Article pubs.acs.org/JAFC
Manipulation of Rumen Microbial Fermentation by Polyphenol Rich Solvent Fractions from Papaya Leaf to Reduce Green-House Gas Methane and Biohydrogenation of C18 PUFA Saeid Jafari,† Goh Yong Meng,*,†,‡ Mohamed Ali Rajion,† Mohammad Faseleh Jahromi,‡ and Mahdi Ebrahimi† †
Department of Veterinary Preclinical Sciences, Faculty of Veterinary Medicine, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia ‡ Institute of Tropical Agriculture, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia ABSTRACT: Different solvents (hexane, chloroform, ethyl acetate, butanol, and water) were used to identify the effect of papaya leaf (PL) fractions (PLFs) on ruminal biohydrogenation (BH) and ruminal methanogenesis in an in vitro study. PLFs at a concentration of 0 (control, CON) and 15 mg/250 mg dry matter (DM) were mixed with 30 mL of buffered rumen fluid and were incubated for 24 h. Methane (CH4) production (mL/250 mg DM) was the highest (P < 0.05) for CON (7.65) and lowest for the chloroform fraction (5.41) compared to those of other PLFs at 24 h of incubation. Acetate to propionate ratio was the lowest for PLFs compared to that of CON. Supplementation of the diet with PLFs significantly (P < 0.05) decreased the rate of BH of C18:1n-9 (oleic acid; OA), C18:2n-6 (linoleic acid; LA), and C18:3n-3 (α-linolenic acid; LNA) compared to that of CON after 24 h of incubation. Real time PCR indicated that total protozoa and total methanogen population in PLFs decreased (P < 0.05) compared to those of CON. KEYWORDS: biohydrogenation, fermentation, in vitro gas production, papaya leaf fractions, methanogenesis, rumen
■
INTRODUCTION Climate change is associated with the emission of greenhouse gases (GHG) such as methane (CH4), in which CH4 formation in the rumen is a major cause of GHG emission.1 CH4 formation represents a physiologically important pathway to avoid hydrogen (H2) accumulation in the rumen; however, CH4 formation (rumen methanogenesis) is contributing to the atmospheric burden of GHG, which is linked to global warming and climate change.2,3 Besides, CH4 emission from enteric fermentation represents a significant loss of feed energy.4 The study of rumen fatty acid metabolism is important to the understanding of factors which influence the types of fatty acid in human food products derived from ruminants.5 Rumen biohydrogenation (BH), the conversion of dietary polyunsaturated fatty acid (PUFA) to saturated fatty acid (SFA) by rumen microbes, is detrimental to human health because of the increasing risk of cardiovascular disease.6 However, many intermediates are produced during this process such as conjugated linoleic acid (CLA), mainly c9 t11 CLA, and vaccenic acid (VA), which have health implications such as the prevention of cancer, reduction of atherosclerosis, and improvement of immune response.7 The BH process is largely influenced by plant secondary metabolites like phenolic compounds.8 Moreover, these compounds, accumulate BH intermediates and enhance PUFA and CLA content.9 Tropical plants, which normally contain a medium to high content of secondary compounds with antimicrobial activity, show promise in the reduction of BH of PUFA and methanogenesis in ruminants.10,11 Carica papaya which can be found in all tropical countries and many subtropical regions of the world has many health implications.12,13 Quantitative © XXXX American Chemical Society
analysis of papaya leaf (PL) has also shown the presence of phenolic acids as the main compound in PL extract.12 Plant extracts have been used for centuries for various purposes such as in traditional medicine and as food preservatives due to their antimicrobial properties.14 The antimicrobial activity of plant extracts is attributed to a number of plant secondary metabolites which include saponins, tannins, terpenoids, essential oils, and other bioactive compounds.14 Solvent extraction is also a usual technique applied to the purification of extracts and/or isolation of phenolic compounds.15 In solvent extraction, methanol, ethanol, acetone, and ethyl acetate and combinations of them and with water are frequently used for the extraction of phenolics. For the purification of crude extracts, nonpolar solvents such as petroleum ether, chloroform, hexane, and other solvents can be used for the removal of lipophilic side compounds.15 Phytochemical screening of PL extracted by different solvents (ethanol, methanol, ethyl acetate, acetone, chloroform, petroleum ether, and hexane) has shown the presence of different classes of plant secondary metabolites. For example, the presence of phytosterol in Carica papaya was very prominent in all the extracts. Saponins, glycosides, proteins, amino acids, flavinoids, and terpinoids showed greater intensity of their presence in ethanol, methanol, ethyl alcohol, and acetone extraction than in other solvent extracts.16 Moreover, the chloroform extract showed the highest activity against gram (+) bacteria among other solvent extracts. Received: February 25, 2016 Revised: May 11, 2016 Accepted: May 18, 2016
A
DOI: 10.1021/acs.jafc.6b00846 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry Moreover, Hossain et al.17 declared that the chloroform crude extracts of Azadirachta indica (neem) could be used as a natural antioxidant. By keeping the above facts in view and lack of enough information in the literature about the effect of different solvent extraction of PL on rumen characteristics, the objectives of this study were to identify the effects of different solvent extracts from PL on rumen methanogenesis, fermentation characteristics, microbial population, and BH of C18 PUFA in an in vitro condition.
■
concentration of 15 mg/250 mg DM, butanol fraction at a concentration of 15 mg/250 mg DM, ethyl acetate fraction at a concentration of 15 mg/250 mg DM, and water fraction at a concentration of 15 mg/250 mg DM15 mg/250 mg DM. The incubations were conducted in two consecutive days, and these incubations were repeated three times within an interval of 1 week. Moreover, incubations comprised six replicates of each treatment and three syringes of blank (only buffered rumen fluid) for the correction of gas production. Linoleic acid (LA, Sigma-Aldrich, St. Louis, MO, USA) was added to the incubations as a PUFA source. Syringes were incubated at 39 °C for 24 h. Additionally, the buffered rumen fluid including samples were sampled before incubation (0 h) to determine the initial fatty acid profiles which later were used for the BH of C18 PUFA. Chemical composition and fatty acid content of substrates used for the in vitro incubations are also shown in Table 1.
MATERIALS AND METHODS
Plant Material and the Extraction−Fractionation Procedure. In June 2014, PL samples were collected from a papaya farm (1°34′57.7″N, 104°12′20.7″E) in Kota Tinggi, Johor, Malaysia. The PL samples were air-dried for 2 days, followed by oven-drying overnight at 50 °C. For extraction−fractionation of PL, as is shown in Figure 1, 250 g of PL powder was extracted by 10 vol (v/w) of 80%
Table 1. Chemical Composition and Fatty Acid Content of Substrates Used for the in Vitro Incubationsa DM (g/kg) DM CP NDF ADF EE C16:0 C18:0 C18:1n-9 C18:2n-6 C18:3n-3
AH
concentrate
907.00 203.00 517.01 334.00 9.40 Fatty Acid (g/100g FA) 5.71 6.38 4.63 16.76 27.93
915.00 167.00 244.03 117.00 18.01 7.60 7.61 5.52 19.99 33.32
a
Figure 1. Schematic diagram depicting the extraction−fractionation of papaya leaf.
C16:0, palmitic acid; C18:0, stearic acid; C18:1n-9, OA; C18:2n-6, LA; C18:3n-3, LNA. AH, alfalfa hay; DM, dry matter; CP, crude protein; NDF, neutral detergent fiber, ADF, acid detergent fiber; EE, ether extract.
methanol at 80 °C for 3 h, and the extraction was repeated three times as described by Lee et al.18 The extracts were filtered through Whatman filter paper (No. 2), concentrated with a vacuum evaporator (Heidolph, Germany), and completely dried with a freeze drier (Labconco, USA). The freeze-dried methanol extract (106 g) was dissolved in water (900 mL) and fractionated with 300 mL of hexane, chloroform, ethyl acetate, butanol, and water.18 The fractionated samples were then concentrated with a vacuum evaporator (Heidolph, Germany) and further dried with a freeze drier (Labconco, USA). Then, they were preserved in tightly closed plastic bags stored in −20 °C until further analysis. Animals and Rumen Liquor Sampling. Four rumen fistulated goats (Kajang crossbred) with average body weight of about 39 ± 0.70 kg were used as rumen liquor donors. The goats were fed twice daily with a diet containing a fixed amount of alfalfa hay (AH) and commercial concentrate in a 60:40 ratio. Rumen liquor was sampled before the morning feeding at 08:00 am from four goats and placed immediately in warm (39◦ C) insulated flasks under anaerobic conditions. In the laboratory, samples were pooled in equal proportions and strained through four layers of cheesecloth under anaerobic conditions and used immediately. All animal management and sampling procedures were approved by the Universiti Putra Malaysia Animal Care and Use Committee. In Vitro Incubation. In vitro gas production protocol was carried out according to Fievez et al.19 in which 30 mL of buffered (phosphate buffer contained 28.8 g of Na2HPO4·12 H2O, 6.1 g of NaH2PO4·H2O, and 1.4 g of NH4Cl, and bicarbonate buffer contained 39.2 g of NaHCO3 per liter distilled water) rumen fluid solution was dispensed into 100 mL calibrated syringes containing different PLFs (hexane, chloroform, ethyl acetate, butanol, and water) fractions with one dose. Treatments were the control (CON) with no PLFs (50:50, 125 mg of DM of AH + 125 mg of DM of concentrate), hexane fraction at a
Analysis of Incubation Products. After 24 h of incubation, total gas production was estimated by visual assessment of the syringes; then, 1 mL of the gas phase was sampled from the syringe and analyzed by gas−liquid chromatography (Agilent 5890 Series Gas Chromatograph, Wilmington, DE, USA) equipped with a flame ionization detector for the determination of CH4 production. Calibration was completed using standard CH4 prepared by Scotty Specialty Gases (Supelco, Bellefonte, PA, USA). All of the procedures were repeated three times. The pH of the contents of the syringes was determined using a pH electrode (Mettler-Toledo Ltd., England). Then, 1 mL of meta-phosphoric acid was added to 4 mL of incubated samples and was centrifuged at 3000g for 10 min at 25 °C. Then, 0.5 mL of clarified sample was added to 0.5 mL of 4-methyl-n-valeric acid (20 mM) before the analysis of concentrations of volatile fatty acids (VFA: acetic, propionic and butyric acids) by gas chromatography. VFA were determined using gas chromatography with a Quadrex 007 Series (Quadrex Corporation, New Haven, CT 06525 USA) bonded phase fused silica capillary column (15m, 0.32 mm ID, 0.25 μm film thickness) in an Agilent 7890A gas−liquid chromatograph (Agilent Technologies, Palo Alto, CA, USA) equipped with a flame ionization detector (FID). The concentration of NH3N was determined using the colorimetric method described by Solorzano.20 A standard curve was prepared to determine whether a linear relationship existed between the varying concentrations of ammonium chloride (NH4Cl) standard solution and the intensity of color produced. Fatty Acid Analysis and Biohydrogenation Calculation. The fatty acid contents were extracted from the whole syringe content after 24 h of incubation based on the method of Folch et al.21 modified by Rajion et al.22 as described by Ebrahimi et al.23 using chloroform/ methanol 2:1 (v/v) containing butylated hydroxy toluene to prevent oxidation during sample preparation. After complete separation, the lower phase was collected in a round-bottomed flask and rotary B
DOI: 10.1021/acs.jafc.6b00846 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry Table 2. Polymerase Chain Reaction (PCR) Primers Used for Amplifying Target Rumen Bacteria and Protozoaa microorganism
sequence 5′−3′
ref
total bacteria F1 total bacteria R2 Butyrivibrio f ibrisolvens F1 Butyrivibrio f ibrisolvens R2 total methanogen F1 total methanogen R2 total protozoa F1 total protozoa R2
CGGCAACGAGCGCAACCC CCATTGTAGCACGTGTGTAGCC TAACATGAGTTTGATCCTGGCTC CGTTACTCACCCGTCCGC TTCGGTGGATCDCARAGRGC GBARGTCGWAWCCGTAGAATCC ACCGCATAAGCGCACGGA CGGGTCCATCTTGTACCGATAAAT
54 55
57
56
a 1
F , forward; R2, reverse.
Table 3. Effect of PLFs on Total Gas (mL/250 mgDM), c (h−1) or Fractional Rate of Gas Production and CH4 Gas (mL/250 mgDM) Production at 24 h of in Vitro Incubation with Rumen Fluid from Goatsa experimental diets parameters
CON
hexane
chloroform
ethyl acetate
butanol
water
SEM
P-values
total gas cb CH4
34.66 a 1.44 7.65 a
19.75 c 0.82 5.69 b
27.75 ab 1.15 5.41 b
26.25 b 1.09 6.11 ab
22.25 b 0.92 5.71 b
23.00 b 0.96 7.59 a
3.151 0.131 0.558
0.0004 0.2388 0.0132
a
CON: control without PLFs (50% concentrate +50% AH). Chloroform: chloroform fraction at a concentration of 15 mg/250 mg DM. Hexane: hexane fraction at a concentration of 15 mg/250 mg DM. Butanol: butanol fraction at a concentration of 15 mg/250 mg DM. Ethyl acetate: ethyl acetate fraction at a concentration of 15 mg/250 mg DM. Water: water fraction at a concentration of 15 mg/250 mg DM. SEM: standard error of mean. Different letters in each row are significantly different (P < 0.05). bc: fractional rate of gas production (h−1)
evaporator (Laborota 4000-efficient; Heidolph, Germany) at 70 °C. An internal standard, heneicosanoic acid (C21:0) (Sigma Chemical, St. Louis, MO, USA), was added to each sample before transmethylation to determine the individual fatty acid concentration within the sample. Transmethylation of the extracted fatty acids to their fatty acid methyl esters was carried out using KOH in methanol and 14% methanolic boron trifluoride. The fatty acid methyl esters were separated by gas chromatography (Agilent 7890A), using a Supelco SP 2560 capillary column of 100m × 0.25 mm ID × 0.2 μm film thickness (Supelco, Bellefonte, PA, USA). One microliter was injected by an autosampler (Agilent Auto Analyzer 7683 B series, Agilent Technologies, Santa Clara, CA, USA) into the chromatograph and equipped with a split/ splitless injector and a FID. The carrier gas was nitrogen at a flow rate of 1.2 mL/min. The split ratio was 1:20 after the injection of 1 μL of the fatty acid methyl esters. The injector temperature was programmed at 250 °C, and the detector temperature was 270 °C. The column temperature program started to run at 150 °C, for 2 min, warmed to 158 °C at1 °C/min, was held for 28 min, warmed to 220 °C at 1 °C/ min, and then held for 20 min to achieve satisfactory separation. The peaks of samples were identified and concentrations calculated based on the retention time and peak area of known standards (Sigma Chemical). The fatty acid concentrations are expressed as gram per 100 g of the sum of identified peaks measured in each sample. BH of PUFA was calculated as decrease of PUFA from the initial PUFA at time zero (0 h) of incubation as described by Jayanegara et al.:24
methanogen, Butyrivibrio f ibrosolvens, and total protozoa in extracted samples from goat was measured by real-time PCR and the SYBR Green PCR Master Mix Kit. The number of copies of a template DNA per mL of elution buffer was calculated using the following formula that is available online at URL Genomics and Sequencing Center webbased calculator (www.uri.edu/research/gsc/resources/cndna.html).
number of copies =
( g)
amount of DNA μ mL × 6.022 × 1023 length (bp) × 109 × 650
Standard curves were constructed using cycle threshold values that were obtained from a serial dilution of plasmid DNA of each bacterial group. Primers used to quantify the population of different groups of microorganisms are shown in Table 2. Real-time PCR was performed with the Bio-Rad CFX96 Touch (Bio-Rad Laboratories, Hercules, CA, USA) using optical grade plates. The PCR reaction was performed on a total volume of 25 μL using the iQTMSYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA). Each reaction included 12.5 μL of SYBR Green Supermix, 1 μL of each primer, 1 μL of DNA samples, and 9.5 μL of RNase free waters. To confirm the specificity of amplification, a melting curve analysis was carried out after the last cycle of each amplification. Statistical Analysis. FA composition, biohydrogenation rate fermentation data, and microbial data after in vitro incubation were analyzed by a one-way ANOVA using the MIXED procedure of SAS (version 9.1; SAS Institute Inc., Cary, NC)25 with a model that included the fixed effect of experimental treatment. The data were checked for normality using PROC UNIVARIATE of the SAS ver. 9.1. The microbial data were normalized using the log10-transformation for the analysis. Differences were declared significant at P < 0.05. Means were separated through the “pdiff” option of the “lsmeans” statement of the MIXED procedure.
biohydrogenation (%) = [PUFA (0 h) − PUFA (24 h) ÷ PUFA (0 h)] × 100 where, PUFA (0 h) = concentration (g/100g of identified fatty acid) of PUFA at 0 h of incubation; and PUFA (24 h) = concentration (g/ 100g of identified fatty acid) of PUFA at 24 h of incubation. Estimation of Rumen Microbial Population Using Real Time PCR. After the termination of incubation, contents in the syringes were used to enumerate the microbial population. At the end of the 24 h in vitro incubation, 300 μL of the rumen fluid mixture was used for extraction of total DNA using the QIAamp DNA Stool kit (Qiagen Gmbh, Hilden, Germany). The concentration of extracted DNA was measured by a Nanodrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The relative abundance of total bacteria, total
■
RESULTS Effect of PLFs on Total Gas and Methane Production. The results of total gas and CH4 production are shown in Table 3. The highest gas production (P < 0.05) was reported for CON and the lowest for the hexane fraction. Fractional rate of gas production or c (h−1) was also significantly (P < 0.05) C
DOI: 10.1021/acs.jafc.6b00846 J. Agric. Food Chem. XXXX, XXX, XXX−XXX
Article
Journal of Agricultural and Food Chemistry
Table 4. Effect of the Addition of Different Levels of PLFs on Rumen Fermentation Parameters after 24 h of in Vitro Incubation with Rumen Fluid from Goatsa experimental diets treatments
CON
hexane
chloroform
ethyl acetate
butanol
water
SEM
P-values
pH NH3N (mg/dL) acetic (mmol/100 mol) propionic (mmol/100 mol) butyric (mmol/100 mol) total VFA (mM/L) acetic/propionic ratio
7.26 b 18.00 ab 68.06 a 33.46 a 3.52 a 105.05 a 2.04 a
7.27 b 17.20 b 58.62 ab 31.22 a 3.04 a 92.89 a 1.88 b
7.46 a 13.72 c 59.12 ab 32.94 a 2.84 ab 94.91 a 1.83 b
7.33 b 13.63 c 50.38 b 24.02 b 2.25 b 76.66 b 2.09 ab
7.24 b 18.57 ab 45.12 c 26.96 ab 2.39 b 74.48 b 1.69 c
7.20 b 23.74 a 51.34 b 29.04 ab 2.79 ab 83.18 ab 1.70 c
0.030 2.085 4.079 2.351 0.238 6.270 0.107
