Mechanistic Insights from the Crystal Structure of ... - ACS Publications

Subscriber access provided by UB + Fachbibliothek Chemie | (FU-Bibliothekssystem)

Article

Mechanistic insights from the crystal structure of Bacillus subtilis osuccinylbenzoyl-CoA synthetase complexed with the adenylate intermediate Yaozong Chen, Yiping Jiang, and Zhihong Guo Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.6b00889 • Publication Date (Web): 09 Nov 2016 Downloaded from http://pubs.acs.org on November 18, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Biochemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Mechanistic insights from the crystal structure of Bacillus subtilis o-succinylbenzoyl-CoA synthetase complexed with the adenylate intermediate Funding Sources: This work was supported by GRF601413 and N_HKUST621/13 from the Research Grants Council and SBI14SC05 from the University Grants Council of the Government of the Hong Kong Special Administrative Region. Yaozong Chen, Yiping Jiang, and Zhihong Guo* Department of Chemistry, The Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong SAR, China. *To whom correspondence should be addressed: Zhihong Guo, Department of Chemistry, The Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong SAR, China. Tel: 852-2358-7352; Fax: 852-2358-1594; Email: [email protected].

ACS Paragon Plus Environment

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 42

ABBREVIATIONS: OSB: o-succinylbenzoate; OSB-CoA: o-succinylbenzoyl-CoA; OSB-AMP: o-succinylbenzoyladenosine monophosphate; OSB-AMS (5′-O-(N-o-succinylbezoylsulfamoyl)adenosine; SHCHC: (1R,

6R)-2-succinyl-6-hydroxy-2,

4-cyclohexadiene-1-carboxylate;

4CBL:

4-

chlorobenzoate:CoA ligase (4CBL); 4CB-AMP: 4-chlorobenzoyl adenosine monophosphate or 4-chlorobenzoyl adenylate; ANL enzymes: acyl/aryl-CoA synthetases, adenylation domains of non-ribosomal

peptide

synthetases

and

firefly

luciferases;

IPTG:

isopropyl

thiogalactopyranoside; DDT: dithiothreitol; RMSD: root-mean-square deviation.


β-D-

Page 3 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

ABSTRACT

o-Succinylbenzoyl-CoA (OSB-CoA) synthetase, or MenE, catalyzes an essential step in vitamin K biosynthesis and is a valuable drug target. Like many other adenylating enzymes, it changes its structure to accommodate substrate binding, catalysis, and product release along the path of a domain alteration catalytic mechanism. We have determined the crystal structure of its complex with the adenylation product, o-succinylbenzoyl-adenosine monophosphate (OSBAMP), and captured a new post-adenylation state. This structure presents unique features such as a strained conformation for the bound adenylate intermediate to indicate that it represents the enzyme state after completion of the adenylation reaction but before release of the C-domain in its transition to the thioesterification conformation. By comparison to the ATP-bound preadenylation conformation, structural changes are identified in both the reactants and the active site to allow inference of how these changes accommodate and facilitate the adenylation reaction and to directly support an in-line backside attack nucleophilic substitution mechanism for the first-half reaction. Mutational analysis suggests that the conserved His196 plays an important role in desolvation of the active site rather than stabilizing the transition state of the adenylation reaction. In addition, comparison of the new structure with a previously determined OSB-AMPbound structure of the same enzyme allows us to propose a release mechanism of the C-domain in its alteration to form the thioesterification conformation. These findings allow us to better understand the domain alteration catalytic mechanism of MenE as well as many other adenylating enzymes.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

o-Succinylbenzoyl-CoA (OSB-CoA) synthetase, or MenE, catalyzes a two-step reaction in which the o-succinylbenzoic acid is activated by ATP in the first step and the resulting OSBAMP intermediate reacts with coenzyme A to form the final product in the second step (Figure 1). It is mechanistically similar and phylogenetically related to acyl/aryl-CoA synthetases (ACS), adenylation domains of non-ribosomal peptide synthetases (NRPSs) and firefly luciferases, which form the ANL family of adenylating enzymes (1). MenE is an essential enzyme in vitamin K biosynthesis (2-4) and a valuable target for development of novel antibiotics against microbial pathogens such as Mycobacterium tuberculosis (5, 6). Members of the ANL family share a low level of sequence homology but are highly conserved in the three-dimensional structure and catalytic mechanism. They are composed of a large amino terminus domain (N-domain) and a smaller carboxy terminus domain (C-domain) with the active site located at the interface of the two domains (7, 8). Previous studies have suggested a domain alteration mechanism for the diverse reactions catalyzed by the enzymes in the ANL family (1). In this mechanism, the enzyme reconfigures its active site in two different active conformations to catalyze the two steps of the reaction, one for the adenylation reaction and the other for the thioesterification reaction (Figure 1). The adenylation active site is formed from a large number of residues on the N-domain and a smaller number of residues on one side of the small C-domain, while the thioesterification active sites is formed from the same set of Ndomain residues and the residues on the opposite side of the C-domain. In catalysis, the enzyme undergoes a significant conformational change to shift from the adenylation conformation to the thioesterification conformation by rotating the small C-domain by a large angle as much as 140° for bacterial acetyl-CoA synthetase (9). This mechanism has been strongly supported by the finding that mutation of residues on one side of the C-domain affects one specific step of the


Page 4 of 42

Page 5 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

overall reaction only (10-13) and structural characterization of both active conformations in a number of ANL enzymes (7, 14-19). The structures of ANL family members are highly dynamic during the catalytic process (1). In the absence of substrates, these enzymes adopt a highly flexible open conformation and undergo open-closed conformational change when the first substrate, ATP, binds to form the adenylation active site, for which the structural basis of the ATP-dependent configuration has been revealed in our recent determination of the structure of Bacillus subtilis MenE (bsMenE) complexed with ATP (20). Subsequently, the carboxylic acid substrate binds and reacts with ATP to form an acyl-AMP intermediate and pyrophosphate. Since the β, γ-pyrophosphate group of ATP is the most important contributor to interaction with the small C-domain in formation of the adenylation active site (20), dissociation of the pyrophosphate product should release Cdomain and allow it to rotate in a large angle to form the second active site for binding CoA-SH and its reaction with the acyl-AMP intermediate in the second-step reaction. In the past many years, numerous snapshots have been taken of the ANL enzymes in the domain alteration catalytic mechanism, often in complexes with the natural ligands of the enzymes

or

their

analogues

(for

an

updated

list,

see

http://labs.hwi.buffalo.edu/gulick/RANLChart.html). However, it is often difficult to determine exactly where the captured structures are in the long and dynamic catalytic path. Moreover, the many available structural snapshots were taken for a diverse array of ANL enzymes, making it difficult to constitute the structural change along any single catalytic path. Furthermore, few snapshots have been taken for a single reaction step. For the adenylation step, both ATP- and acyl-AMP-bound structures were available only for PaaK1 from Burkholderia cenocepacia to allow an inline backside catalytic mechanism to be inferred (21). For DltA from Bacillus cereus


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

and long chain fatty acyl-CoA synthetase from Thermus thermophilus HB8, their structures in complex with ATP or ATP analogs are significantly different from other ANL enzymes probably due to crystal packing interactions and are thus unlikely to inform on the adenylation catalytic mechanism, although their acyl-AMP-bound structures have also been determined (20, 22, 23). A number of structural snapshots of MenE have been taken along the dynamic domain alteration process in its catalysis. Besides the bsMenE-ATP structure (PDB entry 5BUR) that provides the structural basis for the ATP-dependent configuration of the adenylation active site (20), various MenE structures from either Bacillus subtilis or Bacillus anthracis have also been determined in the absence of ligands and in the presence of AMP and OSB-AMP (20, 24). In addition, the R195K mutant of E. coli MenE (ecMenE) has also been structurally determined in complex with OSB-AMS (5′-O-(N-o-succinylbenzoylsulfamoyl)adenosine), a stable analogue of the OSB-AMP intermediate (PDB entry 5C5H) (25). Interestingly, the two subunits in the previously determined bsMenE-OSB-AMP complex structure take two very different conformations, one similar to the open conformation of ligand-free bsMenE and the other similar to the adenylation conformation, with their C-domains taking very different orientations relative to their respective N-domains. Meanwhile, the ecMenE R195K mutant takes a conformation similar to the adenylation conformation with a short distance between the N- and C-domains. Due to the subtle structural differences caused by the high C-domain variability, these MenE structures with OSB-AMP or its analogue appear to take a conformation in which the C-domain is released at a different level along the structural transition path from the adenylation conformation to form the thioesterification conformation. They provide very important structural information for the conformational change in the domain alteration mechanism. However, it is


Page 6 of 42

Page 7 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

less certain how they contribute to our understanding of the catalytic process of the first adenylation step. In this study, we have determined the crystal structure of bsMenE in complex with OSBAMP again at 2.69 Å resolution and captured a new conformation of the enzyme in its catalytic path. The enzyme molecule in this structure contains an ordered C-domain and takes a conformation closely resembling the ATP-bound bsMenE structure with a strained succinyl group in the OSB-AMP ligand. Different from the available OSB-AMP- or OSB-AMS-bound MenE structures whose C-domains are released to different degrees, this new bsMenE structure thus represents the state of the enzyme after completion of the adenylation reaction and before release of its C-domain for transition to the thioesterification conformation. This new structure allows a glimpse of the orientation and positioning of the OSB-AMP product at the time of its formation and provides new mechanistic insights into the adenylation reaction.

Materials and Methods Expression, purification of wild-type bsMenE and its mutants. The C-terminal Histagged wild-type bsMenE was prepared as described previously (20). Briefly, the recombinant bsMenE construct in the pET28a vector was transformed and overexpressed in E. coli strain BL21 (DE3) at 37oC for 8h. The protein was purified by Ni2+ HiTrap affinity column, followed by gel filtration chromatography using a Sephacryl S-200 HR column. During the whole purification process, 2 mM 2-mecaptoethanol was included in all the buffers and the isolated protein was concentrated and stored at 50 mM Tris buffer (pH 8.0) with 10% glycerol and 1 mM DTT at -20oC for both activity assay and crystallization.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 42

The recombinant constructs of mutated bsMenE, including H196F, H196A, and H196Q were generated with the QuikChange™ site-directed mutagenesis kit using the C-terminal-histagged bsMenE described above as template. The oligodeoxynucleotide primers used in the point mutations were: GCTTATCGCATTGCCGCTCTTTTTTATCAGCGGATTGTCCGC (H196F forward),

GCGGACAATCCGCTGATAAAAAAGAGCGGCAATGCGATAAGC

(H196F

reverse),

GCTTATCGCATTGCCGCTCTTTGCTATCAGCGGATTGTCCGC

(H196A

forward),

GCGGACAATCCGCTGATAGCAAAGAGCGGCAATGCGATAA

(H196A

reverse),

GCTTATCGCATTGCCGCTCTTTCAAATCAGCGGATTGTCCGC

(H196Q

forward), and GCGGACAATCCGCTGATTTGAAAGAGCGGCAATGCGATAAGC (H196Q reverse). The genes of all protein mutants were sequenced by Beijing Genomics Institute (BGI) to confirm that mutations were incorporated into the desired sites only. The expression and purification of these protein mutants followed an identical protocol as described above for wild type bsMenE. All purified mutants were verified by circular dichroism spectroscopy to ensure that no significant secondary structural changes occur. Single substrate kinetics of bsMenE and its variants. OSB was purified by reversephase high performance liquid chromatography (HPLC) from a one-pot chemoenzymatic reaction using chorismate as the starting material and the enzymes EntC, MenC, MenD, and MenH that were prepared as described in previous studies (26-31). The single substrate kinetic measurements of wild-type bsMenE and its mutants were carried out as reported previously (5, 20), in which the concentration of one substrate was varied (10 to 1000 µM for OSB, 10 - 2000 µM for ATP and 50 - 2000 µM CoA) in the presence of the other two substrates that were set at a saturating concentration (1 mM for OSB and 2 mM for both ATP and CoA). The OSB-CoA synthetase activity was coupled with excessive MenB (DHNA-CoA synthase) obtained from


Page 9 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

previous studies (32, 33) and the absorbance increase at 392 nm (molar extinction coefficient ε = 4000 M-1•cm-1, 34) was used to calculate the reaction rate by the Michealis-Menten equation listed below,

ν =

∙[ ] [ ]

where ν is the reaction rate (µM/min); νmax is the maximum reaction rate (µM/min) and is equal to kcat multiplied by the total concentration of the enzyme; [S] is the varying substrate concentration (µM); and KM is the Michaelis-Menten constant (µM). Crystallization. The purified protein at a concentration of 10, 15, or 20 mg/mL was mixed with 4 mM ATP and OSB in the absence of Mg2+ and the mixture was incubated at 4oC for 20 min before crystallization screening setup. The screening trial using a range of screen kits (Hampton Research) was performed at 289 K by mixing 1 µL protein solution and 1 µL reservoir solution through sitting-drop vapor diffusion. Small single crystals were observed after 3 days under the similar condition for crystallizing the bsMenE-ATP complex (20), which contained 10% (w/v) polyethylene glycol (PEG) 6000, 5% (v/v) (+/-)-2-methyl-2, 4- pentanediol (MPD) and 0.1 M HEPES pH 7.5. Further optimization was carried out by introducing a series of additives using hanging-drop vapor diffusion in 24-well plates. Rod-shape crystals with good diffraction quality were obtained in the reservoir solution with 10% PEG 6000, 10.5% MPD, 0.094M HEPES pH 7.3, 0.012 M imidazole, 0.12 M sodium acetate, 0.6% PEG 8000 and 0.48% ethylene glycol. Data collection, processing and refinement. The diffraction data of the bsMenE-OSBAMP complex was collected at beamline BL17U equipped with ADSC Quantum 315r CCD detector at Shanghai Synchrotron Radiation Facility (SSRF). The crystals were mounted and


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 42

soaked with the reservoir solution containing 20% (v/v) glycerol and 1 mM OSB and ATP to avoid ice ring and crystal cracking. All of the collected images were indexed, integrated and scaled by HKL2000 (35). The crystal shared the same space group P43 with the ATP- and AMPbsMenE complexes (20), with unit-cell parameters a = b = 121.8, c = 98.5. To fulfill the general criteria of I/sigma, Rmerge and CC1/2, the highest resolution of the data set was set to 2.69 Å. The structure was solved by molecular replacement by Phaser-MR in Phenix (36) using the chain A of ligand-free bsMenE (pdb code 5BUQ, 20) as the search model. Two subunits were found and correctly placed within the asymmetric unit, consistent with the Matthews coefficient prediction (37). The resulting polypeptides were refined with REFMAC (38) in CCP4 Suite (39) and PHENIX.refine (40), during which 5% of reflections were used to calculate the Rfree. Geometry restraints and coordinates of OSBAMP were generated by the PRODRG2 server (41) and refined using eLBOW (42). This small molecule was manually modeled to the un-biased electron density at the inter-domain active sites of both subunits in the asymmetric unit using COOT (43), which resulted in a significant decrease of Rfree. As the refinement converged, TLS anisotropic refinement was incorporated individually for the N- and C-terminal domains, as well as for the acyl-adenylate ligand. The overall data quality was assessed by PROCHECK (44) and MolProbity (45) before being submitted to PDB validation. The statistics of data collection and refinement are summarized in Table 1. Structural analysis and presentation. PyMOL v1.3 was used to perform all the structural analysis and to generate all graphics (46). PISA was used for interface and assemblies analysis (47) and PDB2PQR was used to calculate the electrostatic potential surface (48).

Results


Page 11 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Structure of bsMenE complexed with OSB-AMP. Crystals of bsMenE were grown in the presence of the substrates OSB and ATP under conditions similar to those previously identified for the bsMenE-ATP complex (20). The structure was solved by molecular replacement using the bsMenE structure (PDB code: 5BUQ) as the search model and was refined to 2.69 Å with all the statistics of data collection and refinement listed in Table 1. There are two protein molecules in the asymmetric unit, of which one (chain A) contains an intact N-domain (residues 1-379), linker (residues 380-392) and C-domain (residues 393-486) with good electron density. The other (chain B) contains the large N-domain but without electron density for the small C-domain (Figure 2A and 2B). In the full-length chain, only the first and the last amino acid residues are disordered and its C-domain is significantly more flexible with a much higher average B-factor than the large N-domain (Table 1) as observed in other bsMenE structures or other ANL enzymes. SDS-PAGE analysis of bsMenE in the crystals showed that the protein is uniformly full-length (Figure 2E), excluding the possibility that the absence of the C-terminus of chain B was due to protein degradation prior to crystal formation. PISA analysis showed that the two protein molecules form a strong dimer interface, consistent with the dimeric structure of the enzyme suggested by size exclusion chromatography. A small molecule ligand corresponding to the reaction intermediate OSB-AMP is present in a binding cavity (Figure 1C) formed at the interface between the N- and C-domains in the intact protein chain, while the same ligand is also present in the incomplete protein chain but with significantly poorer electron density (Figure 2F). In the later discussion the full-length chain A serves as the representative of the bsMenE-OSBAMP complex for simplicity. OSB-AMP is bound to the active site in a ‘U- shape’ conformation at the interface of the Nand C-domains with extensive interactions with conserved amino acid residues (Figure 2D).


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 42

Noticeably, its succinyl group contains an ethylene group (SC2-SC3) in an energetically unfavorable eclipsedconformation (Figure 2G), which is the best fit of the electron density at 2.69 Å resolution and fully consistent with the geometry of other parts of the ligand. Its adenine moiety is sandwiched between the backbone of the tripeptide Gly263-Gly264-Gly265 and the hydrophobic Tyr286 with an edge-on π-stacking interaction and is hydrogen-bonded to Ser285 like in other bsMenE structures (20). In addition, its ribose moiety is stabilized by hydrogen bonds with the Asp367 side chain carboxylate and the strictly conserved Arg382 (Figure 2H), while its α-phosphate is tightly fixed by hydrogen bonding with Ser153, His196, Thr289, and possibly Lys471 (Figure 2I). Moreover, the OSB moiety of the adenylate intermediate is mainly stabilized by a hydrogen bond between the carboxylic acid and Gln294 and van der Waals interaction of the benzene ring with Ser198 and Ser293 as well as the Leu261-Leu262-Gly263 (LLG) motif specifically conserved among MenE orthologues (Figures 2D and 2J). Interestingly, the activated OSB carbonyl group of the intermediate is not involved in any interaction with surrounding residues, which would probably be further activated and oriented for reaction with the coenzyme A substrate only after the thioesterification conformation is formed. Comparison

to

the

adenylation

conformation.

The

bsMenE-OSB-AMP

is

superimposable to the bsMenE-ATP complex that has been characterized as the active adenylateforming conformation (20). The RMSD is 0.30 Å for the N-domain and 0.41 Å for the C-domain over all the comparable Cα atoms, demonstrating that the OSB-AMP-bound bsMenE adopts the adenylation conformation closely resembling the ATP-bound bsMenE structure (Figure 3A). In corroboration of this structural similarity, the hinge residue Ser384, which undergoes a large backbone rearrangement in the structural change from the adenylation to the thioesterification conformation, presents essentially identical dihedral angles in these two structures. Nonetheless,


Page 13 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

the P-loop (Thr152 to Lys160) in the N-domain of the bsMenE-OSB-AMP complex (PDB entry 5BUS) is similar to that of the bsMenE-AMP complex but significantly different from that of the bsMenE-ATP complex (PDB entry 5BUR) (Figure 3B), the latter of which forms tight gripping interactions with the β, γ-pyrophosphate group of ATP (20). The bsMenE-OSB-AMP complex is also structurally similar to one subunit (chain B) of another crystal structure of bsMenE in complex with OSB-AMP in a different space group (P1) at 2.89 Å, of which the other subunit (chain A) takes a conformation with its C-domain swung away from the N-domain at a large angle (24). Although the coordinates of this previously determined structure are not publically available for comparison, these two bsMenE-OSB-AMP structures exhibit significant differences in the protein-ligand interactions. As listed in Table 2, many hydrogen bonds stabilizing the ribose, α-phosphate, and OSB moieties of the OSB-AMP intermediate are significantly different in bond length or are specific for one of the structures. More importantly, the ethylene group in the succinyl moiety of the ligand takes an unfavorable eclipsed-conformation in the structure obtained in the current study but takes an energetically favorable anti-conformation in the previously determined structure (24). This structural difference in the succinyl moiety shows that OSB-AMP is more relaxed in the previous structure, indicative of a more relaxed protein conformation in comparison to the structure determined in the current study. Therefore, the two subunits of the previous bsMenE structure in complex with OSB-AMP represent two intermediate structures in the release process of the C-domain from the N-domain in the conformational transition to form the thioesterification conformation, whereas our bsMenE-OSB-AMP complex most likely represents the adenylation conformation after completion of the adenylation reaction and pyrophosphate release but before the conformational release of the C-domain.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 42

The bsMenE-OSB-AMP complex also presents significantly different protein-ligand interactions in comparison to the ecMenE-OSB-AMS complex (PDB entry 5C5H) (25). First of all, the histidine residue equivalent to bsMenE His196 forms no hydrogen bond with the ligand in the latter structure (25) and its imidazole ring takes a different rotamer conformation, which is similar to that in the bsMenE-ATP structure (PDB entry 5BUR) (20). In addition, these two structures exhibit significant differences in the ribose-stabilizing hydrogen bonds corresponding to those listed in Table 2. Moreover, the ethylene group of the ecMenE-bound AMS-AMP ligand is in an anti-conformation, indicating that the ligand is also in a relaxed state that is similar to OSB-AMP in the previously determined bsMenE-OSB-AMP structure (24). From these structural comparisons, the bsMenE-OSB-AMP structure determined in this study undoubtedly represents a state closest to the structure of the enzyme right after completion of the adenylation reaction among all available MenE structures. Structural changes associated with adenylation. Since the bsMenE-OSB-AMP structure is closest to the post-adenylation conformation before C-domain release, its comparison to the pre-adenylation bsMenE-ATP structure (PDB entry 5BUR) allows inference of the structural changes associated with the adenylation reaction. As found in the structural superimposition shown in Figure 4A, the acyl moiety in OSB-AMP and the β, γ-pyrophosphate leaving group in ATP are perfectly in-line and located on opposite sides of the α-phosphate groups of the ligands, providing support for the in-line backside nucleophilic attack reaction mechanism for the adenylation step proposed on the basis of modeling results (20). This structural comparison also indicates that the AMP moiety of the ATP substrate is slightly rotated around the adenine N1 atom as the adenylation reaction proceeds, resulting in a product state in which displacement is gradually increased for other atoms with an increasing distance from the adenine N1 and reaches


Page 15 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

a maximum of 1.7 Å for the α-phosphate phosphorus atom of the AMP moiety (Figure 4A). This AMP rotation is a result of the best fit to the electron densities at the modest 2.69 Å resolution and is strongly supported by the geometry of the acyl moiety in OSB-AMP and the β, γpyrophosphate moiety in ATP. The identified structural differences between ATP and OSBAMP essentially define the reaction coordinates and indicate an in-line backside nucleophilic substitution mechanism for the adenylation reaction. Concomitant with the structural changes in the reactants, the enzyme active site also undergoes substantial changes as the adenylation reaction proceeds. First of all, the backbone of the LLG loop (Figure 4B), which has been shown to be an important structural motif in binding the OSB substrate through hydrophobic interactions (20), undergoes substantial movement toward the OSB moiety in the OSB-AMP-bound structure in comparison to the ATP-bound structure. This structural change likely occurs before the adenylation reaction, when OSB binds to its binding site. In addition, a conserved His196 forms a hydrogen bond with the bridging oxygen atom between the acyl group and the α-phosphate of the AMP moiety in the OSB-AMPbound structure, whereas this residue flips away by 86o in the ATP-bound structure. This conserved residue forms a hydrogen bond with the carbonyl oxygen of the acyl group in the previously determined OSB-AMP-bound structure in the adenylation conformation (chain B, 24), further demonstrating its difference from the structure determined in the current study. Moreover, the strictly conserved Arg382 in the linker loop between the N- and C-domains, which has been suggested to be crucial for the C-domain movement around the hinge residue Ser384 (20), also undergoes significant rearrangement during the adenylation reaction. It forms a strong salt bridge with the β-phosphate of ATP in the nucleotide-bound structure and flips by a large angle to form a 3.0Å hydrogen bond with the 2’-OH of the ribose (Figure 4B and Table 2)


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 42

in the OSB-AMP-bound structure. Furthermore, another strictly conserved residue, Lys471, also undergoes side-chain flipping in the adenylation reaction, changing from hydrogen-bonding with the α-phosphate in the ATP-bound structure to hydrogen-bonding with the endo-ring oxygen of the ribose moiety in the OSB-AMP-bound structure. Besides the dramatic changes identified above, more subtle changes are found for other conserved actives site residues (Figures 2D and 4B). These include Ser198, Ser293, and Gln294 in the binding site of the OSB moiety of the OSB-AMP intermediate, and Thr289 as well as Thr152 and Thr153 at the N-terminus of the P-loop. The remaining active site residues, such as those involved in binding and stabilization of the adenine moiety, are little changed. Notably, the Ser293 side chain forms a bidendate hydrogen bonding interaction with the OSB aromatic carboxylate in the previously determined bsMenE-OSB-AMP structure (chain B, 24) but flips away from this OSB aromatic carboxylate and forms no hydrogen bonds in the currently determined complex structure, suggesting that hydrogen bonding with Ser293 may help the succinyl group to relax from the eclipsed- to anti-conformation in the release of C-domain en route to the thioesterification conformation. Single substrate steady-state kinetics of bsMenE mutated at His196. The hydrogen bond between the stringently conserved bsMenE His196 and the carbonyl oxygen atom in OSBAMP is a strong indicator that the conserved histidine residue may be involved in stabilization of the transition state of the adenylation reaction. Similar hydrogen bonds have been observed in the previously determined bsMenE-OSB-AMP complex and in the structure of 4chlorobenzoate:CoA ligase (4CBL) complexed with 4-chlorobenzoyl adenylate (4CB-AMP) (17), although the hydrogen bonds are formed between the conserved histidine residue and the carboxyl (or ester) oxygen atom instead of the carbonyl oxygen atom as in these structures. In


Page 17 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

the thioesterification conformation of 4CBL (10), this conserved residue (His207) takes a different rotamer conformation and rotates its side chain imidazole away to make room for the thiol group of the CoA substrate in the thioesterfication reaction. Thus, this conserved residue in 4CBL was proposed to have double roles in both stabilizing the adenylation transition state and gating the access of CoA to the adenylate intermediate (17). Indeed, mutation of this residue to alanine or glutamine results in 200-500-fold decrease in kcat/KM for 4-chlorobenzoic acid, but smaller catalytic changes with other substrates (10). To further understand the catalytic role of this residue, we mutated it into phenylalanine, alanine, and glutamine, to observe the effects of mutation on the kinetic properties in bsMenE. These mutant proteins were readily prepared in high purity with a circular dichroism spectrum overlapping well with that of the wild-type protein, indicating that the point mutations have little effect on the overall conformation of the protein. The single-substrate steady-state kinetic parameters are presented in Table 3. Interestingly, neither kcat nor KM is substantially changed for the phenylalanine mutant, resulting in a small kcat/KM decrease of 2-4 fold. These small changes demonstrate that neither substrate binding nor the activation energy is significantly affected by the absence of a hydrogen bond between this residue (Phe is incapable of hydrogen bonding) and the adenylate intermediate, and strongly suggest against a role for His196 in stabilizing the adenylation transition state (Figure 2D and Figure 4B). In contrast, when His196 is mutated to alanine, kcat is decreased more than 100-fold with a significantly increased KM, resulting in a 390-620-fold kcat/KM decrease for all substrates rather than a similar efficiency decrease for the carboxylate substrate only, as seen for 4CBL (17). These dramatic effects show that the alanine mutation not only adversely affects the binding of all substrates but also increases the activation energy of the rate limiting step of the


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 42

MenE-catalyzed reaction. Meanwhile, the glutamine mutation has intermediate effects on catalysis, with deficits between those seen for the alanine and phenylalanine mutations. Combined together, these observed mutational effects are not related to a specific polar interaction, such as a hydrogen bond, but are correlated to the size and hydrophobicity of the side chain. To explain the activity dependence on size rather than hydrogen bonding of the His196 side chain, we propose that this residue plays a critical role in desolvation of the substrates and the adenylate intermediate to affect the substrate binding and activation energy of the adenylation reaction. When mutated to alanine, the desolvation effect of this residue is abolished to significantly affect binding of the substrates, particularly OSB (Table 3), and significantly alter the activation energy by stabilizing the ground state of the substrates. In contrast, when mutated to phenylalanine, the bulky and hydrophobic side chain retains the desolvation effect of the wildtype His196 residue so that very small effects were observed for all the substrates. To be consistent with the mutational effects, the observed hydrogen bond between His196 and the adenylate intermediate may play a nonessential role in facilitating the desolvation function of this conserved residue. Since the mutational effects observed here are different from those for 4CBL (10), it awaits further investigation to see whether a similar desolvation role holds for the corresponding aromatic residue in other ANL enzymes.

Discussion As an essential enzyme in vitamin K biosynthesis, OSB-CoA synthetase (MenE) has been extensively investigated for its kinetic properties, structure-function relationships and potential as a therapeutic target (5, 6, 20, 24). In this study, we determined the OSB-AMP bound


Page 19 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

bsMenE structure and found that it represents a new structural snapshot of the enzyme in its long catalytic path via the domain alteration mechanism. Through comparison with the existent MenE crystal structures, the newly determined structure is assigned to be the post-adenylation conformation before alteration of its C-domain to form the second active site for thioesterification, thus defining the end point of the adenylation reaction. The OSB moiety of the enzyme-bound OSB-AMP is found to locate inline but opposite to the β, γ-pyrophosphate leaving group of the ATP substrate in the pre-adenylation active conformation (Figure 4A), providing direct evidence for the inline backside nucleophilic substitution mechanism for the adenylation reaction. In addition, comparison of the nucleotide ligands in the pre- and postadenylation conformations provides the detailed structural change for the adenine monophosphate moiety during the adenylation reaction. Moreover, comparison of the pre- and post-adenylation conformations also reveals the structural changes of the active site residues directly involved in catalysis. Mutation of His196, which undergoes rotameric flipping in the complete reaction, has led to evidence for its involvement in the desolvation of the adneylation active site. These results have provided valuable mechanistic information about the adenylation reaction, which is inaccessible in previous crystal structures of various ANL enzymes in complex with the acyl-AMP intermediate or its analogs (8, 24, 49-50). The new bsMenE-OSB-AMP structure also provides valuable insights into how the enzyme recognizes and positions the OSB substrate for the adenylation reaction. First of all, the significant LLG loop movement to the OSB moiety of the OSB-AMP intermediate in comparison to the ATP-bound structure (Figure 4B) strongly suggests an induced-fit mechanism for OSB recognition. This structural change in the OSB binding site may underlie the different orientation of the succinyl group and the aromatic ring in the modeled OSB substrate (20)


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 42

relative to the OSB moiety in the OSB-AMP-bound structure. In addition, the same eclipsedconformation for the ethylene group in the modeled structure (20) and the OSB-AMP-bound structure strongly suggests that the OSB substrate is very likely to bind to the enzyme in a strained conformation as shown in the experimentally determined structure. Moreover, His196, which forms a hydrogen bond with the succinyl carbonyl oxygen atom in the OSB-AMP-bound structure, is also likely involved in binding and positioning the OSB aliphatic carboxylate group for reaction with ATP by flipping its imidazole side chain from the rotamer in the ATP-bound structure to the rotamer as found in the OSB-AMP-bound structure (Figure 2D and Figure 4B). This rotameric flipping of His196 expels water molecules from the bound OSB substrate and other parts of the active site most likely by forming a hydrogen bond with the OSB carboxylate, which is however suggested not to be catalytically essential by the kinetic analysis of sitespecific mutants at this position (Table 3). The recognition of the eclipsed-OSB substrate by bsMenE is unlikely to gain any catalytic advantage for the adenylation reaction because this unfavorable conformation is retained in the OSB-AMP product and its energy difference from the favorable anticonformation, which is similar to that of the same conformational rotation in the range of 3.0-3.5 kcal.mol-1 in butane (51), is small. It is a simple result of the special geometric arrangement of the amino acid residues at the binding site that is created by the ATP-dependent configuration of the adenylation active site (20). Nevertheless, the maintenance of this unfavorable conformation in the OSB-AMP intermediate in the currently determined structure is a strong indicator that enzyme takes the conformation before C-domain release compared to the previously determined bsMenE-OSB-AMP structure in which the OSB succinyl group takes a favorable anticonformation in both molecules of the asymmetric unit (24).


Page 21 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

The small energy difference between the eclipsed- and anti-conformations of OSB-AMP, however, is likely enough to break the interaction between the N- and C-domains of bsMenE. This is due to the very weak interdomain interaction in the eclipsed-OSB-AMP-bound bsMenE structure, in which a His333 to Tyr395 hydrogen bond and the 3.0Å hydrogen bond of Lys471 to the ribose endo-ring oxygen atom of the bound OSB-AMP (Figure 2I) are the only interdomain polar interactions. Other hydrogen bonds between the conserved linker residue Arg382 and the ribose 2’-OH in the OSB-AMP (Figure 2H), Gly333 and Asp367 may also contribute to stabilization of the domain interface. In consideration of these experimental observations, the eclipsed- to anti-conformational change of the OSB-AMP intermediate is proposed to drive the C-domain release. This conformational change of the adenylate intermediate is likely facilitated by formation of a new hydrogen bond between the rotated OSB aromatic carboxylate and the Ser293 side chain as observed in chain B of the previously determined bsMenE-OSB-AMP structure (24). This rotational isomerization of the ethylene moiety may cause subtle structural changes that perturb other parts of the OSB-AMP intermediate and break the hydrogen bonds at Lys471 and Arg382, thus forming the first intermediate conformation in the C-domain release process as captured in chain B of the previously determined bsMenE-OSB-AMP structure, in which no hydrogen bond is formed between the bound OSB-AMP and Lys471 or Arg382 (24). Subsequently, the released C-domain is free to rotate around the Ser384 hinge to take many possible conformations, of which one is captured with a large interdomain distance in chain A of the previously determined bsMenE-OSB-AMP structure (24). Binding of the third substrate, CoA, may stabilize the enzyme in its thioesterification conformation for catalysis of the second step reaction.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 42

The definition of the OSB-AMP-bound bsMenE structure as the adenylation end-point structure not only defines the overall conformational change of the enzyme in the first halfreaction and the subsequent domain alteration, it also helps to define the trajectory of a few highly dynamic amino acid residues that play a key role in the domain alteration catalytic mechanism. The first residue is the strictly conserved Arg382 in the linker region, which has been shown to be critical to formation of the adenylation active site by controlling the C-domain orientation via a strong salt bridge to the β-phosphate of ATP (20). From the new OSB-AMPbound structure, it is now known that loss of this strong interaction after release of the pyrophosphate product does not automatically disassemble the adenylation active site, but serves simply to greatly weaken its control of the C-domain orientation by forming a hydrogen bond to the ribose 2’-OH in the OSB-AMP. The subtle conformational change of the OSB-AMP intermediate eventually breaks up the hydrogen bond at this linker residue to fully release the Cdomain for transition to the second active conformation. Thus, the new OSB-AMP-bound bsMenE structure adds a new step in the previously proposed disassembly mechanism of the adenylation active site, which was proposed to totally depend on the loss of the Arg382 hydrogen bond with ATP (20). Another notable amino acid residue is Lys471, which is also strictly conserved among all ANL enzymes and has been proposed to play a critical role in stabilizing the transition state of the adenylation reaction. In the previously determined bsMenE-ATP structure (20), this residue forms a hydrogen bond with the α-phosphate of ATP and provides strong support for its catalytic role in stabilizing the transition state. In the new OSB-AMP-bound structure, the side chain of this residue moves away from α-phosphate of the AMP moiety and forms a hydrogen bond with the ribose endo-oxygen atom (Figure 4I). This indicates that the Lys471 side chain is highly


Page 23 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

mobile and continuously changes its position with the α-phosphate when the AMP moiety rotates around the adenine ring (Figure 4A) as the adenylation reaction proceeds, in order to maintain its stabilizing hydrogen bond with the developing negative charge on the reactive α-phosphate group. Thus, the end-point structure provides an important constraint for the trajectory of the positive Lys471 side chain in the adenylation process. In contrast, this conserved lysine residue remains hydrogen-bonded to the α-phosphate in other acyl-AMP-bound structures (49-51), suggesting that its side chain undergoes much less movement during the reaction. This discrepancy likely arises from the crystallization conditions used in determination of our bsMenE-OSB-AMP structure, which are closely similar to those used for the bsMenE-ATP structure determination and thus constrict the enzyme in a conformation closely resembling the bsMenE-ATP structure that traps the OSB-AMP intermediate in a strained conformation. In contrast, other acyl-AMP-bound enzyme crystals were grown under very different conditions in previous studies to allow the enzyme to take a more energetically favorable conformation with its C-domain released to a certain degree, as seen in the previously determined bsMenE-OSBAMP structure (24). Therefore, the reaction-dependent movement of Lys471 inferred from the new OSB-AMP-bound structure is a better reflection of its structural changes during the adenylation reaction. In summary, we have determined a new post-adenylation structure of bsMenE in complex with the adenylate intermediate, OSB-AMP, which is judged to have a negligible level of Cdomain release. By comparison to the ATP-bound, pre-adenylation bsMenE structure, structural changes in reactants were identified to be coupled to the progression of the reaction, providing direct evidence for the in-line backside nucleophilic substitution mechanism for the adenylation half-reaction. In addition, structural analysis and mutational studies have also revealed details of


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 42

how the enzyme active site changes to accommodate and facilitate the structural changes of the reactants to achieve maximum catalytic efficiency. Moreover, through structural comparison and analysis, this new post-adenylation structure has suggested the first model for release of Cdomain in its transition to form the thioesterification active site for a member in the ANL enzyme family. These novel mechanistic insights allows better understanding of the domain alternation catalytic mechanism of the ANL enzymes at the atomic level.

ACKNOWLEDGMENT We are grateful for access to beamline BL17U1 at Shanghai Synchrotron Radiation Facility (SSRF) and BL19U at National Center for Protein Science Shanghai (NCPSS). We also thank the beamline staff for on-site technical support.

REFERENCES 1. Gulick, A. M. (2009) Conformational dynamics in the acyl-CoA synthetases, adenylation domains of nonribosomal peptide synthetases, and firefly luciferase. ACS Chem. Biol. 4, 811–827. 2. Akerley, B. J., Rubin, E. J., Novick, V. L., Amaya, K., Judson, N., and Mekalanos, J. J. (2002) A genome-scale analysis for identification of genes required for growth or survival of Haemophilus influenzae. Proc. Natl. Acad. Sci. USA 99, 966–971. 3.

Forsyth, R. A., Haselbeck, R. J., Ohlsen, K. L., Yamamoto, R. T., Xu, H., Trawick, J. D., Wall, D., Wang, L., Vickie, B. D., Froelich, J. M., Kedar, G. C., King, P., McCarthy, M., Malone, C., Misiner, B., Robbins, D., Tan, Z., Zhu, Z., Carr, G., Mosca, D. A., Zamudio, C.,


Page 25 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Foulkes, J. G., and Zyskind, J. W. (2002). A genome-wide strategy for the identification of essential genes in Staphylococcus aureus. Mol. Microbiol. 43, 1387–1400. 4. Kobayashi, K., Ehrlich S. D., Albertini, A., Amati, G., Andersen, K. K., Arnaud, M., Asai, K., Ashikaga, S., Aymerich, S., Bessieres, P., Boland, F., Brignell, S. C., Bron, S., Bunai, K., Chapuis, J., Christiansen, L. C., Danchin, A., Débarbouille, M., Dervyn, E., Deuerlin, E., Devine, K., Devine, S. K., Dreesen, O., Errington, J., Fillinger, S., Foster, S. J., Fujita, Y., Galizzi, A., Gardan, R., Eschevins, C., Fukushima, T., Haga, K., Harwood, C. R., Hecker, M., Hosoya, D., Hullo, M. F., Kakeshita, H., Karamata, D., Kasahara, Y., Kawamura, F., Koga, K., Koski, P., Kuwana, R., Imamura, D., Ishimaru, M., Ishikawa, S., Ishio, I., LeCoq, D., Masson, A., Mauël, C., Meima, R., Mellado, R. P., Moir, A., Moriya, S., Nagakawa, E., Nanamiya, H., Nakai, S., Nygaard, P., Ogura, M., Ohanan, T., O'Reilly, M., O'Rourke, M., Pragai, Z., Pooley, H. M., Rapoport, G., Rawlins, J. P., Rivas, L. A., Rivolta, C., Sadaie, A., Sadaie, Y., Sarvas, M., Sato, T., Saxild, H. H., Scanlan, E., Schumann, W., Seegers, J. F., Sekiguchi, J., Sekowska, A., Séror, S. J., Simon, M., Stragier, P., Studer, R., Takamatsu, H., Tanaka, T., Takeuchi, M., Thomaides, H. B., Vagner, V., vanDijl, J. M., Watabe, K., Wipat, A., Yamamoto, H., Yamamoto, M., Yamamoto, Y., Yamane, K., Yata, K., Yoshida, K., Yoshikawa, H., Zuber, U., and Ogasawara, N. (2003) Essential Bacillus subtilis genes. Proc. Natl. Acad. Sci. USA 100, 4678–4683. 5. Tian, Y., Suk, D.-H., Cai, F., Crich, D., and Mesecar, A. D. (2008) Bacillus anthracis osuccinylbenzoyl-CoA synthetase: Reaction kinetics and a novel inhibitor mimicking its reaction intermediate. Biochemistry 47, 12434–12447.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 42

6. Lu, X., Zhou, R., Sharma, I., Li, X., Kumar, G., Swaminathan, S., Tonge, P. J., and Tan, D. S. (2012) Stable analogues of OSB-AMP: potent inhibitors of MenE, the o-succinylbenzoateCoA synthetase from bacterial menaquinone biosynthesis. ChemBioChem 13, 129–136. 7. Conti, E., Franks, N. P., and Brick, P. (1996) Crystal structure of firefly luciferase throws light on a superfamily of adenylate-forming enzymes. Structure 4, 287–298. 8. Conti, E., Stachelhaus, T., Marahiel, M. A., and Brick, P. (1997) Structural basis for the activation of phenylalanine in the nonribosomal biosynthesis of gramicidin S. EMBO J. 16, 4174–4183. 9. Gulick, A. M., Starai, V. J., Horswill, A. R., Homick, K. M., and Escalante-Semerena, J. C. (2003) The 1.75 Å crystal structure of acetyl-CoA synthetase bound to adenosine-5'propylphosphate and coenzyme A. Biochemistry 42, 2866–2873. 10. Wu, R., Cao, J., Lu, X., Reger, A. S., Gulick, A. M., and Dunaway-Mariano, D. (2008) Mechanism of 4-chlorobenzoate: coenzyme A ligase catalysis. Biochemistry 47, 8026–8039. 11. Reger, A. S., Carney, J. M., and Gulick, A. M. (2007) Biochemical and crystallographic analysis of substrate binding and conformational changes in acetyl-CoA synthetase. Biochemistry 46, 6536–6546. 12. Branchini, B. R., Southworth, T. L., Murtiashaw, M. H., Wilkinson, S. R., Khattak, N. F., Rosenberg, J. C., and Zimmer, M. (2005) Mutagenesis evidence that the partial reactions of firefly bioluminescence are catalyzed by different conformations of the luciferase C-terminal domain. Biochemistry 44, 1385–1393. 13. Drake, E. J., Nicolai, D. A., and Gulick, A. M. (2006) Structure of the EntB multidomain nonribosomal peptide synthetase and functional analysis of its interaction with the EntE adenylation domain. Chem. Biol. 13, 409–419.


Page 27 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

14. Sundlov, J. A., Fontaine, D. M., Southworth, T. L., Branchini, B. R., and Gulick, A. M. (2012) Crystal structure of firefly luciferase in a second catalytic conformation supports a domain alternation mechanism. Biochemistry 51, 6493–6495. 15. Yonus, H., Neumann, P., Zimmermann, S., May, J. J., Marahiel, M. A., and Stubbs, M. T. (2008) Crystal structure of DltA. Implications for the reaction mechanism of non-ribosomal peptide synthetase adenylation domains. J. Biol. Chem. 283, 32484–32491. 16. Du, L., He, Y., Luo, Y. (2008) Crystal structure and enantiomer selection by D-alanyl carrier protein ligase DltA from Bacillus cereus. Biochemistry 47, 11473–11480. 17. Reger, A. S., Wu, R., Dunaway-Mariano, D., and Gulick, A. M. (2008) Structural characterization of a 140° domain movement in the two-step reaction catalyzed by 4chlorobenzoate:CoA ligase. Biochemistry 47, 8016–8025. 18. Gulick, A. M., Lu, X., and Dunaway-Mariano, D. (2004) Crystal structure of 4chlorobenzoate:CoA ligase/synthetase in the unliganded and aryl substrate-bound states, Biochemistry 43, 8670–8679. 19. Kochan, G., Pilka, E. S., von Delft, F., Oppermann, U., and Yue, W. W. (2009) Structural snapshots for the conformation-dependent catalysis by human medium-chain Acyl-coenzyme A synthetase ACSM2A. J. Mol. Biol. 388, 997–1008. 20. Chen, Y. Z., Sun, Y. R., Song, H. G., and Guo, Z. (2015) Structural basis for the ATPdependent configuration of adenylation active site in Bacillus subtilis o-succinylbenzoylCoA synthetase. J. Biol. Chem. 290, 23971–23983. 21. Law, A., and Boulanger, M. J. (2011) Defining a structural and kinetic rationale for paralogous copies of phenylacetate-CoA ligases from the cystic fibrosis pathogen Burkholderia Cenocepacia J2315. J. Biol. Chem. 286, 15577–15585.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 42

22. Osman, K. T., Du, L., He, Y., and Luo, Y. (2009) Crystal structure of Bacillus cereus Dalanyl carrier protein ligase (DltA) in complex with ATP. J. Mol. Biol. 388, 345–355. 23. Hisanaga, Y., Ago, H., Nakagawa, N., Hamada, K., Ida, K., Yamamoto M, Hori T, Arii Y, Sugahara M, Kuramitsu S, Yokoyama S, and Miyano M. (2004). Structural basis of the substrate specific two-step catalysis of long chain fatty acyl-CoA synthetase dimer. J. Biol. Chem. 279, 31717–31726. 24. Tian Y. (2008) The reaction kinetics, crystal structures and novel inhibitors of bacterial OSBCoA synthetase. Doctor of Philosophy in Pharmacognosy, University of Illinois at Chicago. 25. Matarlo, J. S., Evans, C. E., Sharma, I., Lavaud, L. J., Ngo, S. C., Shek, R., Rajashankar, K. R., Frenc, J. B., Tan, D. S., and Tonge, P. J. (2015) Mechanism of MenE inhibition by acyl-adenylate analogues and discovery of novel antibacterial agents. Biochemistry 54, 6514– 6524. 26. Jiang, M., and Guo Z. (2007) Effects of macromolecular crowding on the intrinsic catalytic efficiency and structure of enterobactin-specific isochorismate synthase. J. Am. Chem. Soc. 129, 730–731. 27. Jiang, M., Cao, Y., Guo, Z.-F., Chen, M., Chen, X., and Guo, Z. (2007) Menaquinone biosynthesis in Escherichia coli: Identification of 2-succinyl-5-enolpyruvyl-6-hydroxyl-3cyclohexene-1-carboxylate (SEPHCHC) as a novel intermediate and re-evaluation of MenD activity. Biochemistry 46, 10979–10989. 28. Jiang, M., Chen, M., Cao, Y., Yang, Y., Sze, K. H., Chen, X., and Guo, Z. (2007) Determination of the stereochemistry of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene -1- carboxylic acid, a key intermediate in menaquinone biosynthesis. Org. Lett. 9, 4765– 4767.


Page 29 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

29. Jiang, M., Chen X., Guo Z.-F., Cao Y., Chen M., and Guo, Z. (2008) Identification and characterization

of

(1R,

6R)-2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate

synthase in the menaquinone biosynthesis of Escherichia coli. Biochemistry 47, 3426–3434. 30. Jiang, M., Chen, X., Wu, X. H., Chen, M., Wu, Y., and Guo, Z. (2009) Catalytic mechanism of SHCHC synthase in the menaquinone biosynthesis of Escherichia coli: Identification and mutational analysis of the active site residues. Biochemistry 48, 6921–6931. 31. Sun, Y., Yin, S., Feng, Y., Li, J., Zhou, J., Liu, C., Zhu, G., and Guo, Z. (2014) Molecular basis of the general base catalysis of an α/β-hydrolase catalytic triad. J. Biol. Chem. 289, 15867−15879. 32. Jiang, M., Chen, M., Guo, Z. F., and Guo, Z. (2010) A bicarbonate cofactor modulates 1, 4dihydroxy-2- naphthoyl coenzyme A synthase in menaquinone biosynthesis of Escherichia coli. J. Biol. Chem. 285, 30159–30169. 33. Sun, Y., Song, H., Li, J., Jiang, M., Li, Y., Zhou, J., and Guo, Z. (2012) Active site binding and catalytic role of bicarbonate in 1, 4-dihydroxy-2-naphthoyl coenzyme A synthases from vitamin K biosynthetic pathways. Biochemistry 51, 4580–4589. 34. Chen, M., Jiang, M., Sun, Y., Guo, Z. F., and Guo, Z. (2011) Stabilization of the second oxyanion intermediate by 1,4-dihydroxy-2-naphthoyl coenzyme A synthase of the menaquinone pathway: Spectroscopic evidence of the involvement of a conserved aspartic acid. Biochemistry 50, 5893–5904. 35. Otwinowski, Z., and Minor, W. (1997) Processing of X-ray diffraction data collected in oscillation mode. Method Enzymol. 276, 307–326. 36. Adams, P. D., Afonine, P. V., Bunkoczi, G., Chen, V. B., Davis, I. W., Echols, N., Headd, J. J., Hung, L. W., Kapral, G. J., Grosse-Kunstleve, R. W., McCoy, A. J., Moriarty, N. W.,


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 42

Oeffner, R., Read, R. J., Richardson, D. C., Richardson, J. S., Terwilliger, T. C., and Zwart, P. H. (2010) PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr. D 66, 213–221. 37. Kantardjieff, K. A., and Rupp, B. (2003) Matthews coefficient probabilities: Improved estimates for unit cell contents of proteins, DNA, and protein-nucleic acid complex crystals. Protein Sci. 12, 1865–1871. 38. Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. D 53, 240–255. 39. Bailey, S. (1994) The Ccp4 Suite - Programs for Protein Crystallography. Acta Crystallogr. D 50, 760–763. 40. Echols, N., Moriarty, N. W., Klei, H. E., Afonine, P. V., Bunkoczi, G., Headd, J. J., McCoy, A. J., Oeffner, R. D., Read, R. J., Terwilliger, T. C., and Adams, P. D. (2014) Automating crystallographic structure solution and refinement of protein-ligand complexes. Acta Crystallogr. D 70, 144–154. 41. Schuttelkopf, A. W., and van Aalten, D. M. F. (2004) PRODRG: a tool for high-throughput crystallography of protein-ligand complexes, Acta Crystallogr. D 60, 1355–1363. 42. Moriarty, N. W., Grosse-Kunstleve, R. W., and Adams, P. D. (2009) electronic Ligand Builder and Optimization Workbench (eLBOW): a tool for ligand coordinate and restraint generation. Acta Crystallogr. D 65, 1074–1080. 43. Emsley, P., Lohkamp, B., Scott, W. G., and Cowtan, K. (2010) Features and development of Coot. Acta Crystallogr. D 66, 486–501.


Page 31 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

44. Laskowski, R. A., Macarthur, M. W., Moss, D. S., and Thornton, J. M. (1993) Procheck - a Program to Check the Stereochemical Quality of Protein Structures. J Appl. Crystallogr. 26, 283–291. 45. Chen, V. B., Arendall, W. B., Headd, J. J., Keedy, D. A., Immormino, R. M., Kapral, G. J., Murray, L. W., Richardson, J. S., and Richardson, D. C. (2010) MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr. D 66, 12–21. 46. DeLano, W. L. (2002) The PyMOL Molecular Graphics System. In DeLano Scientific, San Carlos, CA. 47. Krissinel, E., and Henrick, K. (2007) Inference of macromolecular assemblies from crystalline state. J. Mol. Biol. 372, 774–797. 48. Dolinsky, T. J., Nielsen, J. E., McCammon, J. A., Baker, N. A. (2004) PDB2PQR: an automated pipeline for the setup, execution, and analysis of Poisson-Boltzmann electrostatics calculations. Nucleic Acids Res. 32, W665–W667. 49. May, J. J., Kessler, N., Marahiel, M. A., and Stubbs, M. T. (2002) Crystal structure of DhbE, an archetype for aryl acid activating domains of modular nonribosomal peptide synthetases. Proc. Natl. Acad. Sci. USA 99, 12120–12125. 50. Jogl, G., and Tong, L. (2004) Crystal structure of yeast acetyl-coenzyme A synthetase in complex with AMP. Biochemistry 43, 1425–1431. 51. Viskolcz, B., Fejer, S. N., and Csizmadia, I. G. (2006) Thermodynamic functions of conformational changes. 2. Conformational entropy as a measure of information accumulation. J. Phys. Chem. A 110, 3808–3813.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Tables Table 1. Statistics for data collection and refinement of Bacillus subtilis MenE-OSB-AMP. OSBAMP-bsMenE PDB ID Data collection Space Group a, b, c (Å) α, β, γ (°) Redundancy (%) Completeness (%)a Reflections (unique)a I/σIa Rmergea CC1/2

5GTD P43 121.8, 121.8, 98.5 90.0, 90.0, 90.0 3.2 (3.6) 99.17 (98.75) 799140 (39783) 19.4 (3.2) 0.083 (0.738) 0.997 (0.868)

Refinement Resolution Range (Å) 31.96 - 2.69 No. of non-hydrogen Atoms 6494 Protein 6356 Water 45 Ligands/ions 93 2 b Average B Factor (Å ) Overall 81.86 N-domain (1-381) 76.51 C-domain (382-485) 103.29 ligand 66.69 Rwork/Rfree 0.1950/0.2295 RMSD for Ideal Value in Bond Length (Å) 0.012 o Bond Angle ( ) 1.31 Ramachandran statistics /%c 95.73 / 3.92 / 0.35 a Respective values for the highest resolution shell are given in parentheses. b

The B-factor values were calculated from the chain A of the bsMenE-OSB-AMP structure.


Page 32 of 42

Page 33 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

c

Ramachandran statistics indicate the fraction of residues in the most favored, allowed, and

disallowed regions of the Ramachandran diagram. Table 2. Differences in protein-ligand hydrogen bonds observed in two bsMenE-OSB-AMP complexes. Hydrogen bond donor/acceptora Protein Asp367-EO1 Asp367-EO2 Arg382-ηNH Thr289-βOH Ser293-βOH Ser293-βOH Gln294-1NH

a

Ligand ribose 3’-OH ribose 2’-OH ribose 2’-OH α-PO4 ACO1 ACO2 ACO1

Donor - Acceptor distance (Å) Structure A 2.2 3.1 3.0 3.0 NDc NDc 2.9

b

Structure B 2.8 2.9 NDc 2.9 3.0 2.8 3.3

b

The hydrogen bonds refer to the interactions shown in Figures 2H, 2I, and 2J with the same

atomic labels. b

Structure A is the bsMenE-OSB-AMP structure determined in this study and Structure B is

chain B of the bsMenE-OSB-AMP structure determined in Ref. 24. c

ND = not detected.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 42

Table 3. Single substrate kinetic parameter of wild type bsMenE and its mutants. Protein WT

H196F

H196A

H196Q

OSB ATP CoA OSB ATP CoA OSB ATP CoA OSB ATP CoA

in kcat/Km (M·min)-1 Fold kDecrease cat/Km

kcat (min-1)

KM (µM)

(7.2± 0.3) ×102 (6.3 ± 0.2) ×102 (7.3 ± 0.8) ×102

44 ± 19 24 ± 4 (2.4 ± 0.8) ×102

(1.6 ± 0.6)×107 (2.7 ± 0.4)×107 (3.0 ± 0.6)×106

(2.6 ± 0.1) ×102 (3.6 ± 0.1) ×102 (3.1 ± 0.2) ×102

68 ± 7 41 ± 14 (2.1± 0.7) ×102

(3.9 ± 0.3)×106 (8.7 ± 2.4)×106 (1.5 ± 0.5)×106

4.2 3.1 2.0

6.2 ± 1.0 5.4 ± 0.3 5.6 ± 0.7

(2.4 ± 0.9) ×102 80 ± 17 (9.1 ± 2.6) ×102

(2.6 ± 0.6)×104 (6.8 ± 1.2)×104 (6.2 ± 1.2)×103

6.2 × 102 3.9 × 102 4.8 × 102

32 ± 2 26 ± 1 28 ± 1

(3.9 ± 0.4) ×102 (1.7 ± 0.3) ×102 (3.1 ± 0.4) ×102

(8.3 ± 0.4)×104 (1.5 ± 0.2)×105 (9.0 ± 1.0)×104

2.0 × 102 1.8 × 102 33


Page 35 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure legends: Figure 1. The two-step reaction catalyzed by OSB-CoA synthetase (MenE). OSB: osuccinylbenzoate; OSB-CoA: o-succinylbenzoyl-coenzyme A; ATP: adenosine 5’-triphosphate; AMP: adenosine 5’-monophosphate; CoA: coenzyme A. Figure 2. Crystal structure of the bsMenE-OSB-AMP complex. (A) Domain organization of bsMenE. (B) Overall architecture of the full-length subunit (chain A) in two perpendicular perspectives. The structure is colored according to the domains as shown in (A) and the OSBAMP intermediate is represented in sticks with pale green carbon atoms. (C) Electrostatic potential surface of the OSB-AMP binding pocket in the full-length subunit (chain A). (D) Stereo diagram of the ligand-protein interaction within the bsMenE-OSB-AMP active site. (E) SDS-PAGE result for bsMenE from the control (lane 1) and the bsMenE-OSB-AMP crystals (lane 2). (F) mFo-DFc electron density map of OSB-AMP in chain A (left) and chain B (right). The maps are calculated from the ligand-omitted model and contoured at 2.5σ. (G) Two views of the eclipsed conformation observed for the ethylene group in the succinyl moiety of OSB-AMP. (H), (I) and (J) show close-up views of the protein-ligand interactions at the ribose, phosphate, and OSB moieties of OSB-AMP. From (C) to (H), the ligand and the side chains of actives site residues in chain A are represented in sticks with green and pink carbon atoms, respectively. Oxygen, nitrogen, phosphorus and sulfur atoms are colored red, blue, orange and yellow, respectively, while hydrogen atoms are presented in white sticks on selected carbon atoms. Yellow dashed lines denote hydrogen bonds with a length ≤ 3.8 Å. Figure 3. Comparison of bsMenE-OSB-AMP with the bsMenE adenylation conformation. (A) Superposition of bsMenE-OSB-AMP (pink) and bsMenE-ATP (gray, PDB code 5BUR). Ndomain and C-domain are shown in loop and cylindrical-helices representations, respectively.


Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 42

The aligned ligands OSB-AMP and ATP are denoted in sticks in the inter-domain active site. (B) Superposition of the phosphate-binding loop (P-loop) of bsMenE-OSB-AMP (pink), bsMenEATP (gray, PDB code 5BUR) and bsMenE-AMP (cyan, PDB code 5BUS) complex structures. Several P-loop residues showing significant structural differences are denoted in sticks. Figure 4. Structural differences between bsMenE-OSB-AMP and bsMenE-ATP. (A) Relative positions of OSB-AMP and ATP in the superimposed structures. OSB-AMP and ATP are shown in green and gray sticks, respectively. The gap between two α-phosphates was depicted by yellow dashed lines in the left panel and the displacement of selected atoms in the AMP moieties is plotted against the distance from the C1 atom in the right panel. (B) Stereo diagram of the ligands and ligand binding sites in the superimposed complexes. The ligands are represented in sticks as in (A) and the active site residues are shown in pink sticks with hydrogen bonds denoted in yellow dashed lines in the bsMenE-OSB-AMP complex and in gray sticks with hydrogen bonds denoted in blue dashed lines in the bsMenE-ATP complex (PDB code: 5BUR). Only secondary structures showing significant changes in the superimposed structures are shown in cartoon with the same color as the stick representation. Figure 5. Stereo diagram of the superimposed OSB and OSB-AMP binding sites. OSB is modeled into its binding site in bsMenE-ATP as shown in Ref. # 20 and is represented in yellow sticks. The representation and color schemes are the same as in Figure 4 for the amino acid residues, OSB-AMP, ATP, and the bsMenE-OSB-AMP and bsMenE-ATP complexes.


Page 37 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Fig. 1. Adenylation step COO

NH2

COO COO

N

O O O P O O

ATP PPi

O

O

N

N

N

MenE Adenylation conformation

O

OSB-AMP

OSB

HO OH C-domain rotation

Thioesterification step NH2

COO O

O O P O O

N O

N

CoA-SH COO O

N

SCoA

N

AMP

O

OSB-AMP

O

OSB-CoA

HO OH


MenE Thioesterification conformation

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48

Fig. 2.


Page 38 of 42

Page 39 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Fig. 3.


39

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 42

Fig. 4.


40

Page 41 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Fig. 5


41

Biochemistry

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 42 of 42

Graphic for the Table of Contents: Yaozhong Chen, Yiping Jiang, and Zhihong Guo*. Mechanistic insights from the crystal structure of Bacillus subtilis o-succinylbenzoyl-CoA synthetase complexed with the adenylate intermediate.


42

Mechanistic Insights from the Crystal Structure of ... - ACS Publications

Recommend Documents