Measuring RNA-Ligand Interactions with Microscale Thermophoresis

Subscriber access provided by READING UNIV

From the Bench

Measuring RNA-Ligand Interactions with Microscale Thermophoresis Michelle H. Moon, Thomas Hilimire, Allix M. Sanders, and John S Schneekloth, Jr. Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.7b01141 • Publication Date (Web): 12 Jan 2018 Downloaded from http://pubs.acs.org on January 12, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Measuring RNA-Ligand Interactions with Microscale Thermophoresis Michelle H Moon1‡, Thomas A Hilimire1‡, Allix M Sanders1, John S Schneekloth Jr.1* Chemical Biology Laboratory, National Cancer Institute, Frederick, Maryland 21702, United States

*Tel.: 301-228-4620 E-mail: [email protected]

ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT In recent years, there has been a dramatic increase in the study of RNA. RNA has gone from being known as an intermediate in the central dogma of molecular biology to a molecule with a large diversity of structure and function that is involved in all aspects of biology. As new functions are rapidly discovered, it has become clear that there is a need for RNA-targeting small molecule probes to investigate RNA biology and clarify the potential for therapeutics based on RNA/small molecule interactions. While a host of techniques exist to measure RNA/small molecule interactions, many of these have drawbacks that make them intractable for routine use and are often not broadly applicable. A newer technology called microscale thermophoresis (MST), which measures the directed migration of a molecule and/or molecule ligand complex along a temperature gradient, can be used to measure binding affinities using very small amounts of sample. The high sensitivity of this technique enables measurement of affinity constants in the nanomolar and micromolar range. Here, we demonstrate how MST can be used to study a range of biologically relevant RNA interactions, including peptide/RNA interactions, RNA/small molecule interactions, and displacement of an RNA bound peptide by a small molecule.


Page 2 of 16

Page 3 of 16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

INTRODUCTION Historically, it was believed that the role of RNA was limited to coding for protein sequences and facilitating protein biogenesis via the ribosome.

However, it has become

apparent that RNA is diverse in both function and structure, controlling many areas of cellular homeostasis and disease. RNA can regulate many aspects of biology by changing transcription or translation through a variety of mechanisms ranging from silencing of genes with miRNA in mammals,1 causing translation inhibition or transcription termination by a bacterial riboswitch binding a small molecule,2 or catalysis by ribozymes3. RNA has also been implicated in many diseases such as repeat expansions found in myotonic dystrophy4, infections from RNA viruses, or mutations in mRNA that can cause changes in splicing that result in aberrant proteins.5 Considering the recent advances in RNA biology, small molecules capable of modulating RNA function would be beneficial as chemical probes and/or inhibitors with potential impact as therapeutics.6-8

Figure 1. Raw MST data. A fluorescently tagged molecule is observed for 5 seconds at which point an IR laser is turned on, heating a small area of a capillary by 2-5 °C. The molecule migrates along the heat gradient resulting in a change in fluorescence intensity. After the IR laser is turned off, molecules back diffuse along their concentration gradient.

Many biophysical techniques that were originally designed to probe interactions involving proteins or DNA have been repurposed successfully for studying RNA/small molecule interactions, but often have drawbacks. Some commonly used techniques employed to date are 2-aminopurine fluorescence, fluorescence anisotropy, electrophoretic mobility shift assays (EMSA), nuclear magnetic resonance (NMR), surface plasmon resonance (SPR), and isothermal titration calorimetry (ITC). A recent thorough review discusses the uses and limitations of these and other techniques with respect to RNA.9


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 16

To overcome the limitations of the standard techniques, we turned to microscale thermophoresis (MST) to investigate RNA/small molecule interactions. MST functions by gently heating a capillary containing a solution of a fluorescently labeled molecule with an IR laser to generate a temperature gradient of approximately 2-5 °C. Molecules migrate along the temperature gradient as a function of hydrodynamic radius, charge, and solvation by what is known as the thermophoretic effect.10 By labeling a biomolecule such as a protein, DNA, or RNA with a suitable fluorophore, the migration of the molecule along this gradient is easily monitored (Figure 1).

Biomolecules may be labeled with any fluorophore with excitation

wavelengths compatible with lasers in the instrument, and commonly used fluorophores such as those based on cyanine and rhodamine scaffolds perform well. To prevent interaction of the fluorophore with the binding interface, generally the macromolecule is end labeled. However, labeling in other locations can be pursued as each system dictates. Interactions with ligands cause significant changes in the migration of the biomolecule-ligand complex with respect to the unbound biomolecule and these changes can be used to derive equilibrium binding constants. The origin of the thermophoretic effect is governed by the Soret coefficient which has been reviewed in detail.10,

11

Since thermophoresis is dependent on multiple parameters, it can be

more sensitive than other biophysical techniques. Furthermore, MST has previously been shown to be a successful means to study systems such as a synthetic evolved ribozyme or fragment-based inhibitor discovery on proteins.

12, 13

In both these situations other biophysical

approaches failed while MST succeeded, further indicating its potential utility for probing therapeutically relevant RNA/ligand interactions. MST is a very cost-efficient method that involves a fluorescently labeled biomolecule at concentrations in the low nanomolar range (some reports have extended this to subnanomolar concentrations), and requires only 1 µL of sample (although 5-20 µL is typically used for practical handling).14 This technique also involves a relatively simple and efficient experimental design that can be applied to many different RNA samples in a day, requires very little training to perform, can be adapted to a high throughput automated system, and can use intrinsic fluorescence to make it label free in some cases. A recent paper offers step by step in depth review of how to perform an MST experiment.15 Finally, the recent development of commercial MST systems has made the technology more broadly accessible for general use. Here, we apply this developing technology to therapeutically important model RNA systems and show the feasibility of studying RNA/ligand interactions quantitatively with MST. MATERIALS/EXPERIMENTAL DETAILS


Page 5 of 16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

General RNA Information To avoid RNase contamination, surfaces and materials were decontaminated with RNaseZap (Ambion) and all buffers were prepared with DEPC-treated water.

The following deprotected and HPLC purified oligonucleotides were purchased from Dharmacon or IDT DNA: DY647-labeled RRE SL IIB RNA: 5′-DY647-CGCUGGGCGCAGUGUCAUUGACGCUGACGGUACAGCG

RRE SL IIB RNA: CGCUGGGCGCAGUGUCAUUGACGCUGACGGUACAGCG Cy5-labeled B. Subtilis PreQ1 Riboswitch RNA: 5′-Cy5-AGAGGUUCUAGCUACACCCUCUAUAAAAAACUAA-3'

Alexa Fluor 647-labeled T. Tengcongensis PreQ1 Riboswitch RNA: 5′-AF647-CUGGGUCGCAGUAACCCCAGUUAACAAAACAAG-3'

Cy5-labeled SAM-II Riboswitch RNA: 5′-Cy5-UCGCGCUGAUUUAACCGUAUUGCAAGCGCGUGAUAAAUGUAGCUAAAAAGGG -3'

Microscale Thermophoresis MST experiments were conducted in triplicate on a Monolith NT.115 system (NanoTemper Technologies). The RRE RNA solutions were prepared in 10 mM HEPES (pH 7.5) 100 mM KCl, 0.5 mM Na2EDTA,

and 2 mM MgCl2, and the Fl-Rev peptide solutions were prepared in 30 mM HEPES

(pH 7.5), 100 mM KCl, 10 mM sodium phosphate, 10 mM NH4OAc, 10 mM guanidinium hydrochloride, 2 mM MgCl2, 20 mM NaCl, 0.5 mM EDTA, 0.01% Nonidet P-40. The RRE RNA was annealed by heating to 95 °C for 2 minutes followed by cooling to room temperature over 1 h.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Fl-Rev with RRE A two-fold dilution series of the unlabeled RRE RNA was prepared in 25 nM Fl-Rev and 5% DMSO, with the final concentrations of the RRE RNA ranging from 2 µM to 0.061 nM. Samples were incubated on ice for at least 30 minutes. Following incubation, the samples were added to premium coated capillaries (NanoTemper Technologies) and were subsequently subjected to MST analysis. The results were analyzed by Temperature Jump (TJump) analysis, and the values obtained were normalized and plotted against the RRE RNA concentration. The dissociation constant was then determined using a single site model to fit the curve. DY-RRE with Neomycin A two-fold dilution series of neomycin was prepared in 50 nM DY647-labeled RRE RNA and 5% DMSO, with the final concentrations of the neomycin ranging from 20 µM to 0.61 nM. Samples were incubated on ice for at least 30 minutes. Following incubation, the samples were added to premium coated capillaries (NanoTemper Technologies) and were subsequently subjected to MST analysis. The results were analyzed by Temperature Jump (TJump) analysis, and the values obtained were normalized and plotted against the neomycin concentration. The dissociation constant was then determined using a single site model to fit the curve. Fl-Rev, RRE, and Neomycin (Displacement) A two-fold dilution series of neomycin was prepared in 25 nM unlabeled RRE RNA, 25 nM FlRev and 5% DMSO, with the final concentrations of the Neomycin ranging from 200 µM to 6.104 nM. Samples were incubated on ice for at least 30 minutes. Following incubation, the samples were added to premium coated capillaries (NanoTemper Technologies) and were subsequently subjected to MST analysis. The results were analyzed by Temperature Jump (TJump) analysis, and the values obtained were normalized and plotted against the neomycin concentration. The dissociation constant was then determined using a single site model to fit the curve. Fl-Rev, RRE, and Neomycin (Competition) A two-fold dilution series of the unlabeled RRE RNA was prepared in 10 µM neomycin, 25 nM Fl-Rev and 5% DMSO, with the final concentrations of the RRE RNA ranging from 10 µM to 0.305 nM. Samples were incubated on ice for at least 30 minutes. Following incubation, the samples were filled into premium coated capillaries (NanoTemper Technologies) and were subsequently subjected to MST analysis. The results were analyzed by Temperature Jump (TJump) analysis, and the values obtained were normalized and plotted against the RRE RNA


Page 6 of 16

Page 7 of 16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

concentration. The dissociation constant was then determined using a single site model to fit the curve. PreQ1-RS with PreQ1 Solutions of fluor-labeled B. subtilis and T. tengcongensis preQ1 riboswitches were prepared in 50 mM Tris-HCl (pH 7.5), 100 mM KCl, and 1 mM MgCl2. Both preQ1 riboswitches were annealed by heating to 75 °C for 5 minutes followed by cooling to room temperature over 1 h. A two-fold dilution series of preQ1 was prepared in 50 nM Cy5-labeled Bs preQ1 riboswitch and 5% DMSO, with the final concentrations of preQ1 ranging from 5 µM to 0.153 nM. Samples were incubated on ice for at least 30 minutes. Following incubation, the samples were added to premium coated capillaries (NanoTemper Technologies) and were subsequently subjected to MST analysis. The results were analyzed by Temperature Jump (TJump) analysis, and the values obtained were normalized and plotted against the preQ1 concentration. The apparent dissociation constant was then determined using a single site model to fit the curve. The same was done for the fluor-labeled Tt PreQ1 riboswitch.

Figure 2. A) Primary sequence of Fluoresceinlabeled Rev peptide and chemical structure of the aminoglycoside neomycin. B) Secondary structure of unlabeled and DY647-labeled RRE RNA.

SAM-II-RS with SAM Solutions of Cy5-labeled SAM-II riboswitch was prepared in 50 mM Tris-HCl (pH 7.5), 100 mM KCl,

and 1 mM MgCl2. The SAM-II riboswitch was annealed by heating to 95 °C for 3 minutes followed by cooling to room temperature over 1 h. A two-fold dilution series of SAM was


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

prepared in 50 nM Cy5-labeled SAM-II riboswitch and 5% DMSO, with the final concentrations of SAM ranging from 20 µM to 0.61 nM. Samples were incubated on ice for at least 30 minutes. Following incubation, the samples were added to premium coated capillaries (NanoTemper Technologies) and were subsequently subjected to MST analysis. The results were analyzed by Temperature Jump (TJump) analysis, and the values obtained were normalized and plotted against the SAM concentration. The dissociation constant was then determined using a single site model to fit the curve. RESULTS AND DISCUSSION Interactions with HIV-1 RRE SL IIB RNA To test the range of interactions possible to measure MST we chose the human immunodeficiency virus type-1 Rev response element RNA (RRE RNA) and its interaction with the viral Rev peptide (Figure 2).16 Following HIV infection, the Rev peptide binds to RRE RNA and facilitates nuclear export of the viral mRNA, which is crucial for HIV replication. This interaction has been extensively studied in RNA biology and therapeutics capable of displacing Rev from RRE RNA are highly sought after.8 We initially measured the binding of a fluorescein-labeled Rev peptide (Fl-Rev) to unlabeled RRE RNA. In the presence of the temperature gradient, unbound Fl-Rev migrated towards higher temperatures into the heated area, corresponding to a negative thermophoretic effect. Upon binding the RRE RNA, the complex displayed an increasingly positive thermophoresis (Figure 3). The change in sign for the thermophoresis is ideal as it allows for a large dynamic range of signal and makes the binding event unambiguous. The data were fit to determine a KD of 4.8 nM, in good agreement with several other previously reported values (Table 1).17


Page 8 of 16

A Normalized Fluoresence

1.02

1.00

[RRE]

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

0.98

0.96

0.94

0.92

B

0

10

20

30

Time (s)

1010

KD = 4.8 ± 0.7 nM

1000

Fn (%)

Page 9 of 16

990

980 -1

0

1

2

3

4

Log [RRE] (nM)

Figure 3. A) Raw MST trace showing the shift in migration between free Fl-Rev and the Rev/RRE RNA complex. Free Rev has a negative thermophoresis and migrates into the heat gradient while the complex has a positive thermophoresis and migrates toward cooler temperatures. B) Binding curve generated from the difference in initial fluorescence intensity compared to the intensity in the presence of heat. The curve was fit to a standard 1:1 binding model to obtain a KD in agreement with literature values.15

Neomycin has previously been reported to bind RRE RNA and competitively displace the Rev peptide. To assess direct small molecule binding to RNA, we used a DY647-labeled RRE RNA and titrated in increasing quantities of neomycin. This yielded a measurable change in

thermophoresis and a calculated KD of 1.5 µM. While neomycin is known to have several binding sites on RRE (KD values range from ~100 nM – 40 µM) the value measured by MST is in excellent agreement with the literature for the physiologically relevant neomycin binding site (Table 1).17 We then investigated more complex systems comprised of Fl-Rev, RRE RNA, and neomycin in order to probe competitive binding. First, preincubated solutions of Fl-Rev and RRE RNA were titrated with neomycin to quantify its ability to competitively displace Rev. Second, solutions containing fixed concentrations of neomycin and Fl-Rev were titrated with increasing concentrations of RRE RNA to assess competitive binding. In both cases, MST successfully measured KD values that were in good agreement with those previously reported in the literature (Table 1, Figure S1), further highlighting the versatility of the technique.18


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 16

Table 1: Direct and competitive binding of ligands to RRE RNA

KD (nM) Direct binding

MST

Literature

Rev + RRE

4.8 ± 0.7

315

Neomycin + RRE

1,500 ± 900

1,90015

Competitive binding

MST

Literature

Rev/RRE complex + Neomycin (Ki)

2300 ± 600

700016

Rev + RRE + Neomycin (Kdapp)

49 ± 12

2916

RRE RNA solutions were prepared in 10 mM HEPES (pH 7.5) 100 mM KCl, 0.5 mM Na2EDTA,

and 2 mM MgCl2, and the Fl-Rev peptide solutions were prepared in 30 mM HEPES

(pH 7.5), 100 mM KCl, 10 mM sodium phosphate, 10 mM NH4OAc, 10 mM guanidinium hydrochloride, 2 mM MgCl2, 20 mM NaCl, 0.5 mM EDTA, 0.01% Nonidet P-40

Interactions with Riboswitches Riboswitches are highly structured RNA aptamers that occur naturally within the 5′ UTR of many bacterial genes.2 These RNA motifs undergo conformational changes upon binding to a metabolite which result in regulation of gene expression at both transcriptional and translational levels. Riboswitches are excellent model systems for studying RNA/small molecule interactions as they are among the best examples of high affinity RNA/small molecule interactions currently known. In addition, riboswitches may serve as antibacterial drug targets,19 and some progress has been made in discovering synthetic ligands.20-22


Page 11 of 16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Two riboswitches that bind the bacterial metabolite

pre-queuosine1

(preQ1)

were

chosen from the model organisms B. subtilis (Bs) and T. tengcongensis (Tt). While both bind preQ1 and regulate the biosynthesis of preQ1,

the

former

does

so

through

transcriptional regulation and the latter through translational regulation.23,

24

The binding of

preQ1 to the two riboswitches was analyzed by titrating increasing amounts of preQ1 into solutions containing a constant concentration of the Cy5- and Alexa Fluor 647-labeled Bs and Tt preQ1 riboswitches, respectively (Figure 4). Both the Bs and Tt preQ1 riboswitches Figure 4. Secondary structure of A) preQ1 riboswitches from Bs and Tt, and B) the SAM-II riboswitch. C) Chemical structures of the cognate riboswitch ligands preQ1 and SAM

respectively) (Table 2).

24, 25

exhibited tight binding with KD values of 26 ± 3 nM and 27 ± 14 nM, which are in good agreement with the literature (20 nM and 2 nM,

Binding of preQ1 to the Bs riboswitch resulted in a large change in

thermophoresis relative to the change observed with the Tt riboswitch (Figure 5).

This

observation correlates with information derived from X-Ray crystal structures and mechanistic studies of these riboswitches which suggest the Tt riboswitch undergoes a smaller conformational change upon preQ1 binding; therefore, the apo form of the Tt riboswitch resembles the bound state more closely than the analogous forms of the Bs riboswitch.23,

24

Furthermore, the Tt riboswitch can even be crystallized in the absence of ligand, while efforts to crystalize unbound Bs riboswitch have been unsuccessful to date.24 Additionally, the Tt riboswitch displayed a net negative thermophoretic movement upon binding whereas the Bs riboswitch exhibited a positive thermophoresis, providing further evidence that the two riboswitches undergo different conformational changes upon binding with preQ1 (Figure 5).


Biochemistry

A

C

B 965

KD = 26 ± 3 nM

965

KD = 27 ± 14 nM

875

960

KD = 138 ± 36 nM

960

950

870

Fn (%)

955

Fn (%)

Fn (%)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 16

865 860

945

-1

0

1

2

3

4

950 945

855

940

955

-1

Log [PreQ1] (nM)

0

1

2

3

4

Log [PreQ1] (nM)

940 -4

-3

-2

-1

0

1

2

Log [SAM] (µM)

Figure 5. Binding curves generated by MST for preQ1 binding to the A) Bs riboswitch and B) Tt riboswitch. The opposite change in thermophoretic behavior suggests that these two aptamers undergo different conformational changes upon ligand binding. C) Binding curve from MST for SAM-II riboswitch binding SAM.

We next evaluated the performance of MST to measure a different riboswitch/small molecule interaction. We chose the SAM-II riboswitch, which is responsible for controlling the expression of genes that regulate the biosynthesis of the cofactor S-adenosyl methionine (SAM).7 To this end, we designed a Cy5-labeled SAM-II riboswitch that was titrated with increasing concentrations of SAM. We measured a KD of 138 ± 36 nM, which aligns well with a previously reported value of ~200 nM (Table 2).7 These results indicate that MST is useful for probing a variety of riboswitch/ligand interactions.

Table 2:Binding affinities of riboswitches with cognate ligands

KD (nM) Riboswitch

MST

Literature

BS PreQ1 RS

26 ± 3

2022

TT PreQ1 RS

27 ± 14

223

SAM-II RS

138 ± 36

2007

Solutions of fluor-labeled riboswitches were prepared in 50 mM Tris-HCl (pH 7.5), 100 mM KCl, and 1 mM MgCl2

CONCLUSION

In this study, we explored the utility of MST to probe RNA/ligand interactions. We examined high affinity RNA/small molecule interactions with three different riboswitches, low affinity RNA/small molecule interactions (RRE RNA/neomycin), as well as high affinity


Page 13 of 16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

peptide/RNA interactions (Rev peptide/RRE RNA). We also examined competition in RRE RNA binding between neomycin and the Rev peptide via two different approaches. In all of these applications, MST successfully measured binding affinities that were in good agreement with previously reported values that were determined through several different biophysical techniques. This shows that the ability of MST to monitor therapeutically relevant RNA binding events and competitive displacement (i.e. Rev/neomycin/RRE RNA binding) is comparable to that of other techniques currently used in the field. In addition to being broadly applicable to studying RNA binding interactions, MST is also decidedly more material efficient due to its high sensitivity and the low volume of sample required for analysis. These features would make MST attractive as a screening platform for discovering small molecules that are capable of binding to RNA and/or displacing RNA-bound peptides or proteins. Alternatively, it would be useful in the direct comparison of a series of related ligands, as in a medicinal chemistry optimization campaign or probing the specificity of a series of mutants when studying protein/RNA interactions. The data reported here indicate that MST will most likely be useful as a technique to analyze systems where either a conformational change or change in net charge occurs upon ligand binding. For instance, the change in thermophoresis direction upon binding of preQ1 to the Bs and Tt riboswitches shows that MST can distinguish subtle differences in binding brought on by conformational changes. Also, the significant change in net charge that occurs upon RRE RNA binding with neomycin and Rev can be characterized by the robust thermophoretic shift in the MST traces. Thus, MST can be considered a valuable approach to investigate RNA/ligand interactions, including probing the binding of small molecules.

Supporting Information Methods and characterization for the Fl-Rev peptide and MST curves for RRE/ligand interactions are included as supporting information

Corresponding Author *E-mail: [email protected] Author Contributions T.H., M.M., and J.S. conceived the project. M.M. and T.H. performed MST experiments. A.S. synthesized the Fl-Rev peptide and edited the manuscript. T.H., M.M., and J.S. wrote the


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

manuscript. All authors have given approval to the final version of the manuscript. ‡These authors contributed equally. Funding This Research was supported by the Intramural Research Program of the NIH, National Cancer Institute, Center for Cancer Research (1 ZIA BC011585 03). Notes The authors declare no competing financial interest. Acknowledgments We thank Dr. S. Tarasov and M. Dyba (Biophysics Resource, SBL, NCI at Frederick) for training and assistance with microscale thermophoresis. References [1] Bartel, D. P. (2004) Cell 116, 281-297. [2] Breaker, R. R., and Joyce, G. F. (2014) Chem Biol 21, 1059-1065. [3] Cech, T. R., and Bass, B. L. (1986) Annu Rev Biochem 55, 599-629. [4] Holmans, P. A., Massey, T. H., and Jones, L. (2017) Hum Mol Genet 26, R83-R90. [5] Cooper, T. A., Wan, L., and Dreyfuss, G. (2009) Cell 136, 777-793. [6] Connelly, C. M., Moon, M. H., and Schneekloth, J. S., Jr. (2016) Cell Chem Biol 23, 10771090. [7] Haller, A., Rieder, U., Aigner, M., Blanchard, S. C., and Micura, R. (2011) Nat Chem Biol 7, 393-400. [8] Thomas, J. R., and Hergenrother, P. J. (2008) Chem Rev 108, 1171-1224. [9] Blakeley, B. D., DePorter, S. M., Mohan, U., Burai, R., Tolbert, B. S., and McNaughton, B. R. (2012) Tetrahedron 68, 8837-8855. [10] Duhr, S., and Braun, D. (2006) Proc Natl Acad Sci U S A 103, 19678-19682. [11] Seidel, S. A., Dijkman, P. M., Lea, W. A., van den Bogaart, G., Jerabek-Willemsen, M., Lazic, A., Joseph, J. S., Srinivasan, P., Baaske, P., Simeonov, A., Katritch, I., Melo, F. A., Ladbury, J. E., Schreiber, G., Watts, A., Braun, D., and Duhr, S. (2013) Methods 59, 301-315. [12] Linke, P., Amaning, K., Maschberger, M., Vallee, F., Steier, V., Baaske, P., Duhr, S., Breitsprecher, D., and Rak, A. (2016) J Biomol Screen 21, 414-421. [13] Gaffarogullari, E. C., Krause, A., Balbo, J., Herten, D. P., and Jaschke, A. (2013) RNA Biol 10, 1815-1821. [14] Jerabek-Willemsen, M., André, T., Wanner, R., Roth, H. M., Duhr, S., Baaske, P., and Breitsprecher, D. (2014) Journal of Molecular Structure 1077, 101-113. [15] Entzian, C., and Schubert, T. (2016) Methods 97, 27-34. [16] Le Grice, S. F. (2015) Curr Top Microbiol Immunol 389, 147-169. [17] Lacourciere, K. A., Stivers, J. T., and Marino, J. P. (2000) Biochemistry 39, 5630-5641. [18] Luedtke, N. W., and Tor, Y. (2003) Biopolymers 70, 103-119. [19] Breaker, R. R. (2011) Mol Cell 43, 867-879.


Page 14 of 16

Page 15 of 16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

[20] Blount, K. F., Megyola, C., Plummer, M., Osterman, D., O'Connell, T., Aristoff, P., Quinn, C., Chrusciel, R. A., Poel, T. J., Schostarez, H. J., Stewart, C. A., Walker, D. P., Wuts, P. G., and Breaker, R. R. (2015) Antimicrob Agents Chemother 59, 5736-5746. [21] Howe, J. A., Xiao, L., Fischmann, T. O., Wang, H., Tang, H., Villafania, A., Zhang, R., Barbieri, C. M., and Roemer, T. (2016) RNA Biol 13, 946-954. [22] Wang, H., Mann, P. A., Xiao, L., Gill, C., Galgoci, A. M., Howe, J. A., Villafania, A., Barbieri, C. M., Malinverni, J. C., Sher, X., Mayhood, T., McCurry, M. D., Murgolo, N., Flattery, A., Mack, M., and Roemer, T. (2017) Cell Chem Biol 24, 576-588 e576. [23] McCown, P. J., Liang, J. J., Weinberg, Z., and Breaker, R. R. (2014) Chem Biol 21, 880889. [24] Jenkins, J. L., Krucinska, J., McCarty, R. M., Bandarian, V., and Wedekind, J. E. (2011) J Biol Chem 286, 24626-24637. [25] Zhang, Q., Kang, M., Peterson, R. D., and Feigon, J. (2011) J Am Chem Soc 133, 51905193.


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

For Table of Contents Use Only


Page 16 of 16

Measuring RNA-Ligand Interactions with Microscale Thermophoresis

Recommend Documents