Metabolism of Inorganic Arsenic in Intestinal Epithelial Cell Lines

Sep 19, 2012 - (iAs) [As(III) and As(V)] in human intestinal cells as a function of cell ... (absorptive type) and HT29-MTX (goblet type) cells were e...
0 downloads 0 Views 502KB Size
Download PDF
Article pubs.acs.org/crt

Metabolism of Inorganic Arsenic in Intestinal Epithelial Cell Lines M. Calatayud, D. Vélez, and V. Devesa* Instituto de Agroquímica y Tecnología de Alimentos (IATA-CSIC), Avenida Agustín Escardino No. 7, 46980 Paterna, Valencia, Spain ABSTRACT: This study evaluates the metabolism of inorganic arsenic (iAs) [As(III) and As(V)] in human intestinal cells as a function of cell type, differentiation stage, type of support used for cell growth, and exposure time. Additionally, mRNA expression of arsenic (+3 oxidation state) methyltransferase (AS3MT) was evaluated. For this purpose, Caco-2 (absorptive type) and HT29-MTX (goblet type) cells were exposed at various stages of differentiation (5, 15, and 21 days post-seeding) with different concentrations of As(III) and As(V) (1 and 10 μM) and exposure times (24, 48, and 72 h), using multiwell plates or Transwells. The results show that both cell lines express AS3MT at all stages of differentiation and in all culture conditions. Caco-2 cells are capable of metabolizing iAs, As(III) metabolism being greater than that observed for As(V). Metabolism depends on the stage of differentiation, reaching 36% after 48 h of exposure of differentiated cells (15 days post-seeding), with the monomethylated species as the major metabolite. Analysis of the cell interior shows that the metabolites are present predominantly in trivalent form. The type of support is also an important factor, metabolism being greater in multiwell plates than in Transwells (36 ± 6% vs 11 ± 3%). Neither monomethylated arsenic species (MMA) nor dimethylated arsenic species (DMA) are detected in HT29MTX cells after exposure to iAs, possibly because most of the iAs is retained in the mucus layer and does not internalize. These results show that the intestine is an organ that may take part in presystemic metabolism of iAs. Moreover, the transformation of iAs into more toxic species indicates the need to study the effects of this species on the intestinal epithelium.

■

INTRODUCTION In the past decade, inorganic As (iAs) [As(III) and As(V)], the major form of arsenic in drinking water and in some food products, has aroused the interest of the scientific community and international organizations responsible for food safety and health.1,2 It is listed as a human carcinogen3 and is also associated with other kinds of pathologies, such as skin lesions, cardiovascular and cerebrovascular pathologies, type 2 diabetes, respiratory illnesses, and neurobehavioral disorders in children.1,2 In recent years, studies have indicated that metabolism may be an important factor in the development of the toxic effects observed. A recent study by Kojima et al.4 shows that the metabolism of As(III) favors the induction of oxidative damage of DNA and accelerates cell transition to a cancerous phenotype in rat liver epithelial cells and transfected human urothelial cells with rat AS3MT. Various pathways have been proposed for the metabolism of iAs in humans,5 but they all coincide in the formation of monoand dimethylated intermediaries, in trivalent and pentavalent forms. The behavior of pentavalent metabolites is very different from that of their trivalent analogues, both in vitro and in vivo.6,7 The trivalent forms have a greater degree of cellular accumulation and higher toxicity, whether or not they form complexes with GSH.8−10 This difference between arsenic species resulting from the metabolism of iAs means that the extent of metabolism and the metabolic profile are determining factors in evaluating the risk associated with the ingestion of iAs. Various enzymes have been proposed as candidates for this © 2012 American Chemical Society

metabolic pathway, although in recent years there has been increasing support for the idea that arsenic (+3 oxidation state) methyltransferase (AS3MT), a protein with 375 amino acids rich in cysteine residues, is the enzyme that is mainly responsible for this pathway.11 In vitro studies of the metabolism of iAs have concentrated on target organs, especially urinary bladder cells and hepatic cells or rodent liver cytosol preparations.12−17 However, it is not known what happens in the intestinal epithelium, which is the first physiological barrier that a contaminant meets after ingestion. Presystemic metabolism takes place in the gastrointestinal tract and the liver, and the result is that part of the ingested compound reaches the systemic circulation in a modified form, which alters the effect that it may produce. Although hepatic metabolism is considered the most important, numerous metabolic reactions occur in the gut wall, including those typically referred to as phase 1 and phase 2 processes.18 Many metabolizing enzymes present in the liver are also found in the small intestine, although their levels are generally much lower in the latter than in the former.18 Recent studies in intestinal permeability of various forms of arsenic show that in vitro intestinal transport varies substantially, depending on oxidation state and degree of methylation.19,20 Consequently, changes in the form of arsenic in the intestinal epithelium may alter its permeability, increasing or Received: June 8, 2012 Published: September 19, 2012 2402

dx.doi.org/10.1021/tx300385y | Chem. Res. Toxicol. 2012, 25, 2402−2411

Chemical Research in Toxicology

Article

DMEMc for HT29-MTX. The cells were incubated at 37 °C, 5% CO2, and 95% relative humidity, with a change of medium every 2−3 days until cell differentiation was attained (15 days post-seeding). The cells were then exposed to two concentrations of As(III) or As(V) (1 and 10 μM) for 4, 6, 24, 48, and 72 h in minimal essential medium with Earle’s salts (MEM, PAA). Influence of GSH and Vitamin B12 (Cyanocobalamin) on the Metabolism of As(III) and As(V) in Differentiated Caco-2 Cells. The effect of GSH and vitamin B12 on the metabolism of As(III) and As(V) in differentiated Caco-2 cells (15 days post-seeding in 6-well plates) was studied by adding these compounds (1 mM GSH or 100 μg/mL vitamin B12) together with 1 μM As(III) or 10 μM As(V) in MEM and maintaining the exposure for 48 h. Metabolism of As(III) in Differentiated Caco-2 Cells as a Function of the Culture System Employed. These studies were conducted on differentiated Caco-2 cells (15 days post-seeding) exposed to 1 μM As(III) in MEM for 48 h. The influence of the type of cell support on the metabolism of As(III) was evaluated by comparing the results in 6-well plates and in a two-chamber Transwell system (semipermeable polyester membranes, diameter 24 mm, pore size 0.4 μm; Costar Corporation, USA). In the Transwell system, the cells are seeded on the porous membrane of the insert that separates the well into two compartments: apical (upper) and basal (lower). The cells were seeded on the apical side to produce monolayers of Caco-2, with the addition of 1.5 mL of DMEMc to the apical chamber and 2 mL to the basal chamber. Transepithelial electrical resistance, an index of confluence, tight junction formation, and monolayer integrity, was evaluated before and after the treatment with a Millicell-ERS (Millipore Corporation, USA). Metabolism of As(III) and As(V) as a Function of Differentiation State. In addition to the evaluation of metabolism at 15 days post-seeding, we conducted studies of metabolism at 5 days and 21 days post-seeding. The metabolism assays were conducted in 75cm2 flasks with cells at 5 days post-seeding and in 6-well plates with cells at 21 days post-seeding. In all cases, the cells were exposed to 1 μM As(III) or 10 μM As(V) for 24, 48, and 72 h in MEM. Influence of Mucus on Intracellular Accumulation of As(III) and As(V) in HT29-MTX Cell Line. The influence of the presence of the mucus monolayer on arsenic accumulation was studied with differentiated HT29-MTX cells (15 days post-seeding). The cells were seeded in 6-well plates and after differentiation were exposed for 24 h to 1 μM As(III) or 10 μM As(V) in MEM. After exposure, the medium was recovered, and the mucus layer was separated from the cell monolayer, using the method described by Mahler et al.21 with some modifications. Briefly, the monolayer was washed with 1.5 mL of 10 mM N-acetylcysteine (NAC) in Hank’s balanced salt solution (HBSS, PAA) at 37 °C with agitation (135 rpm) for 1 h. Subsequently, the medium (HBSS + NAC) was recovered to quantify arsenic contents in mucus. Mucus removal was verified by alcian blue staining of the monolayer after the washing procedure. Sample Collection and Preparation: Determination of Total Arsenic and Arsenic Species. After the various treatments, the culture media were recovered, and the cells were washed three times with Dulbecco’s phosphate buffered solution (DPBS, PAA), scraped, and lysed with 1% Triton X-100 (Merck, Germany). The concentrations of total arsenic and arsenical forms were determined in the media, the cell lysates, and the mucus layer. The total arsenic concentration was quantified using Zeeman graphite furnace atomic absorption spectrometry, GF-AAS (model AAnalyst 600, Perkin-Elmer), following the protocol described by Calatayud et al.19 The arsenic species were determined by hydride generation (HG)−cold trap (CT)−atomic absorption spectrometry (AAS),22 using a Perkin-Elmer model 3300 atomic absorption spectrometer (Perkin-Elmer Hispania, S.A., Spain). Using this technique at pH 1, the total inorganic [As(V) and As(III)], monomethylated [MMA(V) and MMA(III)], and dimethylated [DMA(V) and DMA(III)] forms are quantified without distinguishing oxidation states; whereas at pH 6, only trivalent forms [As(III), MMA(III) and DMA(III)] are determined. In the present study, the arsenical forms of all the samples (media and cells) were quantified using this technique at pH

decreasing its final bioavailability (the fraction of a compound that reaches the systemic circulation after ingestion). Moreover, it has also been shown that cellular or tissular accumulation depends on the species of arsenic8,9 so that intestinal metabolism might also alter the accumulation and possible effects of the metalloid on the intestinal epithelium. The aim of the present study was to evaluate the intestinal metabolism of arsenite [As(III)] and arsenate [As(V)] in two cell lines derived from colon adenocarcinoma and widely used as models of the intestinal epithelium, Caco-2 (absorptive cells) and HT29-MTX (goblet cells). Metabolism was evaluated as a function of cell monolayer differentiation state, cell type, exposure time, type of support employed for cell growth, and the presence of dietary components (GSH and vitamin B12). Cellular accumulation of the inorganic forms and their metabolites and levels of expression of AS3MT were also studied.

■

MATERIALS AND METHODS

Arsenical Species. The As(V) standard solution (H3AsO4, 1000 mg/L) was acquired from Merck (Merck, Darmstadt, Germany). The As(III) standard (1000 mg/L) was prepared by dissolving 1.320 g of As2O3 (Riedel de Haën, Germany) in 25 mL of KOH at 20% (m/v), neutralizing with 20% H2SO4 (v/v) and making up to a final volume of 1 L with 1% H2SO4 (v/v). The standard solutions of MMA(V) and DMA(V) (1000 mg/L) were prepared by dissolving the appropriate amount of the following salts in water: CH3AsO(ONa)2·6H2O for MMA(V) (Carlo Erba, Italy) and (CH3)2AsNaO2·3H2O for DMA(V) (Fluka Chemika Biochemika, Spain). These standard stock solutions were kept at 4 °C until use. The standard stock solutions of monomethylarsonous acid [MMA(III)] and dimethylarsinous acid [DMA(III)] (1000 mg/L) were prepared daily from CH3AsI2 and (CH3)2AsI (Argus Chemicals, Vernio, Italy) respectively. Working standards of arsenic species were prepared before use from stock solutions. Cell Culture. The Caco-2 cells were acquired from the European Collection of Cell Cultures (ECACC; number 86010202, Salisbury, UK). For the present study, cells were used between passages 5 and 25. Cell maintenance was carried out in 75-cm2 flasks in Dulbecco’s modified Eagle's medium (DMEM) high glucose (4.5 g/L). DMEM was supplemented with 10% (v/v) of fetal bovine serum, 1% (v/v) of nonessential amino acids, 1 mM sodium pyruvate, 10 mM HEPES (N2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid), 100 U/mL of penicillin, 0.1 mg/mL of streptomycin, and 0.0025 mg/L of amphotericin B (DMEMc). The HT29-MTX cells were kindly provided by Dr. Thécla Lesuffleur (Institut National de la Santé et de la Recherche Médicale, INSERM UMR S 938, Paris, France). For the assays, cells were used between passages 20 and 30. Cell maintenance was carried out in 25cm2 flasks to which 5 mL of DMEM high glucose (4.5 g/L) was added, supplemented with 10% (v/v) of fetal bovine serum, 1 mM sodium pyruvate, 10 mM HEPES, 100 U/mL of penicillin, 0.1 mg/mL of streptomycin, and 0.0025 mg/L of amphotericin B (HT-DMEMc). Both cell lines were incubated at 37 °C in an atmosphere with 95% relative humidity and a CO2 flow of 5%. The medium was changed every 2−3 days. When the cell monolayer reached 80% confluence, the cells were detached with a solution of trypsin (0.5 mg/L) and EDTA (0.22 g/L) and reseeded at a density of 5 × 104 cells/cm2. All of the reagents used were acquired from PAA Laboratories GmbH (Germany). For all of the assays described in the following sections, a seeding density of 7.5 × 104 cells/cm2 was maintained, irrespective of the support employed. Confluent cell monolayers were obtained within 4 to 5 days after seeding. Evaluation of the Metabolism of As(III) and As(V) in Differentiated Caco-2 and HT29-MTX Cells as a Function of Exposure Time. Cells were seeded in 6-well plates in the corresponding culture medium: DMEMc for Caco-2 and HT2403

dx.doi.org/10.1021/tx300385y | Chem. Res. Toxicol. 2012, 25, 2402−2411

Chemical Research in Toxicology

Article

Table 1. Oligonucleotide Sequences, Efficacies, and Relative mRNA Expression of Differentiation Markers (Mean ± Standard Deviation, n = 6) in Caco-2 and HT29-MTX Cells at Various Stages of Differentiationa cell line Caco-2

HT29-MTX

gen

primer sequence

efficacy

days post-seeding

ALPI NM_001631 DPP4 NM_001935 SI NM_001041 MUC5AC XM_001130382

F: GTGCGACCAGACGTGAATGA R: CCATGACATGCGCTACGAA F: GTGGCGTGTTCAAGTGTGG R: CAAGGTTGTCTTCTGGAGTTGG F: AAATCAGACACCCAATCGTTTCC R: GGGCAACCTTCACATCATACAA F: CCTTCGACGGACAGAGCTAC R: TCTCGGTGACAACACGAAAG

1.88 ± 0.21

15 21 15 21 15 21 15 21

2.01 ± 0.32 2.12 ± 0.17 1.84 ± 0.25

expression ratio (2-log scale) 8.6 5.2 5.5 2.6 5.0 5.9 3.2 6.6

± ± ± ± ± ± ± ±

3.5* 2.4* 2.3* 1.1* 2.0* 2.6* 0.3* 1.6*

a

mRNA expression at 15 and 21 days post-seeding has been relativized with respect to mRNA expression at 5 days post-seeding. Statistically significant differences are marked with an asterisk (p < 0.05).

1. In addition, at 15 days post-seeding the arsenic present inside Caco2 cells exposed to 1 μM As(III) or 10 μM As(V) was quantified at pH 6. All of the results were standardized in terms of mg of protein determined by Bio-Rad Protein Assay (Bio-Rad, USA). The primary methylation rate [MMA (cells + medium)/total iAs (cells + medium)] and secondary methylation rate [DMA (cells + medium)/total MMA (cells + medium)] were also calculated. In all the assays conducted, a mass balance was performed, comparing the total arsenic added to the cells initially and determined by graphite furnace and the total arsenic obtained as the sum of species (iAs + MMA + DMA) after analysis of the cells and medium by HG-CT-AAS at pH 1. Relative mRNA Expression of AS3MT in Caco-2 and HT29MTX cells by Reverse Transcription−Quantitative Polymerase Chain Reaction (RT-qPCR). mRNA expression of AS3MT was evaluated at various differentiation stages of Caco-2 cells not treated with arsenic. Cells were seeded in the corresponding medium (DMEMc or HT-DMEMc). At 5, 15, or 21 days post-seeding, cells were recovered, and expression of AS3MT was evaluated. The data obtained at 15 and 21 days post-seeding were relativized with respect to the expression values obtained at 5 days post-seeding. RNA was extracted using a NucleoSpin RNA II kit (MachereyNagel, Germany). The RNA extracted was quantified spectroscopically in a Nanodrop ND-1000 (NanoDrop Technologies, USA), adjusting the samples with RNase-free water in order to work with the same concentrations. First-strand cDNA (cDNA) was obtained from 200 ng of total RNA using a Reverse Transcriptase Core kit (Eurogentec Headquarters, Belgium). To study the effect of exposure to arsenic on the expression of AS3MT, at 5, 15, or 21 days post-seeding cells were exposed to 1 μM As(III) or 10 μM As(V) in MEM for 24, 48, and 72 h. After this exposure time, the cells were recovered and RNA was extracted as described before. Cells not treated with arsenic and maintained in culture for 24, 48, and 72 h, like the treated cells, were used as controls. qPCR was performed using LightCycler 480 Real-Time PCR System (Roche Diagnostics, Indianapolis, IN, USA). Reactions were carried out in a 20 μL final volume containing 10 μL of LightCycler 480 SYBR Green I Master Mix (2×, Roche), 5 μL of cDNA (20 ng/ μL), and 2 μL of each forward and reverse primers (10 μM; Biolegio, The Netherlands) and nuclease-free water. No-template controls were run to verify the absence of genomic DNA. The oligonucleotides used for AS3MT were the following: forward, 5′-CGTCTATACGAGCCTTGAAC-3′; reverse, 5′-AACGACAGTCACCGATAA-3′.15 RN18S was used as a reference gene (forward, 5′-CATGTGCAAGGCCGGCTTCG-3′; reverse, 5′-GAAGGTGTGGTGCCAGATTT-3′). PCR efficiency curves for each gene were calculated using five duplicate 2-fold dilutions. The qPCR conditions were 95 °C for 5 min, followed by 40 cycles: 10 s denaturation at 95 °C, 10 s annealing at 55 °C, and 20 s elongation at 72 °C. The melting curve of each sample was analyzed after every PCR run to confirm PCR product specificity. Data were analyzed with Relative Expression Software Tool (REST 2009,

QIAGEN). All of the experiments were performed in quadruplicate on two separate days. Relative mRNA Expression of Differentiation Markers in Caco-2 and HT29-MTX Cells by RT-qPCR. At 5, 15, and 21 days post-seeding, mRNA expression of intestinal alkaline phosphatase (ALPI), dipeptidyl peptidase-4 (DPP4), and sucrase isomaltase (SI) was evaluated in Caco-2 cells and MUC5AC mucin in HT29-MTX as cell differentiation markers.23,24 The data obtained at 15 and 21 days post-seeding were relativized with respect to the expression values obtained at 5 days post-seeding. The oligonucleotides used and the efficacy values are presented in Table 1. Cell Viability. After the various treatments, cell viability was evaluated by trypan blue staining (0.4% v/v, Sigma) after recovery of the cells by treating with trypsin (0.5 mg/L) and EDTA (0.22 g/L). Statistical Analysis. All of the assays were performed at least in triplicate in independent cultures. The results were analyzed statistically by a one-factor analysis of variance (ANOVA) with Tukey’s HSD post-hoc multiple comparison (SPSS, version 15.0). Differences were considered significant when p < 0.05.

■

RESULTS The mass balance of the assays conducted shows recoveries ranging between 85 and 115%. Moreover, the cell viability assays show that the work was done in sublethal conditions in all cases. Relative Expression of mRNA of Differentiation Markers in Caco-2 and HT29-MTX Cells by RT-qPCR. Many studies show that after reaching confluence, Caco-2 cells and HT29-MTX differentiate progressively until they acquire the typical characteristics of differentiated enterocyte or mucussecreting cells, respectively.21,23 In order to confirm this, we evaluated the gene expression of several widely used cell differentiation markers, ALPI, SI, and DPP4 for Caco-2 and MUC5AC for HT29-MTX. The results show that the expression levels of these genes increase with cell culture maintenance time (Table 1). In all of the assays that we conducted, gene expression of ALPI, SI, and DPP4 was higher in Caco-2 cells at 15−21 days post-seeding than in Caco-2 cells at 5 days post-seeding (2.6- to 8.6-fold change on a 2-log scale). In HT29-MTX, mRNA levels of MUC5AC were higher in differentiated cells than in cells at 5 days post-seeding (3.2- to 6.6-fold change on a 2-log scale). These data confirm that there is a greater degree of differentiation in cells at 15 and 21 days post-seeding than in cells at 5 days post-seeding. Effect of Exposure Time on the Metabolism of Differentiated Intestinal Cells (15 Days Post-Seeding). The results obtained show that the metabolism of the inorganic forms is only detectable after 24 h of exposure. At shorter times (4 and 6 h), the metabolism of As(III) or As(V) was not observed. Table 2 shows the amount of arsenic species (cell 2404

dx.doi.org/10.1021/tx300385y | Chem. Res. Toxicol. 2012, 25, 2402−2411

3 12 7 11 7 18 9 15 12 138 143 129 173 159 180 138 165 191 21

15

24 48 72 24 48 72 24 48 72 5

Values are expressed as the mean ± standard deviation (n = 4). n.d.: not detected. bTotal As in the medium added to the cells, quantified by GF-AAS. cTotal methylation yield: % metabolism (MMA + DMA) in cells + % metabolism (MMA + DMA) in medium.

4 2 2 5 9 5 7 5 8 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

11 15 13 58 60 57 22 43 46

cell amount added (ng As)b time (h) days postseeding

lysate and medium), the percentage of metabolism, and the methylation rates in Caco-2 at 15 days post-seeding in 6-well plates exposed to 1 μM As(III) at 24, 48, and 72 h. The percentages are calculated with respect to the arsenic initially added to the culture, determined by GF-AAS. The results show that the percentage of metabolism of As(III) does not change significantly with time (24 h, 29 ± 6%; 48 h, 36 ± 4%; 72 h, 27 ± 4%). For all the times, MMA was detected both inside the cells and in the medium and was the major metabolite. DMA was detected in the cells at all the time points but was only observed in the medium after 72 h of exposure. The primary methylation rate (MMA/iAs) has similar values at 24 and 72 h (0.26 and 0.22, respectively), whereas it is significantly higher at 48 h (0.44). The secondary methylation rate (DMA/MMA) has a maximum value at 24 h (0.72) and decreases significantly at longer times (48 h, 0.32; 72 h, 0.41). Total cellular arsenic retention of As(III) ranged between 32 and 38%. The analysis of the arsenic species inside the cells after 48 h of exposure, which was performed at both pH 1 and pH 6, shows that all the arsenic species found inside the cells were in trivalent form. Unlike what happened after exposure to 1 μM As(III), at the concentration of 10 μM As(III) metabolism in Caco-2 cells was not detectable at any of the times assayed (data not shown). With regard to the pentavalent inorganic form, the assays conducted with Caco-2 at 15 days post-seeding showed very different behavior from that of its trivalent counterpart. Arsenate requires a preliminary reduction stage in order to produce As(III) and follow the metabolic pathways described in the literature; therefore, the metabolites of As(V) evaluated included As(III) in addition to the mono- and dimethylated species. For 10 μM As(V), cell retention was relatively low (24 h, 1.5 ± 0.2%; 48 h, 7 ± 2%; 72 h, 7 ± 2%), less than the retention observed for As(III). Metabolism of As(V) had a value of 7% [As(III), 3 ± 1%; MMA, 4 ± 1%] at 48 h. This metabolism percentage was maintained at 72 h. As in the case of As(III), the species found inside the cells at 48 h were in trivalent form. Metabolism was not observed at the lower concentration (1 μM), possibly owing to the sensitivity of the analytical technique. As for the mucus-secreting cells, the HT29-MTX cell line, at 15 days post-seeding no metabolism was detected for any of the conditions studied [As(III) or As(V); 1 and 10 μM; 4, 6, 24, 48, and 72 h of exposure]. Influence of GSH and Vitamin B12 on the Metabolism of Differentiated Intestinal Cells. GSH and vitamin B12 are food components that can affect the metabolism of inorganic forms of arsenic.13 Co-exposure of As(V) with these two compounds does not significantly affect the metabolic profile and distribution of arsenic species in the Caco-2 cell line (data not shown). However, these compounds do affect the metabolism of As(III), as Figure 1 shows. The percentages of total metabolism in the presence of GSH (37 ± 7%) were similar to those found in cells exposed only to As(III) (36 ± 4%), whereas the cells coexposed with vitamin B12 had slightly lower percentages (28 ± 7%). Although the differences in percentages of metabolism were not great, the differences in species profiles and their distribution (cells or medium) were statistically significant (p < 0.05). In the exposure to As(III) or As(III)/GSH, the major metabolite was MMA (28 ± 4% and 26 ± 3%, respectively), and DMA was a minor metabolite (9 ± 1% and 9 ± 4%, respectively). After 48 h of exposure to As(III)/GSH, the primary methylation rate was slightly higher

a

0.00 0.60 0.25 0.72 0.32 0.41 0.13 0.21 0.48 0.00 0.07 0.06 0.26 0.44 0.22 0.13 0.26 0.17 n.d. 11 ± 2 8±1 29 ± 6 36 ± 4 27 ± 4 13 ± 3 25 ± 5 25 ± 2 n.d. 4 ± 0.2 4±1 10 ± 2 15 ± 1 9±2 8±1 12 ± 1 9±2 n.d. 7±1 4 ± 0.5 18 ± 3 21 ± 4 18 ± 3 5±1 13 ± 2 16 ± 3 n.d. n.d. n.d. n.d. n.d. 3±1 n.d. n.d. 4±1 n.d. 6±1 2 ± 0.1 21 ± 4 14 ± 2 11 ± 4 2 ± 0.4 7±2 9±3 n.d. 6 ± 0.3 5±1 18 ± 5 24 ± 1 13 ± 1 11 ± 3 19 ± 2 12 ± 2 n.d. 4±1 3 ± 0.5 11 ± 1 20 ± 4 21 ± 2 5±1 15 ± 4 15 ± 2 129 ± 15 138 ± 21 117 ± 12 86 ± 7 75 ± 13 128 ± 9 105 ± 6 108 ± 7 135 ± 20 11 ± 4 5±1 8±2 27 ± 5 26 ± 4 25 ± 6 15 ± 3 21 ± 4 22 ± 3

medium cell medium cell medium cell medium medium

cell

iAs total As

Article

129 ± 15 144 ± 25 97 ± 11 115 ± 2 87 ± 8 134 ± 8 116 ± 7 130 ± 12 143 ± 19

DMA/ MMA

methylation rates

MMA/ iAs total methylation yield (%)c

% metabolism (MMA +DMA) DMA MMA ng As/mg protein

Table 2. Concentrations of Total Arsenic and Arsenic Forms in Cell Lysates and Media after Exposure of Caco-2 Cells in Various Differentiation Stages (5, 15, and 21 Days Post-Seeding) to 1 μM As(III) for 24, 48, and 72 ha

Chemical Research in Toxicology

2405

dx.doi.org/10.1021/tx300385y | Chem. Res. Toxicol. 2012, 25, 2402−2411

Chemical Research in Toxicology

Article

Table 3. Metabolism in Caco-2 Cells at 15 Days PostSeeding in a Transwell System Exposed to 1 μM As(III) for 48 ha basal compartment cells apical compartment

iAs

MMA

DMA

23.1 ± 4.4 (18.2 ± 3.5) 4.5 ± 1.2 (3.5 ± 0.4) 107.2 ± 5.6 (84.4 ± 4)

6.8 ± 1.8 (5.3 ± 1.4) n.d.

n.d.

6.9 ± 1.5 (5.4 ± 1.2)

n.d.

n.d.

The data show ng As/mg protein (mean ± standard deviation, n = 4), with percentages in parentheses. The percentage of arsenic in cells and the medium was calculated with respect to the initial addition of arsenic. n.d.: not detected.

a

The metabolism percentage was significantly lower in the twochamber system (p < 0.05) than in multiwell plates (11 ± 3% vs 36 ± 4%). Metabolism of As(III) and As(V) as a Function of Differentiation State. The intestinal epithelium is constantly being renewed, and therefore in the intestinal tract, there are cells at various stages of differentiation. It has been shown that the metabolic activity and transport mechanisms of the epithelial cell lines of the intestine vary as a consequence of the degree of differentiation. We therefore evaluated the metabolism of As(III) and As(V) in HT29-MTX and Caco-2 at various stages of differentiation: 5, 15, and 21 days post-seeding (1, 11, and 17 days post-confluence, respectively). The results obtained indicate that HT29-MTX cells do not metabolize iAs at any of the differentiation stages. In Caco-2 cells, the results were different, as can be seen in Table 2, which shows the concentrations of total arsenic and arsenic species in cell lysate and medium after 24, 48, and 72 h of exposure to 1 μM As(III) for various degrees of differentiation. The metabolism percentage was less in undifferentiated cells (8− 11%) than in differentiated cells (25−36%) (p < 0.05). Moreover, the differentiation state significantly affected cellular retention (p < 0.05), being less in undifferentiated cells (7− 16%) than in differentiated cells (15 days post-seeding, 26− 34%; 21 days post-seeding, 17−37%). The rates of the primary and secondary methylation steps for Caco-2 cells at various differentiation stages are shown in Table 2. At 5 days post-seeding, the primary methylation rate (MMA/ iAs) is very low (