Mapping the Expression of Soluble Olfactory Proteins in the Honeybee Francesca Romana Dani,†,# Immacolata Iovinella,‡,# Antonio Felicioli,§,# Alberto Niccolini,§ Maria Antonietta Calvello,‡ Maria Giovanna Carucci,‡ Huili Qiao,‡ Giuseppe Pieraccini,† Stefano Turillazzi,† Gloriano Moneti,† and Paolo Pelosi*,‡ CISM, University of Firenze, Firenze, Italy, Department of Agricultural Chemistry and Biotechnologies, University of Pisa, Pisa, Italy, and Department of Physiological Sciences, University of Pisa, Pisa, Italy Received October 26, 2009
Chemical communication in insects is mediated by soluble binding proteins, belonging to two large families, Odorant-binding Proteins (OBPs) and Chemosensory Proteins (CSPs). Recently, evidence has been provided that OBPs are involved in recognition of chemical stimuli. We therefore decided to investigate the expression of OBPs and CSPs in the honeybee at the protein level, using a proteomic approach. Our results are in agreement with previous reports of expression at the RNA level and show that 12 of the 21 OBPs predicted in the genome of the honeybee Apis mellifera and 2 of the 6 CSPs are present in the foragers’ antennae, while the larvae express only three OBPs and a single CSP. MALDI mass spectrometry on crude antennal extracts and MALDI profiling on sections of antennae demonstrated that these techniques can be applied to investigate individual differences in the expression of abundant proteins, such as OBPs and CSPs, as well as to detect the presence of proteins in different regions of the antenna. Finally, as part of a project aimed at the characterization of all OBPs and CSPs of the honeybee, we expressed 5 OBPs and 4 CSPs in a bacterial system and measured their affinity to a number of ligands. Clear differences in their binding spectra have been observed between OBPs, as well as CSPs. Keywords: Odorant-binding protein • Chemosensory Protein • Proteomics • Apis mellifera • MALDIMS profiling • Ligand-binding.
Introduction The honeybee, as other social insects, makes use of a complex system of chemical communication, mediating relationships between sexes, castes and colonies and regulating the specific tasks of each individuals within the community life.1,2 The chemical composition of some pheromones has been identified. The queen mandibular pheromone, a mixture of 9-keto-2-decenoic acid, 9-hydroxy-2-decenoic acid, methyl p-hydroxybenzoate and 4-hydroxy-3-methoxyphenylethanol, together with other compounds, inhibits the fertility of workers,3 the brood pheromone, a mixture of 10 esters derived from 16 and 18 carbon atoms fatty acids,4 stimulates the workers to take care of the larvae, while other volatiles, such as 2-heptanone and amyl acetate, are used as alarm pheromones.5 Other aspects of the honeybee behavior are mediated by pheromones, but not all the chemical structures of such * To whom correspondence should be addressed. Department of Agricultural Chemistry and Biotechnologies, University of Pisa, via S. Michele, 4, 56124 Pisa, Italy. Tel.: +39 050 2216626. Fax: +39 050 2216630. E-mail:
[email protected]. † University of Firenze. # These authors have equally contributed to the work. ‡ Department of Agricultural Chemistry and Biotechnologies, University of Pisa. § Department of Physiological Sciences, University of Pisa.
1822 Journal of Proteome Research 2010, 9, 1822–1833 Published on Web 02/16/2010
compounds are known. We know that honeybees are able to recognize individuals of their own family, diploid males, and sick individuals.6 Moreover, the different tasks assigned to workers during their lives are regulated by specific pheromones, yet to be identified. Such complex chemical language requires an adequately complex perception system. In fact, the genome of the honeybee7 contains 170 functional genes encoding olfactory receptors,8 sending their signals to the same number of glomeruli in the antennal lobes.9 The 170 olfactory receptor genes of the honeybee represent a much larger repertoire than the 62 reported in Drosophila melanogaster,10 the 79 of Anopheles gambiae,11 the 41 of Bombyx mori12 or the 26 of Tribolium castaneum.13 However, the number of soluble proteins, such as odorantbinding proteins (OBPs) and chemosensory proteins (CSPs)14 is unexpectedly much lower in the honeybee. Only 21 genes encode proteins similar to OBPs, of which only 13 contain the 6-cysteine signature of insect OBPs.15 The number of CSPs is even lower with six sequences exhibiting the 4-cysteine pattern.16 Previous studies have investigated OBPs and CSPs in the honeybee, both at the gene and at the protein level. A fractionation of antennal proteins from different castes and their N-terminal sequencing represented the first identification 10.1021/pr900969k
2010 American Chemical Society
research articles
Soluble Olfactory Proteins in the Honeybee 17
of OBPs in the honeybee, named antennal specific proteins, ASP1, ASP2, ASP4, ASP5 and ASP6. Later ASP1, that we shall call AmelOBP1 for homogeneity with the names of other OBPs,15 was heterologously expressed and characterized.18 Ligand-binding experiments indicated that this protein binds the two major components of queen pheromone, 9-keto-2decenoic acid and 9-hydroxy-2-decenoic acid.18 ASP2 (AmelOBP2) was similarly investigated and shown to bind several volatiles, including plant odors.20 ASP3c, instead, a member of the CSP family, renamed as AmelCSP3,17 was proposed to be involved in the perception of the brood pheromone, on the basis of the observation that it binds fatty acids of 16 and 18 carbon atoms and their methyl esters.20 Five additional CSPs were also reported and partially characterized: W-AP1 (AmelCSP1);21 AmelCG2 (AmelCSP2), CG4 (AmelCSP4), CG5 (AmelCSP5), and CG6 (AmelCSP6).22 The three-dimensional structures of AmelOBP1 and AmelOBP2 have been resolved.23,24 In particular, a recent study reported a conformational change of AmelOBP1 upon binding of the queen pheromone component 9-keto-2-decenoic acid and other ligands,25 as well as a monomer-dimer equilibrium controlled by pH.26 Similar behaviors had previously been observed with other proteins of the same family, such as the B. mori PBP27 and the A. gambiae OBP1.28 Such conformational changes associated with ligand binding support a more specific and essential role for OBPs than previously hypothesized, suggesting a direct involvement of these soluble proteins in recognition and discrimination of semiochemicals. More recent work has demonstrated that mutants of LUSH, one of the OBPs of Drosophila, can activate the olfactory receptor even in the absence of the pheromone, provided they mimic the conformation assumed by LUSH upon binding its ligand, the male pheromone vaccenyl acetate.29 In another relevant study, switching some OBP genes between two Drosophila species produced modification of their behavior toward some fatty acids.30 In the light of the new interest in the role of OBPs, stimulated by these recent studies, the number of papers on the characterization of these soluble proteins has greatly increased in the past few years. The distribution of genes encoding OBPs and CSPs in the honeybee, mapped using PCR and Northern blot, has revealed complex expression patterns with relation to tissue, sex, caste and age.15,16 Within such studies, particularly interesting is the report that at least one of the chemosensory proteins, CSP5, is not involved in chemical communication, but mediates development of the embryo.31 Therefore, the number of soluble proteins (OBPs and CSPs) active in chemosensing could be lower than the number of genes identified for these families. The small number of OBPs with respect to that of chemoreceptors, while raising challenging questions on how these two classes of proteins might interact between them and with ligands, provides, at the same time, an ideal model for a complete structural and functional study. We have therefore decided to map the expression of OBPs and CSPs at the protein level, following a proteomic approach, with the use of different mass spectrometry techniques. At the same time, we have started a characterization of these proteins in terms of ligand-binding specificities, in order to find relationships between ligands, protein expression and tasks of honeybees according to caste and age.
Materials and Methods Insects. Honeybees (Apis mellifera ligustica) were sampled in an experimental apiary of the Veterinary Faculty of the University of Pisa in the spring of 2009 and stored at -80 °C until use. Reagents. All enzymes were from New England Biolabs. Oligonucleotides were custom synthesized at Eurofins MWG GmbH, Ebersberg, Germany. All other chemicals were purchased from Sigma-Aldrich and were of reagent grade, except selected compounds used in binding assays, that were prepared along with conventional synthetic routes. RNA Extraction and cDNA Synthesis. Total RNA was extracted using TRI Reagent (Sigma), following the manufacturer’s protocol. cDNA was prepared from total RNA by reverse transcription, using 200 units of SuperScript III Reverse Transcriptase (Invitrogen) and 0.5 µg of an oligo-dT primer in a 50 µL total volume. The mixture also contained 0.5 mM of each dNTP (GE-Healthcare), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol (DTT) and 0.1 mg/mL bovine serum albumin (BSA) in 50 mM Tris-HCl, pH 8.3. The reaction mixture was incubated at 50 °C for 60 min and the product was directly used for PCR amplification or stored at -20 °C. Polymerase Chain Reaction. Aliquots of 1 µL of crude cDNA were amplified in a Bio-Rad Gene Cycler thermocycler, using 2.5 units of Thermus aquaticus DNA polymerase (GE-Healthcare), 1 mM of each dNTP (GE-Healthcare), 1 µM of each PCR primer, 50 mM KCl, 2.5 mM MgCl2 and 0.1 mg/mL BSA in 10 mM Tris-HCl, pH 8.3, containing 0.1% (v/v) Triton X-100. At the 5′ end, we used specific primers corresponding to the sequence encoding the first six amino acids of the mature protein. The primers also contained an Nde I restriction site, for ligation into the expression vector and providing at the same time the ATG codon for an additional methionine at position 1. At the 3′ end, specific primers were used, encoding the last six amino acids, followed by a stop codon and an Eco RI restriction site (a Bam HI site in the case of AmelOBP8) for ligation into the expression vector. Therefore, we used the following primers for each protein (enzyme restriction sites are underlined): fw Amel CSP1: 5′- AACATATGGAGGAACTTTATTCTGAT-3′ rv AmelCSP1: 5′-GTGAATTCTTATTATGCGCCTTCGTCTTT-3′ fwAmelCSP2: 5′-AACATATGGAGACGGAAGAAGGACAG-3′ rvAmelCSP2: 5′-GTGAATTCTTATTACGAAACTCCGGCATACTG-3′ fwAmelCSP3: 5′-AACATATGGACGAATCTTATACATC-3′ rvAmelCSP3: 5′-GTGAATTCTTATTAAACATTAATGCCGAGCTT3′ fwAmelCSP4: 5′-AACATATGGAAGACAAATACACGAC-3′ rvAmelCSP4: 5′-GTGAATTCTTATTAATAAGACTCTTCTTTAAC3′ fwAmelOBP2: 5′-AACATATGATAGATCAAGACACCGTA-3′ rvAmelOBP2: 5′AAGAATTCTTATTACGAGAACAGTTTCTCGAT3′ fwAmelOBP3: 5′-AACATATGATGGTTCGTTGTGACGAT-3′ rvAmelOBP3: 5′-AAGAATTCTTATCAAGTAGAGTTGTCGCTGCT-3′ fwAmelOBP4: 5′-AACATATGGACACGGTAGCAATTCTA-3′ rvAmelOBP4: 5′-AAGAATTCTTATTAATTTCCAGCAATCTTTTC3′ fwAmelOBP5: 5′-AACATATGGTGAAAAGTATGAGTGCC-3′ rvAmelOBP5:5′-AAGAATTCTTATCACGGGAAGAAAAACTTTTC3′ Journal of Proteome Research • Vol. 9, No. 4, 2010 1823
research articles
Dani et al.
fwAmelOBP8: 5′-AACATATGAAAAAGATGACGATCGAG-3′ rvAmelOBP8:5′-AAGGATCCTTATCATGGCGCTAAATAGAGCTC-
of other ligands was measured in competitive binding assays, using 1-NPN as the fluorescent reporter at 2 µM concentration and 2-16 µM concentrations of each competitor.
After a first denaturation step at 95 °C for 5 min, we performed 35 amplification cycles (1 min at 95 °C, 30 s. at 50 °C, 1 min at 72 °C) followed by a final step of 7 min at 72 °C. In all experiments, we obtained amplification products of 300-400 bp, in agreement with the expected sizes. Cloning and Sequencing. The crude PCR products were ligated into a pGEM (Promega) vector without further purification, using a 1:5 (plasmid/insert) molar ratio and incubating the mixture overnight, at room temperature. After transformation of Escherichia coli XL-1 Blue competent cells with the ligation products, positive colonies were selected by PCR using the plasmid’s primers SP6 and T7 and grown in LB/ampicillin medium. DNA was extracted using the kit GFX Micro Plasmid Prep (GE-Healthcare) and custom sequenced at Eurofins MWG (Martinsried, Germany). Cloning in Expression Vectors. pGEM plasmids containing the appropriate sequences were digested with Nde I and Eco RI restriction enzymes (Nde I and Bam HI for AmelOBP8) for 2 h at 37 °C and the digestion products were separated on agarose gel. The obtained fragments were purified from gel and ligated into the expression vector pET30b (Novagen, Darmstadt, Germany), previously linearized with the same enzymes. The resulting plasmids were sequenced and shown to encode the mature proteins. Preparation of the Proteins. For expression of recombinant proteins, each pET-30b vector containing the appropriate OBP or CSP sequence was used to transform BL21(DE3)pLysS E. coli cells. Protein expression was induced by addition of IPTG to a final concentration of 0.4 mM when the culture had reached a value of OD600 ) 0.8. Cells were grown for further 2 h at 37 °C, then harvested by centrifugation and sonicated. After centrifugation, CSPs were found in the supernatants, while OBPs were present as inclusion bodies. To solubilize them, the pellet from 1 L of culture was dissolved in 10 mL of 8 M urea, 1 mM DTT in 50 mM Tris buffer, pH 7.4, then diluted to 100 mL with Tris buffer and dialyzed three times against Tris buffer. Purification of the proteins was accomplished by combinations of chromatographic steps anion-exchange resins, such as DE-52 (Whatman), QFF or Mono-Q (GE-Healthcare), followed by gel filtration on Sephacryl-100 or Superose-12 (GEHealthcare) along with standard protocols previously adopted for other odorant-binding proteins.32,33 Fluorescence Measurements. Emission fluorescence spectra were recorded on a Jasco FP-750 instrument at 25 °C in a right angle configuration, with a 1 cm light path quartz cuvette and 5 nm slits for both excitation and emission. The protein was dissolved in 50 mM Tris-HCl buffer, pH 7.4, while ligands were added as 1 mM methanol solutions. Intrinsic Fluorescence. The tryptophan intrinsic fluorescence was measured on a 2 µM solution of the protein, using an excitation wavelength of 295 nm and recording the emission spectrum between 300 and 380 nm. Quenching of intrinsic fluorescence by ligands was measured in the same condition and in the presence 0-16 µM of each ligand. Fluorescence Binding Assays. To measure the affinity of the fluorescent ligand 1-NPN to each protein, a 2 µM solution of the protein in 50 mM Tris-HCl, pH 7.4, was titrated with aliquots of 1 mM ligand in methanol to final concentrations of 2-16 µM. The probe was excited at 337 nm and emission spectra were recorded between 380 and 450 nm. The affinity
For determining binding constants, the intensity values corresponding to the maximum of fluorescence emission were plotted against free ligand concentrations. Bound ligand was evaluated from the values of fluorescence intensity assuming that the protein was 100% active, with a stoichiometry of 1:1 protein/ligand at saturation. The curves were linearized using Scatchard plots. Dissociation constants of the competitors were calculated from the corresponding IC50 values, using the equation: KD ) [IC50]/[1 + [1-NPN]/K1-NPN], [1-NPN] being the free concentration of 1-NPN and K1-NPN being the dissociation constant of the complex Protein/1-NPN. Two-Dimentional Electrophoresis of Proteins. Antennae and larvae were homogenized in 1.0 mL of 1% aqueous trifluoroacetic acid (TFA) and centrifuged at 19 000g for 40 min at 4 °C. For a single 2D gel, we used 250 antennae of foragers or 10 larvae. Along with our previously described protocol,34 the obtained supernatants were concentrated to 50 µL and diluted to 400 µL with a buffer containing 7 M urea, 2 M thiourea, 2% (w/v) CHAPS, 1% (v/v) IPG buffer (GE-Healthcare) and 60 mM DTT. The samples were loaded by rehydration for 11.5 h in IPG strips (pH 3-11, 11 cm). Isoelectrofocusing was performed with an Ettan IPG Phor III system (GE-Healthcare) using the following conditions: 50 V (2 h), 100 V (2 h), 500 V (2 h), 1000 V (2 h), and 6000 V (1.5 h). About 300 µg of antennal proteins and 600 µg of larval proteins were loaded on each strip. The second-dimension electrophoresis was performed in 14% acrylamide gels using an SE 600 Ruby equipment (GE-Healthcare). Gels were stained with Brilliant Blue G-Colloidal Concentrate (Sigma). Identification of Proteins from 2-D Gel Spots. Spots of interest (in the range of 10-20 kDa) were excised from the gel and individually transferred to a 1.5 mL microcentrifuge tube. Spots were washed three times for about 10 min in 40 µL of acetonitrile and then in 40 µL of a 0.1 M ammonium bicarbonate water solution. The solution was removed and 40 µL of a 1 mg/mL of modified trypsin (Promega, Madison, WI) in 10 mM ammonium bicarbonate was added to each spot. After 40 min, the solution was removed and replaced with the same volume of 10 mM ammonium bicarbonate. After overnight digestion at 37 °C, the reaction was blocked by addition of 10% TFA and the supernatant was recovered. The peptide mixture was submitted to HPLC-ESI FTMS analysis on an Ultimate 3000 (Dionex, San Donato Milanese, Milano, Italy) coupled with an LTQ Orbitrap mass spectrometer (Thermo Fisher, Bremen, Germany). Peptides were eluted on a PepSwift monolithic PSDVB column (200 µm i.d. × 5 cm, Dionex) at 3 µL/min. The elution was obtained using a 10 min gradient from 98% of A (H2O 0.1% formic acid) to 50% B (acetonitrile 0.1% formic acid), followed by a second gradient to 90% B in 0.5 min and a final isochratic step of 2.5 min. Mass spectra were acquired in positive ion mode, setting the spray voltage at 1.8 kV, the capillary temperature at 250 °C, and the tube lens at 140 V. Data were acquired in data-dependent mode with dynamic exclusion enabled (repeat count 2); survey MS scans were recorded in the Orbitrap analyzer in the mass range 500-2000 Th at a 15 000 nominal resolution, then up to three most intense ions in each full MS scan were fragmented and analyzed in the linear ion trap.
3′
1824
Journal of Proteome Research • Vol. 9, No. 4, 2010
Monocharged ions did not trigger MS/MS experiments. The acquired data were searched using the Sequest program
research articles
Soluble Olfactory Proteins in the Honeybee
Figure 1. Two-dimensional gel electrophoretic separation of honeybee foragers’ antennae (A and B) and larvae (C). Samples of 300 µg of protein, obtained from 250 antennae and 600 µg of protein extracted from 10 larvae were loaded onto the gels. Panel A shows the complete gel of antennae, and panel B is a magnification of the low molecular weight region, where all OBPs and CSPs should be found. Panel C is a magnification of a corresponding region in the gel of larvae. Circles indicate spots that have been identified as OBPs, squares indicate CSPs. The full set of data on the identified proteins is reported in Table 1 for OBPs and CSPs and in Table S1 for other proteins.
(Thermo Fisher) against a database created by merging the sequences contained in the A. mellifera predicted peptide set generated from Amel_pre_release2_OGS_pep.fa (downloaded from BeeBase; http://www.beebase.org) together with the entries reporting the A. mellifera OBPs and CPSs in the NCBI database (September 2009). Searches were performed allowing: (i) up to four missed cleavage sites, (ii) 10 ppm of tolerance for the monoisotopic precursor ion and 0.5 mass unit for monoisotopic fragment ions, and (iii) carbamidomethylation of cysteine and oxidation of methionine as variable modifications. For SEQUEST, we accepted peptides displaying: (i) P(pep) lower than 0.001; (ii) cross-correlation values higher than 2 for doubly charged, 2.5 for triply and 3.0 for quadruply charged ions; and (iii) percent ion coverage higher than 30%. In addition, a protein hit was only accepted if: (i) at least two spectra were obtained representing two distinct peptides, (ii) displayed a protein probability lower than 0.001, and (iii) the consensus score was higher than 15. Since a blank analysis was run between samples obtained from digested protein spots, proteins identified in blank analyses were discarded from the list of proteins found in the following run. Each protein sequence identified from the A. mellifera protein set showing a compatible MW (between 10 and 20 kDa) and different from OBPs and CSPs was submitted to a BLAST search to identify homologous proteins from other insect species (Supporting Information Table S1). MALDI Mass Spectrometry on Tissue Extracts. Proteins extracts obtained from antennae were analyzed on a MALDI-
TOF/TOF mass spectrometer Ultraflex III (Bruker Daltonics, Bremen, Germany) by using Flex Control 3.0 as data acquisition software. A 1 µL volume of the sample was mixed with 1 µL of the matrix (sinapinic acid 10 mg/mL in CH3CN/H2O, 0.1% TFA, 70:30) on the target and allowed to dry. Spectra were acquired in linear mode over the m/z range 5000-20 000 for a total of 500 shots. The instrumental parameters were chosen by setting ion source 1 at 25 kV, ion source 2 at 23.45 kV, lens at 6.0 kV and pulsed ion extraction at 80 ns. The instrument was externally calibrated prior to analysis using the Bruker Protein I calibrant standard kit (5000-17 000 Da).35 MALDI Profiling. The same MALDI TOF istrument and the same parameters were used in the experiments of MALDI profiling, except for the pulsed ion extraction time which was set at 100 ns. Single antennomers were laid directly on the target and 1 µL of matrix solution was readily deposited on them. This allowed antennae to stick to the target.
Results and Discussion Proteomic Analysis. To detect the presence of OBPs and CSPs in crude extracts of the honeybee and verify whether all the genes reported to be transcribed15,16 were also translated, we applied a proteomic approach to selected samples, crude extracts of foragers’ antennae and whole larvae. Figure 1 shows the 2D gel of antennae, together with an enlargement of the low molecular weight region. The figure also reports an enlargement of the same region from a 2D gel obtained with a crude extract of 72 h-old larvae. The results from mass spectrometry analysis relative to those spots identified as OBPs or CSPs in both gels are reported in Table 1. Journal of Proteome Research • Vol. 9, No. 4, 2010 1825
research articles
Dani et al. a
Table 1. Identification of OBPs and CSPs in the 2D Gels of A. mellifera Foragers’ Antennae and Larvae spot number
1 4 4 4 4 5 7 8 9 11 11 12 12 14 16 16 17 17 17 18 18 18 21 24 24 24 25 38 39 43
4 6
1826
NCBI accessionnumberb
name
coveragec
no. of peptides
Foragers Antennae 13 39-51; 57-123 (64%)
NP_001011591 (GB20134) NP_001035297 (DQ435334) NP_001035295 (DQ435333) NP_001071288 (GB17875) NP_001011591 (GB20134) NP_001071288 (GB17875) NP_001035298 (DQ435332) NP_001011583 (GB18819) NP_001011583 (GB18819) NP_001035295 (DQ435333) NP_001011591 (GB20134) NP_001035296 DQ435338 NP_001035295 (DQ435333) NP_001011588 AF393497 NP_001035295 (DQ435333) NP_001011590 AF393494 NP_001035295 (DQ435333) NP_001011589 AF393495 NP_001011591 (GB20134) NP_001035296 DQ435338 NP_001035317 DQ435335 NP_001035295 (DQ435333) NP_001035313 DQ435331 NP_001035299 DQ435336 NP_001035296 DQ435338 NP_001035299 DQ435337 NP_001035299 DQ435336 NP_001035295 (DQ435333) NP_001035316 DQ435328 NP_001011583 (GB18819)
OBP2
CSP3
11
NP_001035298 (DQ435332) NP_001011583 (GB18819)
OBP15
12
P (pro)
consensus score
1.2e-14
170.4
OBP17
9
8-102 (80%)
4.4e-15
114.3
OBP16
4
51-98 (40%)
6.7e-15
40.2
CSP1
5
1-57 (59%)
2.2e-15
50.3
OBP2
2
63-90 (23%)
3.4e-5
20.2
CSP1
6
1-58; 82-91 (70%)
2.2e-15
70.3
13
1-10; 19-52; 68-118 (79%)
1.0e-30
160.4
CSP3
8
3-59; 74-95; 98-111 (85%)
1.8e-14
100.3
CSP3
9
3-59; 74-95; 98-111 (85%)
4.4e-15
110.3
OBP16
8
7-118 (95%)
1.0e-30
156.4
OBP2
5
9-51; 58-123 (88%)
1.3e-14
50.3
OBP21
15
1-101; 109-118 (94%)
1.0e-30
144.4
OBP16
2
26-101 (64%)
1.0e-30
50.3
OBP5
12
24-54; 58-123 (79%)
5.2e-14
196.3
OBP16
7
7-98 (78%)
1.1e-14
70.3
OBP1
2
1-19; 89-119 (42%)
1.1e-14
40.2
OBP16
4
7-25; 53-98 (55%)
1.0e-30
40.3
OBP4
14
11-83; 95-117 (82%)
3.2e-13
186.4
OBP2
2
63-90 (23%)
3.6e-9
30.3
OBP21
13
11-101 (77%)
5.3e-15
122.3
OBP18
14
1-10; 118-101 (80%)
1.0e-30
136.3
OBP16
4
7-25; 53-98 (56%)
6.7e-15
40.3
OBP14
13
9-51; 59-101 (74%)
1.0e-30
150.4
OBP19
3
17-27; 35-61; 69-99 (51%)
4.4e-15
40.3
OBP21
2
53-98 (39%)
1.8e-11
20.2
OBP20c
1
53-83 (26%)
5.7e-7
10.3
OBP19
3
17-27; 35-61 (28%)
1.1e-14
30.3
OBP16
5
7-25; 52-98 (56%)
1.3e-9
50.3
OBP11
6
24-40; 49-69; 97-124; 130-143 (55%)
1.0e-30
90.2
1-59; 74-95; 98-111 (86%)
2.2e-16
120.4
1.0e-30
140.4
1.1e-12
80.3
OBP15
CSP3
Journal of Proteome Research • Vol. 9, No. 4, 2010
8
Larvae 1-52; 69-118 (79%) 3-23; 31-59;74-95; 98-111 (85%)
research articles
Soluble Olfactory Proteins in the Honeybee Table 1. Continued spot number
8 11 20 29 30 48
NCBI accessionnumberb
name
no. of peptides
NP_001035314 DQ435330 NP_001011583 (GB18819) NP_001035313 DQ435331 NP_001035313 DQ435331 NP_001035313 DQ435331 NP_001035313 DQ435331
OBP13
24
CSP3
6
coveragec
P (pro)
consensus score
1-98; 101-115 (97%)
2.7e-14
290.3
31-59; 74-95; 98-111 (85%)
1.2e-10
60.2
OBP14
21
7-101 (81%)
1.0e-30
230.4
OBP14
18
7-101 (81%)
1.0e-30
200.4
OBP14
9
9-41; 52-101; 108-118 (79%)
1.0e-30
88.4
OBP14
6
59-101 (36%)
1.0e-30
90.4
a Names of OBPs and CSPs are as in Foreˆt and Maleszka,15 and Foreˆt et al.16 b In brackets, the code reported by Foreˆt and Maleszka15 and Foreˆt et al.16 Aminoacidic positions in the mature protein sequence after removal of signal peptide as predicted by Signal-P program. In brackets, percent of the mature protein covered. c Tentative assignment.
c
As described in Materials and Methods, each spot was digested with trypsin and the peptides so generated were separated by micro HPLC. Each peptide was then identified by comparison with those generated from the genome database, on the basis of its molecular mass and of information obtained by MS/MS experiments. Table 1 reports the number of peptides identified, the percent of sequence coverage, calculated on the mature proteins, and the reliability of the assignment, evaluated by the P-value and the consensus score. All the assignments of Table 1 are based on at least two peptides, with the sole exception of spot 24 that was tentatively assigned to OBP20 based on a single peptide. The results indicate that all the nonclassic OBPs (those presenting only four or five of the six cysteines, namely, OBPs 14-21) were present in the antennae of foragers, while only 4 of the classic OBPs could be detected, OBP1, OBP2, OBP4 and OBP5. Of the six CSPs predicted by the genome, only CSP1 and CSP3 could be identified in the antennal sample. In a similar experiment, performed with a crude extract of whole larvae, we could only detect the presence of OBP13, OBP14, OBP15 and CSP3. Other OBPs and CSPs could be expressed in specific organs of the larvae, but their concentration in the extract of whole body was too low to be detected. To identify OBPs and CSPs, we had to analyze all the spots in the low molecular weight region, thus, revealing the presence of other proteins not belonging to the olfactory system and therefore outside the interest of the present report, but nevertheless worth citing. Table S1, included as Supporting Information, reports the data relative to all the other proteins identified in the foragers’ antennae, limited to the low molecular weigth region (12-20 kDa). It is interesting to observe that OBP13 is present in the larvae, but not in the foragers’ antennae. Likewise, other OBPs and CSPs, that we failed to identify in our samples, could be expressed in other castes or at different ages or in different organs. A comparison of our findings with the expression patterns reported by Foˆret and coauthors15,16 shows good, although not complete agreement between our protein data and their results at the RNA level. In particular, in the foragers’ antennae, RNA was found at high concentration for OBPs 1, 2, 4, 8, 11, 16, 19, 20, 21 and at lower concentration for OBPs 5, 14, 15, 17, 18. We have found OBPs 1, 2, 4, 5, and 11 among the classic OBPs, but failed to identify OBPs 8. However, we could detect the presence of OBP8 in the foragers’ antennae, using specific
antibodies, that we prepared against the recombinant protein, in Western blot experiments (data not shown). Among the nonclassic OBPs, we found good evidence of all of them in our 2D gels, except for OBP20, whose tentative assignment was based on a single peptide, in agreement with RNA transcription data of Foˆret and Maleszka.15 In the larvae, we also found complete agreement with the RNA data of the same authors.15 Concerning CSPs, the most abundant RNA trascripts were those of CSPs 1 and 3 in the foragers’ antennae, that of CSP3 in the larvae, in agreement with our protein data.16 In some cases, we found more than one spot that could be assigned to the same protein, as for OBP2, occurring in spots 1, 4, 11 and 17, or OBP16 detected in spots 11 and 12. Most reasonably, this phenomenon could be due to limited degradation of the protein, either physiological or as a result of manipulation, giving rise to truncated forms of lower molecular weight, but also of different isoelectric points, in the cases where the lost fragments contained charged residues. In the specific case of CSP3, occurring in spots 8 and 43, this phenomenon could be explained with the presence of mature proteins generated by cleavage of the signal peptide at different positions. The CSP3 of spot 8 could be the result of proteolytic digestion between positions 21 and 22 of the full frame sequence, that of spot 43 could contain at its N-terminus the two additional amino acids arginine and methionine. The presence of arginine in this form of the protein could explain the higher isoelectric point observed on the gel for spot 43. In fact, the calculated isoelectric points of these two forms of CSP3 are 5.8 and 6.8, respectively, in agreement with the positions of the two spots on the 2D gel. This hypothesis is also suggested by the observation that the mature protein is predicted by the program SignalP to start at position 20 of the full-length sequence, while a comparison with the sequences of OBPs of other insect species indicates Asp22 as most likely starting residue of the mature protein. In a second series of experiments, we applied mass spectrometry analytical techniques to crude extracts of antennae of queens, foragers, newly emerged workers and drones. Figure 2 shows the MALDI-MS spectra obtained with the above samples. OBPs 1, 2 and 16, together with CSP1, were found in all the specimens, with the exception of OBP2 that was absent in the queens. We could also detect a signal corresponding to the molecular mass of OBP21 only in the foragers’ antennae. The relative intensities of the peaks corresponding to these proteins were markedly different in the four spectra reported. Journal of Proteome Research • Vol. 9, No. 4, 2010 1827
research articles
Dani et al.
Figure 2. MALDI-TOF mass spectra of crude extracts from antennae of (A) males, (B) virgin queens, (C) newly emerged workers, (D) foragers. Peaks were tentatively assigned to proteins on the basis of molecular weight. Agreement between measured and calculated values was always within 5 mass units. In particular, the observed mass of OBP1 in most samples corresponded to the molecular weight of the oxidized protein. CSP1, OBP1 and OBP16 are present in all four samples, but in different relative amounts. OBP2 is lacking in the virgin queens, while OBP21 could be detected only in the foragers’ antennae.
The small number of proteins revealed in this analysis with respect to the much larger number of OBPs and CSPs identified in the 2D gel is due to the different protocol used. While in the 2D gel we analyzed a sample obtained from 250 antennae, the MALDI spectra here described were generated by samples corresponding to less than a single antenna. We then investigated the feasibility to analyze pieces of tissues from single individuals, performing MALDI profiling experiments on single antennomers directly deposited onto the MALDI sample plate. Figure 3 shows the results obtained with the most distal antennomer and the scape. The two spectra show good signals with different expression patterns of proteins. In particular, CSP1 and several OBPs can be easily detected in the first spectrum, while none of these proteins are present in the scape. These results indicate that such method is sensitive enough to detect differences in the expression of the same protein along the antenna or in different regions of other tissues. The sensitivity of MALDI-TOF applied to the protein extracts and to profiling experiments, however, appears to be lower than the classical proteomic approach, revealing only the most abundant proteins. Nevertheless, MALDI-MS analysis can be applied to protein extracts prepared from single specimens or to profile single antennae or antennomers, thus, being suitable for detecting individual differences, besides being extremely simple and rapid. Expression of OBPs and CSPs. The second aspect of our ongoing investigation on the role of OBPs and CSPs involves a structural and functional study of each of these proteins, particularly with regard to their ligand-binding properties. As 1828
Journal of Proteome Research • Vol. 9, No. 4, 2010
a first step toward this goal, therefore, we decided to express some OBPs and CSPs in a bacterial system and use them in ligand-binding experiments. For this purpose, we selected OBPs 2, 3, 4, 5, and 8. Of these, OBPs 2, 4, and 5 were identified both at the RNA level and as proteins in the foragers’ antennae, OBP8 was reported as strongly expressed in Northern blot experiments, but was not detectable in the 2D gels, while OBP3 was reported to be transcribed in some tissues other than common sensory organs, such as cuticle, thorax and fat bodies.16 As for CSPs, we selected all of them, except for CSP5, that was clearly shown to be involved in embryo development and CSP6, whose RNA was reported mainly in early developmental stages.15 We used a construct encoding the mature protein with the only addition of an initial methionine, as described in Materials and Methods. The recombinant CSPs were expressed in their soluble forms, while OBPs, as we already observed with those of most insect species, were produced as inclusion bodies and had to be denatured and renatured in order to obtain them in soluble form. Such process, however, has been demonstrated in several cases to afford the OBPs in their native folding, with the six cysteines correctly paired.32,36–38 Figure 4 shows two examples (one OBP and one CSP) of the electrophoretic analysis of crude bacterial pellets containing the recombinant proteins and some steps of their purification. All the proteins were highly expressed with yields of 10-30 mg/L of bacterial culture. Purification of the solubilized proteins followed standard protocols, involving anion-exchange chromatography on resins such as DE-52 (Whatman), QFF and Mono-Q (GEHealthcare) combined with gel filtration on Sephacryl-100 or Superose-12 (GE-Healthcare). The purity of the final protein
Soluble Olfactory Proteins in the Honeybee
research articles
Figure 3. MALDI Profiling on antennae of foragers. The last antennomer (A) and cross-section slices of the scape (B) were laid on the MALDI target and applied with the matrix (sinapinic acid). CSP1 and several OBPs were identified in the first sample, based on their molecular weight, while no member of either class of these proteins could be detected in the scape.
DNA in the samples. The identity of the recombinant proteins was verified measuring their molecular weight by MALDI-MS.
Figure 4. Expression and purification of OBPs and CSPs. Selected OBPs and CSPs were expressed in bacterial systems and purified by combinations of chromatographic steps in ion-exchange chromatography and gel filtration. The figure reports the SDSPAGE analysis relative to two typical examples, one for OBPs, the other for CSPs. While CSPs were obtained in soluble form, OBPs were synthesized as inclusion bodies and had to be denatured and renatured before purification.
The purified proteins were then used in ligand-binding experiments to map their specificities toward common organic compounds. We first measured the affinity to the fluorescent probe N-phenyl-1-naphthylamine (1-NPN), a ligand that proved efficient for most OBPs and CSPs of insects. The emission spectrum of this compound, upon binding the protein, undergoes a major change, with a shift of its maximum from 480 nm to about 405-410 nm, and a strong increase in intensity, thus, allowing reliable measurements of the bound ligand in the presence of free ligand. The binding curves of recombinant OBPs and CSPs are reported in the top left panels of Figure 5 for OBPs and Figure 6 for CSPs. All the proteins tested, with the only exception of CSP4, could bind the fluorescent probe 1-NPN with dissociation constants in the micromolar range, as most OBPs and CSPs of other insect species. The fact that CSP4 did not show any spectral change in the presence of 1-NPN could indicate either that 1-NPN does not bind this protein or that the binding is not associated with any spectral change.
samples was monitored by SDS-PAGE, as well as by measuring their absorbance at 280 and 260 nm to verify the absence of
To evaluate the affinity of other chemicals to the proteins, we used 1-NPN at a fixed concentration and titrated the protein/1-NPN complex with increasing amounts of each Journal of Proteome Research • Vol. 9, No. 4, 2010 1829
research articles
Dani et al.
Figure 5. Binding of selected ligands to some recombinant OBPs of A. mellifera. (Top left panel) Binding curves of 1-NPN and Scatchard plots (inset). A 2 µM solution of the protein in Tris was titrated with 1 mM solution of 1-NPN in methanol to final concentrations of 2-16 µM. Dissociation constants (average of three replicates) were OBP2, 5.02 µM (SD 0.61); OBP3, 5.23 µM (SD 1.09); OBP4, 2.08 µM (SD 0.19); OBP5, 1.78 µM (SD 0.31); OBP8, 5.35 µM (SD 0.61). The other panels report binding of the best ligands for each protein measured in competition assays. A mixture of the protein and 1-NPN in Tris, both at the concentration of 2 µM, was titrated with 1 mM solutions of each competing ligand to final concentrations of 2-16 µM. Fluorescence intensities are reported as percent of the values in the absence of competitor. The calculated dissociation constants for all the ligands used are listed in Supporting Information Table S2.
potential ligand, measuring the percent of fluorescence displaced by the ligand. The other panels of Figures 5 and 6 show typical results of these experiments, limited for each protein to its best ligands. The full set of data, with the calculated 1830
Journal of Proteome Research • Vol. 9, No. 4, 2010
dissociation constants, is reported in Table S2. For CSP4, that did apparently bind 1-NPN, we evaluated the affinity of some aromatic compounds by measuring the quenching of the intrinsic protein fluorescence due to a tryptophan residue
Soluble Olfactory Proteins in the Honeybee
research articles
Figure 6. Binding of selected ligands to some recombinant CSPs of A. mellifera. (Top left panel) Binding curves of 1-NPN and Scatchard plots (inset). A 2 µM solution of the protein in Tris was titrated with 1 mM solution of 1-NPN in methanol to final concentrations of 2-16 µM. Dissociation constants (average of three replicates) were CSP1, 1.23 µM (SD 0.28); CSP2, 4.73 µM (SD 0.29); CSP3, 4.0 µM (SD 0.26). The other panels report binding of the best ligands for each protein to the same CSPs measured in competition assays. A mixture of the protein and 1-NPN in Tris, both at the concentration of 2 µM, was titrated with 1 mM solutions of each competing ligand to final concentrations of 2-16 µM. Fluorescence intensities are reported as percent of the values in the absence of competitor. The calculated dissociation constants for all the ligands used are listed in Table S2. For CSP4, that did not produce any change in the fluorescence spectrum of 1-NPN, the binding of some aromatic ligands was evaluated by quenching of the intrinsic fluorescence of the protein, relative to a tryptophan residue located inside the binding pocket. The right bottom panel reports the dissociation constants of homologous series of linear alcohols and esters to CSP1 and CSP3. For both proteins, the best ligand is 1-tridecanol, but CSP3 appears to be much more selective than CSP1. Journal of Proteome Research • Vol. 9, No. 4, 2010 1831
research articles located inside the binding pocket. This residue is present in most of OBPs and CSPs of insects and represents a useful tool for investigating the ligand binding site. All five OBPs taken into account in our study exhibit good affinity to large molecules, often containing two aromatic rings. The only clear exception is OBP8, that seems to prefer terpenoids such as retinal and retinol, besides some synthetic elongated diazo compounds of similar size. OBP2, that, using different ligandbinding methods, had been reported to show affinity for plant odorants of different nature,18 and in our experiments also binds several chemicals with no apparent clear discrimination. Many of the ligands used are synthetic chemicals, that do not suggest relationships between each OBP and known pheromone components of the honeybee. However, these data provide the stereochemical requirements of the binding pocket for each protein and can be useful for modeling the interactions between protein and ligands. The four CSPs investigated show different binding spectra. Particularly interesting is the behavior of CSP1, that binds straight-chain primary alcohols and esters, with a maximum of activity around 12-14 carbon atoms. Such compounds do not include pheromone components of the honeybee, but some of them have been identified in pheromones of other insects, including species of the Apidae family.39–43 In the bottom rigth panel of Figure 6, the dissociation constants of complexes between homologous series of primary alcohols and esters with CSP1 are plotted against the number of carbon atoms. A clear trend is apparent, with a minimum corresponding to 13 carbon atoms. CSP3 also shows a similar trend, but appears to be much more specific than CSP1, showing strong affinity only for 1-tridecanol. In fact, the dissociation constants of 1-tetradecanol and 1-dodecanol are much higher, while other alcohols of the series, as well all the tested esters of similar size failed to show appreciable binding. This protein had previously been reported to bind methyl esters of 16 and18 carbons fatty acids, components of the brood pheromone20 and suggested to be involved in the perception of this pheromone. CSP2, instead, binds a spectrum of compounds more similar to the large aromatic molecules found to be good ligands for the five OBPs, such as p-tert-butylbenzophenone and 4-hydroxy-4′-isopropylazobenzene. CSP4 also appears different from the other CSPs in terms of ligand binding. Although it was not possible to perform competitive binding assays, because the fluorescence spectrum of 1-NPN does not change in the presence of the protein, we were able to evaluate the relative strength of some ligands, measuring the quenching of the intrinsic tryptophan fluorescence produced by the presence in the binding pocket of compounds able to absorb some of the emitted light. The results show that terpenoids, such as β-ionone and retinol are among the best ligands. Such approach, however, cannot provide quantitative data, nor a fine comparison between different ligands. In fact, the quenching effect observed depends both on the absorbance of the ligand at the wavelength of the emitted fluorescence (around 330 nM) and on the proximity of the ligand’s chromophore to the tryptophan residue.
Conclusions This work presents for the first time a complete account at the protein level of the expression of the OBPs and CSPs predicted by the genome, although limited to workers (foragers’ antennae and larvae). The results are in agreement with previous reports at the RNA level and indicate that a proteomic 1832
Journal of Proteome Research • Vol. 9, No. 4, 2010
Dani et al. approach can be applied to soluble proteins of chemoreception in these insects. The presence of the same protein in more than one spot, observed in certain cases, is most likely the result of proteolytic degradation occurring during manipulation of the samples, but we cannot exclude that physiologically important protein modifications could be responsible for such phenomenon. Again, the proteomic approach here described is suitable and will be adopted for looking into such aspects. MALDI mass spectrometry, applied to crude extracts of antennae, as well as used directly on parts of the antennae, represents a powerful tool for investigating individual differences in the expression of OBPs and CSPs, as well as their distribution along the antenna or in different areas of the same organ. Although such technique can reveal the presence of only the most abundant proteins, it offers the advantage of being simple and fast, therefore, suitable for screening a large number of samples. The binding experiments, performed with a selection of OBPs and CSPs, represent a first step toward mapping the ligand specificities of all OBPs and CSPs, in order to decipher the olfactory code of the honeybee. So far, differences have been observed between the proteins utilized, particularly with CSPs, supporting a role of these proteins in chemoreception. On the basis of such observation, as well as on the evidence that some CSPs are clearly involved in other functions, we can reasonably regard CSPs as a superfamily of proteins, including members mediating chemoreception, as well as others involved in different physiological functions.
Acknowledgment. We thank Francesca Boscaro and Elena Michelucci for technical assistance during LC-MS analyses. Research partly supported by a PRIN Project, MIUR, Italy. Supporting Information Available: Tables of dissociation constants (micromolar) of various ligands to OBPs and CSPs; identification of proteins other than OBPs and CSPs, relative to spots in the low molecular weight region of the foragers’ 2D gel. Replicates of 2D gel of a crude antennal extract of forager honeybees; Replicates of 2D gel of a crude whole honeybee larvae. This material is available free of charge via the Internet at http://pubs.acs.org. References (1) Wilson, E. O. The Insect Societies. Belknap Press of Harvard University Press, Cambridge, MA, 1971. (2) Slessor, K. N.; Winston, M. L.; Le Conte, Y. Pheromone communication in the honeybee (Apis mellifera L.). J. Chem. Ecol. 2005, 31, 2731–2745. (3) Slessor, K. N.; Kaminski, L.-A.; King, G. G. S.; Borden, J. H.; Winston, M. L. Semiochemical basis of the retinue response to queen honey bees. Nature 1988, 332, 354–356. (4) Le Conte, Y.; Arnold, G.; Trouiller, J.; Masson, C. Identification of a brood pheromone in honeybees. Naturwissenschaften 1990, 77, 334–336. (5) Moritz, R. F. A.; Burgin, H. Group response to alarm pheromones in socialwasps and the honeybees. Ethology 1987, 76, 15–26. (6) Swanson, J. A.; Torto, B.; Kells, S. A.; Mesce, K. A.; Tumlinson, J. H.; Spivak, M. Odorants that induce hygienic behavior in honeybees: identification of volatile compounds in chalkbrood-infected honeybee larvae. J. Chem. Ecol. 2009, 35, 1108–1116. (7) Honeybee Genome Sequencing Consortium. Insights into social insects from the genome of the honeybee Apis mellifera. Nature 2006, 443, 931–949. (8) Robertson, H. M.; Wanner, K. W. The chemoreceptor superfamily in the honey bee, Apis mellifera: Expansion of the odorant, but not gustatory, receptor family. Genome Res. 2006, 16, 1395–1403.
research articles
Soluble Olfactory Proteins in the Honeybee (9) Galizia, C.; McIlwrath, S.; Menzel, R. A digital three-dimensional atlas of the honeybee antennal lobe based on optical sections acquired by confocal microscopy. Cell Tissue Res. 1999, 295, 383– 394. (10) Robertson, H. M.; Warr, C. G.; Carlson, J. R. Molecular evolution of the insect chemoreceptor gene superfamily in Drosophila melanogaster. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 14537–14542. (11) Hill, C. A.; Fox, A. N.; Pitts, R. J.; Kent, L. B.; Tan, P. L.; Chrystal, M. A.; Cravchik, A.; Collins, F. H.; Robertson, H. M.; Zwiebel, L. J. G protein-coupled receptors in Anopheles gambiae. Science 2002, 298, 176–178. (12) Wanner, K. W.; Anderson, A. R.; Trowell, S. C.; Theilmann, D. A.; Robertson, H. M.; Newcomb, R. D. Female-biased expression of odourant receptor genes in the adult antennae of the silkworm Bombyx mori. Insect Mol. Biol. 2007, 16, 107–119. (13) Abdel-latief, M. A. Family of Chemoreceptors in Tribolium castaneum (Tenebrionidae: Coleoptera). PLoS One. 2007, 2, e1319. (14) Pelosi, P.; Zhou, J.-J.; Ban, L. P.; Calvello, M. Soluble proteins in insect chemical communication. Cell. Mol. Life Sci. 2006, 63, 1658– 1676. (15) Foreˆt, S.; Maleszka, R. Function and evolution of a gene family encoding odorant binding-like proteins in a social insect, the honey bee (Apis mellifera). Genome Res. 2006, 16, 1404–1413. (16) Foreˆt, S.; Wanner, K. W.; Maleszka, R. Chemosensory proteins in the honey bee: Insights from the annotated genome, comparative analyses and expressional profiling. Insect Biochem. Mol. Biol. 2006, 37, 19–28. (17) Danty, E.; Arnold, G.; Huet, J. C.; Huet, D.; Masson, C.; Pernollet, J. C. Separation, characterization and sexual heterogeneity of multiple putative odorant-binding proteins in the honeybee Apis mellifera L. (Hymenoptera: Apidae). Chem. Senses 1998, 23, 83– 91. (18) Danty, E.; Briand, L.; Michard-Vanhee, C.; Perez, V.; Arnold, G.; Gaudemer, O.; Huet, D.; Huet, J. C.; Ouali, C.; Masson, C.; Pernollet, J. C. Cloning and expression of a queen pheromone-binding protein in the honeybee: an olfactory-specific, developmentally regulated protein. J. Neurosci. 1999, 19, 7468–7475. (19) Briand, L.; Nespoulous, C.; Huet, J. C.; Takahashi, M.; Pernollet, J. C. Ligand binding and physico-chemical properties of ASP2, a recombinant odorant-binding protein from honeybee (Apis mellifera L.) . Eur. J. Biochem. 2001, 268, 752–760. (20) Briand, L.; Swasdipan, N.; Nespoulous, C.; Bezirard, V.; Blon, F.; Huet, J.-C.; Ebert, P.; Pernollet, J. C. Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier. Eur. J. Biochem. 2002, 269, 4586– 4596. (21) Kamikouchi, A.; Morioka, M.; Kubo, T. Identification of honeybee antennal proteins/genes xpressed in a sex- and/or caste selective manner. Zool. Sci. 2004, 21, 53–62. (22) Wanner, K. W.; Willis, L. G.; Theilmann, D. A.; Isman, M. B.; Feng, Q.; Plettner, E. Analysis of the insect OS-D-like gene family. J. Chem. Ecol. 2004, 30, 889–911. (23) Lartigue, A.; Gruez, A.; Briand, L.; Blon, F.; Be´zirard, V.; Walsh, M.; Pernollet, J. C.; Tegoni, M.; Cambillau, C. Sulfur singlewavelength anomalous diffraction crystal structure of a pheromonebinding protein from the honeybee Apis mellifera L. J. Biol. Chem. 2004, 279, 4459–4464. (24) Lescop, E.; Briand, L.; Pernollet, J. C.; Van Heijenoort, C.; Guittet, E. 1H, 13C and 15N chemical shift assignment of the honeybee odorant-binding protein ASP2. J. Biomol. NMR 2001, 21, 181–182. (25) Pesenti, M. E.; Spinelli, S.; Bezirard, V.; Briand, L.; Pernollet, J. C.; Tegoni, M.; Cambillau, C. Structural basis of the honey bee PBP pheromone and pH-induced conformational change. J. Mol. Biol. 2008, 380, 158–169.
(26) Pesenti, M. E.; Spinelli, S.; Bezirard, V.; Briand, L.; Pernollet, J. C.; Campanacci, V.; Tegoni, M.; Cambillau, C. Queen bee pheromone binding protein pH-induced domain swapping favors pheromone release. J. Mol. Biol. 2009, 390, 981–990. (27) Horst, R.; Damberger, F.; Luginbuhl, P.; Guntert, P.; Peng, G.; Nikonova, L.; Leal, W. S.; Wuthrich, K. NMR structure reveals intramolecular regulation mechanism for pheromone binding and release. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 14374–14379. (28) Wogulis, M.; Morgan, T.; Ishida, Y.; Leal, W. S.; Wilson, D. K. The crystal structure of an odorant binding protein from Anopheles gambiae: evidence for a common ligand release mechanism. Biochem. Biophys. Res. Commun. 2005, 339, 157–164. (29) Laughlin, J. D.; Ha, T. S.; Jones, D. N. M.; Smith, D. P. Activation of pheromone-sensitive neurons is mediate by conformational activation of Pheromone-binding protein. Cell 2008, 133, 1255– 1265. (30) Matsuo, T.; Sugaya, S.; Yasukawa, J.; Aigaki, T.; Fuyama, Y. OdorantBinding Proteins OBP57d and OBP57e Affect Taste Perception and Host-Plant Preference in Drosophila sechellia. PLoS Biol. 2007, 5, e118. (31) Maleszka, J.; Foret, S.; Saint, R.; Maleszka, R. RNAi-induced phenotypes suggest a novel role for a chemosensory protein CSP5 in the development of embryonic integument in the honeybee (Apis mellifera). Dev. Genes Evol. 2007, 217, 189–196. (32) Ban, L. P.; Scaloni, A.; Brandazza, A.; Angeli, S.; Zhang, L.; Yan, Y. H.; Pelosi, P. Chemosensory proteins of Locusta migratoria. Insect Mol. Biol. 2003, 12, 125–134. (33) Calvello, M.; Guerra, N.; Brandazza, A.; D’Ambrosio, C.; Scaloni, A.; Dani, F. R.; Turillazzi, S.; Pelosi, P. Soluble proteins of chemical communication in the social wasp Polistes dominulus. Cell. Mol. Life Sci. 2003, 60, 1933–1943. (34) Scarselli, R.; Donadio, E.; Giuffrida, M. G.; Fortunato, D.; Conti, A.; Balestreri, E.; Felicioli, R.; Pinzauti, M.; Sabatini, A. G.; Felicioli, A. Towards royal jelly proteome. Proteomics 2005, 5, 769–776. (35) Dani, F. R.; Francese, S.; Mastrobuoni, G.; Felicioli, A.; Caputo, B.; Simard, F.; Pieraccini, G.; Moneti, G.; Coluzzi, M.; Della Torre, A.; Turillazzi, S. Exploring proteins in Anopheles gambiae male and female antennae through MALDI mass spectrometry profiling. PLoS One 2008, 3, e2822. (36) Prestwich, G. D. Bacterial expression and photoaffinity labeling of a pheromone binding protein. Protein Sci. 1993, 2, 420–428. (37) Plettner, E.; Lazar, J.; Prestwich, E. G.; Prestwich, G. D. Discrimination of pheromone enantiomers by two pheromone binding proteins from the gypsy moth Lymantria dispar. Biochemistry. 2000, 39, 8953–8962. (38) Kruse, S. W.; Zhao, R.; Smith, D. P.; e Jones, D. N. Structure of a specific alcohol-binding site defined by the odorant binding protein LUSH from Drosophila melanogaster. Nat. Struct. Biol. 2003, 10, 694–700. (39) Svensson, B. G.; Bergstro¨m, G. Marking pheromones of Alpinobombus males. J. Chem. Ecol. 1979, 5, 603–615. (40) Whitten, W. M.; Young, A. M.; Stern, D. L. Nonfloral sources of chemicals that attract male euglossine bees (Apidae: Euglossini). J. Chem. Ecol. 1993, 19, 3017–3027. (41) Bertsch, A.; Schweer, H.; Titze, A.; Tanaka, H. Male labial gland secretions and mitochondrial DNA markers support species status of Bombus cryptarum and B. magnus (Hymenoptera, Apidae). Insectes Soc. 2005, 52, 45–54. (42) Calam, D. H. Species and sex-specific compounds from the heads of male bumblebees (Bombus spp.). Nature 1969, 221, 856–857. (43) Kullenberg, B.; Bergstro¨m, G.; Sta¨llberg-Stenhagen, S. Volatile components of the marking secretion of male bumblebees. Acta Chem. 1970, 24, 1481–1483.
PR900969K
Journal of Proteome Research • Vol. 9, No. 4, 2010 1833
