frassineti, G. L.; Ragazzini, A.; Amadori, D. Cancer letters 2013, 335, 225-231. (34) Peeters, D. J.; De Laere, B.; Van den Eynden, G. G.; Van Laere, S. J.; Rothe, F.; Ignatiadis, M.; Sieuwerts, A. M.; Lambrechts, D.; Rutten, A.; van Dam, P. A.; Pauwels, P.; Peeters, M.; Vermeulen, P. B.; Dirix, L. Y. British journal of cancer 2013, 108, 1358-1367. (35) Hosokawa, M.; Hayata, T.; Fukuda, Y.; Arakaki, A.; Yoshino, T.; Tanaka, T.; Matsunaga, T. Analytical chemistry 2010, 82, 6629-6635. (36) Hosokawa, M.; Yoshikawa, T.; Negishi, R.; Yoshino, T.; Koh, Y.; Kenmotsu, H.; Naito, T.; Takahashi, T.; Yamamoto, N.; Kikuhara, Y.; Kanbara, H.; Tanaka, T.; Yamaguchi, K.; Matsunaga, T. Analytical chemistry 2013, 85, 5692-5698. (37) Hosokawa, M.; Kenmotsu, H.; Koh, Y.; Yoshino, T.; Yoshikawa, T.; Naito, T.; Takahashi, T.; Murakami, H.; Nakamura, Y.; Tsuya, A.; Shukuya, T.; Ono, A.; Akamatsu, H.; Watanabe, R.; Ono, S.; Mori, K.; Kanbara, H.; Yamaguchi, K.; Tanaka, T.; Matsunaga, T.; Yamamoto, N. PloS one 2013, 8, e67466. (38) Negishi, R.; Hosokawa, M.; Nakamura, S.; Kanbara, H.; Kanetomo, M.; Kikuhara, Y.; Tanaka, T.; Matsunaga, T.; Yoshino, T. Biosensors & bioelectronics 2015, 67, 438-442. (39) Osada, K.; Hosokawa, M.; Yoshino, T.; Tanaka, T. The Analyst 2014, 139, 425-430. (40) Jiang, Z.; Zhang, X.; Deka, R.; Jin, L. Nucleic acids research 2005, 33, e91. (41) Okabe, T.; Okamoto, I.; Tamura, K.; Terashima, M.; Yoshida, T.; Satoh, T.; Takada, M.; Fukuoka, M.; Nakagawa, K. Cancer research 2007, 67, 2046-2053. (42) Bong, K. W.; Chapin, S. C.; Doyle, P. S. Langmuir : the ACS journal of surfaces and colloids 2010, 26, 8008-8014. (43) Pregibon, D. C.; Toner, M.; Doyle, P. S. Science 2007, 315, 1393-1396. (44) Yang, D.; Qin, Y.; Ye, S.; Ge, J. Advanced Functional Materials 2014, 24, 817-825. (45) Ingargiola, A.; Panzeri, F.; Sarkosh, N.; Gulinatti, A.; Rech, I.; Ghioni, M.; Weiss, S.; Michalet, X. Proceedings of SPIE--the International Society for Optical Engineering 2013, 8590. (46) de Bourcy, C. F.; De Vlaminck, I.; Kanbar, J. N.; Wang, J.; Gawad, C.; Quake, S. R. PloS one 2014, 9, e105585.

genome amplification (WGA)

Table Table 1 Comparison of DNA yields obtained by wholeWGA product (µg)

Samples*

WGA condition(cycles)

Single-cell isolated by micromanipulation

Pre-amplification: 12 Amplification: 14

3.1 ± 0.2

Single cell encapsulated “on” hydrogel


2.6 ± 0.1

Single cell encapsulated “on” hydrogel


3.2 ± 0.3

Single cell encapsulated “in” hydrogel


0.5 ± 0.0

*NCH-H1975 cells were used for WGA.

7


Manipulation of a Single Circulating Tumor Cell Using Visualization of

Recommend Documents