Article pubs.acs.org/bc
Metallochelate Coupling of Phosphorescent Pt-Porphyrins to Peptides, Proteins, and Self-Assembling Protein Nanoparticles Ruslan I. Dmitriev,* Neil O’Donnell, and Dmitri B. Papkovsky School of Biochemistry and Cell Biology, ABCRF, University College Cork, Cork, Ireland S Supporting Information *
ABSTRACT: Specific and reversible metallochelate coupling via nitrilotriacetate (NTA) moiety is widely used for immobilization, purification, and labeling of oligo(histidine)-tagged proteins. Here, we evaluated this strategy to label various peptides and proteins with phosphorescent Pt-porphyrin derivatives bearing NTA group(s). Zn2+ complexes were shown to have minimal effect on the photophysics of the porphyrin moiety, allowing quenchedphosphorescence sensing of O2. We complexed the PtTFPP-NTA conjugate with His-containing peptide that can facilitate intracellular loading, and observed efficient accumulation and phosphorescent staining of MEF cells. The more hydrophilic PtCP-NTA conjugate was also seen to form stable complexes with larger polypeptide constructs based on fluorescent proteins, and with subunits of protein nanoparticles, which retained their ability to self-assemble. Testing in phosphorescence lifetime based O2 sensing assays on a fluorescence reader and PLIM microscope revealed that phosphorescent metallochelate complexes perform similarly to the existing O2 probes. Thus, metallochelate coupling allows simple preparation of different types of biomaterials labeled with phosphorescent Pt-porphyrins.
■
INTRODUCTION Bioimaging usually requires specific and stable labeling of particular biomolecules with fluorescent reporters or other contrast agents.1,2 Ideally, this should be performed in situ, with minimal effort and invasiveness and maximal flexibility, to produce targeted probes providing quantitative readout, such as fluorescence and phosphorescence lifetime imaging microscopies (FLIM, PLIM).3 Traditional chemical conjugation methods, genetically encoded constructs based on fluorescent proteins, new high-affinity interaction-based bioorthogonal chemistries are actively explored for such purposes.4−7 Metallochelate coupling is a common approach, which utilizes the ability of iminodiacetic and nitrilotriacetic (NTA) complexes with transition metal ions (Zn2+, Ni2+, Co2+, or Cu2+) to coordinate certain amino acid residues, mainly histidine (KD ∼ 10 μM, largely enhanced for oligo-His sequences) over the broad pH range.8 NTA-based metallochelate chemistry has been proposed for protein immobilization/purification, nanopatterning, and site-specific labeling with fluorescent dyes, quantum dots, phospholipid bilayers, and proteins.8−10 However, this coupling chemistry often impacts label emission decreasing fluorescence quantum yield by up to 70−80%.8 The area of metallochelate coupling of phosphorescent dyes also remains relatively unexplored. Pt(II)-porphyrins and probes on their basis are rapidly emerging indicator dyes, particularly for quenched-phosphorescence detection and imaging of molecular oxygen (O2).11−13 Being important tools for cell biology, hypoxia research, © 2015 American Chemical Society
metabolic diseases, cancer, microbiology and food safety, they can provide relatively simple and robust quantification and high-resolution imaging of O2 in various mammalian tissue models, across the multitude of imaging platforms and readout modes, particularly PLIM. For efficient phosphorescent staining of cells and tissues, in vivo applications, and studies of subcellular O2 gradients, specific intracellular targeting is usually required.14−19 Metallochelate coupling can help address these challenges, but so far it has not been applied for the preparation of bioconjugates based on Pt-porphyrins. Another complication is high susceptibility of phosphorescent dyes to quenching by heavy atoms such as metal ions. Here, we applied metallochelate coupling chemistry to produce several oligo- and polypeptide-based phosphorescent probes (Figure 1A). First, we used short Arg-containing cellpenetrating peptides to facilitate intracellular delivery of phosphorescent Pt-porphyrin. Next, we demonstrated specific coupling of Pt-porphyrin moiety to His6-tagged fluorescent proteins. Finally, we prepared a phosphorescent complex from elastin-like protein subunit fused with CCMV (cowpea chlorotic mottle virus) capsid, and showed that it can selfassemble to produce phosphorescent virus-like nanoparticles. Collectively, all described metallochelate complexes displayed Special Issue: Molecular Imaging Probe Chemistry Received: October 3, 2015 Revised: December 19, 2015 Published: December 24, 2015 439
DOI: 10.1021/acs.bioconjchem.5b00535 Bioconjugate Chem. 2016, 27, 439−445
Article
Bioconjugate Chemistry
phosphorescence and sensitivity to O2 comparable with other (poly)peptide-based probes.
■
RESULTS AND DISCUSSION For the evaluation of metallochelate coupling in O2 imaging applications, we employed the bright and photostable PtTFPP dye (exc. 395 nm, em. 650 nm, e395 = 257 000 M−1 cm−1), in which p-fluorine atoms can be click-modified20,21 with thiol or amine-containing groups (Figure 1, Figures S1−S3). Using the lysine derivative of NTA, one can introduce up to three NTA groups per PtTFPP moiety. To cope with nonspecific interactions of hydrophobic origin, unrelated to metallochelate coupling, we also studied the more hydrophilic and spectrally similar though less photostable PtCP dye (exc. 380 nm, em. 650 nm, e380 = 72 000 M−1 cm−1),22 from which the monofunctionalized derivative was prepared in this work (PtCP-NTA, Figures S1−S3). First, we studied the effects of different metal ions on Pt-porphyrin-NTA emission. Chelation of Zn2+ or Ni2+ had no major effect on the phosphorescence, in both air-saturated or deoxygenated solutions (Figure 1B). At 0% O2 phosphorescent signals slightly increased upon binding the metal ion, probably due to reduced aggregation of the complexes formed. Zn2+ had minimal effect on phosphorescence intensity when it was present in solution in quantities up to 10 mol equiv (Figure 1C), while Co2+, Cu2+, and Ni2+ showed moderate quenching at higher concentrations (>4 equiv, not shown). Ni2+ ions can also decrease fluorescence quantum yield,8 which potentially limits the application area of phosphorescent Pt-porphyrins (e.g., in conjunction with fluorescent proteins). We therefore chose Zn2+ for future experiments. We next studied if metallochelate-complexing can aid intracellular delivery of Pt-porphyrins. To do this, we complexed PtTFPP(NTA) derivatives with His- and Argcontaining cell-penetrating peptides. We previously showed that “branched” Pt-porphyrin derivatives harboring 6−8 Arg residues per molecule provide efficient staining of mammalian cells and intracellular localization.23,24 We prepared complex of PtTFPP(NTA) with peptide His6-Gly2-Arg6(amide) in the
Figure 1. (A) General structure of Pt-porphyrin-NTA complexed with metal ion (Ni2+, Co2+, Cu2+, Zn2+) and His-containing peptides. R1−5 represent various groups. (B) Effect of Ni2+ and Zn2+ addition (2 mol equiv) on the phosphorescence PtTFPP-NTA in deoxygenated and air-saturated conditions. (C) Effect of addition of Zn2+ on the phosphorescence of PtCP-NTA in PBS.
Figure 2. Complex of PtTFPP(NTA)1 with His6-Gly2-Arg6-amide peptide provides efficient cell penetration in MEF cells. Left: general structure of complex. Center: intracellular localization of the complex (PtTFPP(NTA) + Zn2+ + peptide, shown in red, counter-stained with Calcein Green) in live MEF cells. Scale bar is in μm. Right: average fluorescence intensity (405 nm exc., 650 nm em.) of MEF cells, stained with the PtTFPP(NTA) dye in the presence or absence of 2 mol equiv of Zn2+ and peptide. 440
DOI: 10.1021/acs.bioconjchem.5b00535 Bioconjugate Chem. 2016, 27, 439−445
Article
Bioconjugate Chemistry
Figure 3. Coupling of PtCP-NTA to monomeric green fluorescent protein EGFP via N-terminal His6-tag. (A) Structure of PtCP-NTA. (B) Absorbance spectra of EGFP before and after coupling with PtCP-NTA/Zn2+ (negative control with EDTA). Emerging peaks at 380 and 540 nm confirm efficient coupling with PtCP-NTA. (C) Luminescent properties of EGFP-PtCP/Zn2+: fluorescence excitation (emission at 507 nm) and emission (exc. at 488 nm) spectra of free EGFP and phosphorescence emission spectra of complex in air-saturated and deoxygenated solutions. (D) Phosphorescence intensity signals of EGFP-PtCP/Zn2+ measured on time-resolved fluorescence reader at 21% O2. Red dashed line indicates background phosphorescence levels. (E) phosphorescence lifetimes of EGFP-PtCP/Zn2+ in aerated and deoxygenated solutions.
presence of Zn2+ ions (5−10 min incubation at room temperature), incubated it with cultured MEF cells (16 h), and inspected by confocal fluorescence microscopy (Figure 2). Despite the high hydrophobicity of the PtTFPP moiety, we observed efficient intracellular accumulation of the dye inside the cells, compared with control staining experiments (without peptide and added Zn2+). We also evaluated PtTFPP(NTA)3 with three additional peptide sequences: His1 with “classical” His6 tag and two Arg residues; His2 with two His residues separated by Gly and two Arg residues; His3 with only one His and Arg, for which we expected very weak complexation (Figure S4). In this case, complexation with peptides His1 and His2 improved intracellular staining and photostability of the porphyrin phosphor (Figure S4), being sufficient for collection of phosphorescent images and generation of PLIM maps reflecting intracellular O2 concentrations. The decay time range was somewhat narrow, with approximately 2-fold change between air-saturated and deoxygenated conditions (Figure S4). Overall, PtTFPP(NTA) complexes with His-containing peptides showed efficient cell permeability rendering them as potential future venues for
development of intracellular O2 probes similar to nanoparticle and small molecule probes.20,25 Our next aim was to see how metallochelate coupling works with larger molecules such as monomeric and self-assembling multisubunit proteins. Since PtTFPP has a highly hydrophobic backbone, is poorly water-soluble, and can nonspecifically interact with proteins, we used for coupling a more hydrophilic derivative, PtCP-NTA (Figure 3A). Using enhanced green fluorescent protein with N-terminal His6 tag (EGFP, produced in bacteria) and Zn2+ as chelating metal, we found that PtTFPP(NTA) produced only nonspecific binding (not shown). In contrast, PtCP-NTA showed >40% yield of complexation with EGFP and minimal nonspecific binding (see EDTA control, Figure 3B). The EGFP-PtCP complex showed fluorescence similar to that of free EGFP, and an additional phosphorescence emission band sensitive to O2 with peak at 650 nm (Figure 3C). Phosphorescent signals from stained cells measured on a time-resolved fluorescence reader were ∼25 000 cps at 1 μM concentration and phosphorescence lifetimes ranging from 28 to 62 μs. This is very comparable to a MitoXpress probe comprising PtCP−protein conjugate.26 To confirm efficient 441
DOI: 10.1021/acs.bioconjchem.5b00535 Bioconjugate Chem. 2016, 27, 439−445
Article
Bioconjugate Chemistry
Figure 4. Properties of ELPCP-PtCP-NTA self-assembling nanoparticles. (A) SDS-PAGE analysis of purified for ELPCP proteins with N- and Cterminal His6-tags. (B) Absorption spectra of the dimeric form of ELPCP-H6-PtCP-NTA/Zn2+ complex (“capsid” buffer, pH 7.5). (C) Analysis of size of assembled ELPCP-H6-PtCP nanoparticles by dynamic light scattering. (D) Absorption of ELPCPH6-PtCP VLPs and MitoXpress at 15 nM concentration. (E) Phosphorescence excitation and emission spectra of VLPs and MitoXpress at 7.5 nM concentration in aerated and deoxygenated conditions. (F) Phosphorescence lifetimes of ELPCP-H6-PtCP VLP.
NTA. Coupling with the dimers did occur; however, final VLPs structures did not form (not shown). Our explanation was that topologically the His6-tags could face the inner cavity and PtCP-NTA bound to them sterically hindered the assembly of VLP. Hence, we hypothesized that His6 tag located at C terminus (the outer surface of the capsid) complexed with PtCP-NTA would not prevent VLP assembly. To prove this, we subcloned the ELPCP in vector expressing C-terminal His6-tag and overexpressed and purified the resulting protein (Figure 4A). In its dimer state this construct was successfully coupled with PtCP-NTA at ∼65% efficiency (Figure 4B). The resulting complex did form the VLPs, ∼28 nm in size (Figure 4C). Interestingly, without PtCP-NTA coupling we did not observe VLP assembly (see Figure S6). ELPCP-H6-PtCP VLPs showed remarkable stability with no visible changes in absorption spectra over 7 days storage (not shown). Compared to commercial O2 probe MitoXpress,26 VLPs showed ∼25.8 times higher absorptivity and ∼7 times higher phosphorescence intensity signals in deoxygenated state (Figure 4D,E). This is due to the higher dye content (∼117 per capsid at 65% coupling efficiency). Upon deoxygenation, VLPs showed 5.3-fold increase in phosphorescence intensity versus 2.45-fold for MitoXpress. When measured at the same molar
coupling, we also evaluated several other recombinant fluorescent proteins with N-terminal His6 tags: blue TagBFP2 and red fluorescent DsRed-Express (Figure S5). With all of them we observed efficient coupling with PtCP-NTA with no major impact on photophysical properties of fluorescent protein. Slight quenching of protein fluorescence by PtCPNTA and no significant FRET between the both dyes (protein, porphyrin) were also noted. Such conjugates can be used for ratiometric-based measurements of O2, where fluorescent protein can be used as O2-insensitive reference. The protein complexes displayed moderate storage stability in solution, losing only 30−40% of phosphorescence intensity after 7 days (Figure S5C). We think this can be improved by optimizing the His-tags and the structure and number of NTA moieties on the Pt-porphyrin.8 ELPCP is a chimeric protein based on plant CCMV capsid, which can form virus-like nanoparticles (VLP).27 The assembly of ELPCP with N-terminal His6 tag depends on pH, ionic strength, and temperature, and proceeds through dimerization (pH 7.5) and final assembly (pH 5) of VLPs having 180 subunits and 28 nm size. Since these conditions of VLP formation are compatible with metallochelate coupling, we studied the interaction of recombinant H6-ELPCP with PtCP442
DOI: 10.1021/acs.bioconjchem.5b00535 Bioconjugate Chem. 2016, 27, 439−445
Article
Bioconjugate Chemistry concentration on the fluorescence plate reader, VLPs showed 37 times higher signals in the deoxygenated state (Figure S7), but the lifetime range (27−67 μs) was similar to that of MitoXpress. This can be explained by PtCP quenching by itself or by protein backbone. Altogether, we demonstrated that NTA coupling is a viable approach for simple conjugation of Pt-porphyrins to various biomolecules ranging from short peptides, monomeric proteins, and self-assembling virus-like nanoparticles via their oligo-His tags. Such complexes can be used for targeted delivery of Ptporphyrin, if the linear His6 sequence is present or at least two His residues joined via linker (e.g., His2 peptide). Stability of these complexes after crossing the cell membrane is unknown,8 but peptides can serve as guide molecules at the internalization stage. Specific brightness and photostability of peptide-bound PtTFPP in the cell were sufficient for live cell PLIM measurements, and this can be exploited for sensing of intracellular O2.11 While the current constructs did not show exceptional brightness and coupling yield (40−65%), further research can help improve this, e.g., by using multiple NTA moieties, optimized chelator structures, and His-tags in proteins. The described PtCP-NTA complexes are of limited use for highresolution imaging, but very appropriate for plate reader applications such as analysis of oxygen consumption rate or analysis of drug-induced toxicity.28 Their brightness exceeds the similar chemical conjugate probe MitoXpress, and response to O2 is even stronger providing higher sensitivity. Brighter and more photostable PtTFPP and Pt-benzoporphyrin derivatives29 can also be used for improved sensing, if their hydrophobicity and nonspecific binding of proteins can be decreased. The PtCP-NTA-ELPCP-H6 complex is the first example of phosphorescent VLP structure. High brightness and O2 sensing properties make it well suited for measurements on timeresolved fluorescence microplate readers while the future research and design can produce even more efficient phosphorescent O2 probes with controlled targeting and improved brightness due to multiple chelation sites.
Synthesis of PtTFPP(NTA)1−3 and PtCP-NTA. Mono- and trisubstituted PtTFPP(NTA) conjugates were prepared according to the previously described click-modification.20,21,30 Briefly, PtTFPP was mixed with 0.5−5× molar excess of Nα,Nαbis(carboxymethyl)-L-lysine hydrate (NTA) in DMF in the presence of excess of triethylamine and incubated at 70 °C for 20−24 h (Figure S1). Depending on incubation time and amount of NTA, mono- or trisubstituted derivatives of PtTFPP were produced (Figure S2). The reaction was analyzed by RPHPLC on Zorbax XDB-C18 column (4.6 × 150 mm, 5 μm, Agilent) using gradient of acetonitrile in H2O−0.1% trifluoroacetic acid (TFA). Target products (1−2 μmol reaction scale) were purified on a semipreparative column Discovery C18 (1 × 25 cm, 5 μm, Supelco). Yields (initial amount of porphyrin/amount after purification): PtTFPP-NTA − 78%; PtTFPP(NTA)3 − 6%. PtCP-NTA was synthesized according to published protocol:31 PtCP-NCS was mixed with 2 mol equiv of NTA and triethylamine (>20-fold excess) in DMSO and incubated for 16 h at room temperature. The reaction mixture (contained single peak product) was analyzed by RP-HPLC as above and purified on a semipreparative column Discovery C18 (1 × 25 cm, 5 μm, Supelco). Yield: 50%. Purity of the conjugates was confirmed by RP-HPLC and was typically 95−100% (Figure S2B). The conjugates were dried under vacuum, reconstituted in DMSO, and stored at −18 °C. The structures of PtTFPP(NTA) and PtCP-NTA were confirmed using HPLC−MS Waters Micromass ZQ (ESCI ionization mode) (Waters, Milford, USA). Column: YMCTriart C18, 3 μm, gradient of acetonitrile in 10 mM triethylammonium acetate pH 7 buffer. Data acquisition was carried out by MassLynx (v 4.1) software. MS (Figure S3): PtTFPP(NTA) found 1409.058 (theoretical 1409.1180); PtCP-NTA found 1269.402 (theoretical 1269.3805). Cell Culture and Fluorescence Microscopy. MEF cells were cultured in DMEM medium supplemented with 10% FBS and 10 mM HEPES, pH 7, as described before.20 His1−3 complexes were added to the cells, incubated for 6−16 h, and then washed and analyzed. Cell staining efficiency, response to deoxygenation, and photostability were measured on a widefield fluorescence PLIM microscope (exc. 390 nm, emission 635−675 nm).32 Subcellular localization and costaining with Calcein Green AM dye were assessed on a laser-scanning TCSPC PLIM microscope (exc. 405 nm, emission 635−675 nm for PtTFPP complexes) as previously described.16 All measurements were performed in triplicate. Molecular Cloning. Plasmid DNA encoding EGFP with Nterminal His6 tag in pQE-30 (Qiagen, UK) was a gift from Dr. I. Okkelman (University College Cork, Ireland). EBFP ORF was amplified using 5′-GATCGGATCCATGGTGAGCAAGGGCGAGGA (forward) and GATCGGTACCGCCACCCTTGTACAGCTCGTCCAT (reverse) primers, Pf u DNA polymerase,27 and EBFP-C1 as a template. The product was cloned in pQE-30 vector via BamHI and KpnI sites. The gene encoding EBFP2 protein (Genbank Acc. No. AER25341) was synthesized by GenScript and then subcloned using KpnI in pQE-30 vector. The ORF of DsRed was PCR-amplified with Pf u DNA polymerase from DsRed-Express-N1 vector using forward and reverse primers 5′-AGTCGGTACCATGGCCTCCTCCGAGGACGTC and AGTCGGTACCCAGG-
■
EXPERIMENTAL PROCEDURES Materials. Synthetic peptides HHHHHHGRR-amide (His1), GHGGGHGRR-amide (His2), HGR-amide (His3), and HHHHHHGGRRRRRR-amide (His4) (purity >92%, HPLC, structures confirmed by mass spectrometry) and SDSPAGE gradient gels were from Genscript (Piscataway, NJ, USA). Pt(II)-meso-tetrakis(pentafluorophenyl)porphyrin (PtTFPP) was from Frontier Scientific (Inochem Ltd., Lancashire, UK), MitoXpress and Pt(II)-coproporphyrin I isothiocyanate (PtCP-NCS) were from Luxcel Biosciences (Cork, Ireland). Plasmid DNA encoding H6-ELP-[V4L4G1-9]CP (ΔN26) in pET-15b vector (H6-ELPCP)27 was a gift from Prof. Jan van Hest (Radboud University Nijmegen, Netherlands). Plasmid DNA encoding TagBFP2 with N-terminal H6tag in pQE30 was from Evrogen (Moscow, Russia). Plasmid DNA encoding EGFP-N3, DsRed-Express-N1, EBFP-C1, and EBFP2-C1 were from BD Biosciences (Oxford, UK). PCR master mix, Pfu DNA polymerase, BglII, T4 DNA ligase and protein Mw standards were from Promega (MyBio, Ireland). KpnI, BamHI, and Antarctic Phosphatase were from New England Biolabs (Brennan & Company, Ireland). CellLytic B solution, Nα,Nα-bis(carboxymethyl)-L-lysine hydrate (NTA), and all the other reagents were from Sigma-Aldrich (Dublin, Ireland). 443
DOI: 10.1021/acs.bioconjchem.5b00535 Bioconjugate Chem. 2016, 27, 439−445
Article
Bioconjugate Chemistry
Express) = 33 800 (554 nm) M−1 cm−1. Typical yield of proteins was >20 mg/L culture for EBFP1−2 and DsRed, >200 mg/L culture for EGFP, and 60−80 mg/L culture for ELPCP. Nanoparticle size was determined by dynamic light scattering at 20−25 °C in Assembly buffer on Zetasizer NANO ZS equipped with 4 mW 633 nm laser (Malvern Instruments). Metallochelate Coupling. A. Peptides. To a solution of 2 μM of PtTFPP(NTA) in 100 μL PBS, 4 μM of ZnSO4, and 4 μM of His4 were added, incubated 5−10 min at room temperature, then mixed with equal volume of DMEM medium supplemented with 10% FBS) and immediately added to cultured MEF cells. Negative controls were mixtures without Zn2+ and peptide. B. Proteins. A 2.5−5 nM solution of fluorescent protein in PCL or Capsid buffers was mixed with 1.5−2× molar excess of PtCP-NTA (or PtTFPP-NTA), 0.5 mM of ZnSO4, 0.1% Triton X100, and 1 mM EDTA-Na (negative control) in 500 μL (final volume), incubated for 1 h (RT, rotary shaker, protected from light) and then desalted on PD MiniTrap G25 (GE Healthcare, Buckinghamshire, UK) columns against PBS or Capsid buffer (∼1 mL elution volume). Coupling efficiency was assessed by UV−vis spectrophotometry using ε(PtCP) = 72 000 (380 nm), ε(PtTFPP) = 257 000 (395 nm) M−1 cm−1. ELPCPs (N- or C-terminal His6) were coupled to PtCPNTA as dimers, similar to the above, using 2.5 nM of ELPCP protein and 7.5 nmol of PtCP-NTA, desalted, and analyzed using UV−vis spectrophotometry. To assemble VLP, the solution was dialyzed against Assembly buffer at room temperature, cleared by centrifugation (10 000g, 10 min) and analyzed spectrally and for size distribution. Spectral and Time-Resolved Phosphorescence (TR-F) Measurements. Absorption spectra were measured on an 8453 diode array spectrophotometer (Agilent); fluorescence and phosphorescence excitation and emission were measured on LS50B (PerkinElmer) spectrometer. Time-resolved phosphorescence intensity and lifetime (RLD method) measurements were performed on Victor2 (PerkinElmer) multilabel reader as previously described.23
AACAGGTGGTGGCGGCC. It was then subcloned in pQE30 vector using the KpnI site. To construct plasmid DNA encoding ELPCP-H6 (with Cterminal His-tag), the ORF encoding H6-ELPCP/pET-15b was amplified by Pf u DNA polymerase using CCMV-F (5′TAGCGGATCCGTTCCGGGCGTCGGTGTTCCT) and CCMV-R (GATCAGATCTACCGCCACCATACACCGGAGT) primers, then digested by BamHI and BglII, cloned in pQE-16 vector at the same sites and transformed in E. coli SG13009 (Qiagen) cells as described before.17 The structures of the expression constructs were confirmed by sequencing. E. coli Production, Purification, and Assembly of VLPs. EBFP1−2, TagBFP, EGFP, and DsRed proteins were produced in E. coli SG13009 strain, by growing cells in LB medium, in the presence of Ampicillin (100 μg/mL) and Kanamycin (25 μg/ mL). When OD600 of 0.4−0.5 was reached (37 °C), cells were induced with 0.25−0.5 mM IPTG overnight at room temperature. H6-ELPCP (N-terminal tag) was produced in BL21 cells in the presence of Ampicillin and Chloramphenicol at room temperature as described.27 ELPCP-H6 (C-terminal tag) cloned in pQE-16 was produced similarly, using Ampicillin and Kanamycin and induction with 1 mM IPTG overnight at room temperature. Cells were harvested and pellets stored at −80 °C. Fluorescent proteins were purified by dissolving the pellets in “PCL” buffer (50 mM NaH2PO4, 0.3 M NaCl, 10 mM Imidazole, pH 8 (>5 volumes per mg of wet weight) supplemented with 1× CellLytic B (Sigma C8740), 0.25−1 mg/mL Lysozyme, 1× protease inhibitor cocktail (Sigma P2714), incubation on ice for 0.5 h, passing the extract through the needle (23 1/4 G, 5 times), and centrifugation (15 000g, 15 min, 4 C). Cleared extracts were applied on Ni2+-NTA resin (Sigma P6611) in gravity-flow columns, which were washed with PCL buffer and then eluted with the same buffer supplemented with 250 mM Imidazole. Eluted proteins were dialyzed against PCL buffer without imidazole or another buffer (8 kDa MWCO, RT, 2× 1 h) and quantified using Bradford assay. H6-ELPCP and ELPCP-H6 were purified according to the method27 with minor modifications. E. coli pellets were defrosted, dissolved for lysis in 50 mM NaH2PO4, 10 mM Imidazole, 1.3 M NaCl, pH 8, 1 mg/mL Lysozyme, 1× Protease inhibitor cocktail (Sigma P2714), 1× CellLytic B (Sigma C8740), 10 μg/mL DNase, 10 μg/mL RNase A, incubated at room temperature for 0.5 h, passed through the needle (23 1/4 G, 5 times), and centrifuged (15 000g, 15 min, 4 C). Cleared extracts were applied on Ni2+-NTA resin (Sigma P6611) in gravity-flow columns, washed with lysis buffer, containing 20 mM imidazole, and then eluted with the same buffer containing 250 mM imidazole. To produce dimers, purified proteins were immediately dialyzed against “capsid” buffer (50 mM Tris, pH 7.5, 500 mM NaCl, 10 mM MgCl2, 1 mM EDTA) (8 kDa MWCO, 1 h, RT), then against the same buffer without EDTA. They were quantified by Bradford assay. To produce VLPs, dimers were further dialyzed against “assembly” buffer (50 mM CH3COONa, pH 5, 500 mM NaCl, 10 mM MgCl2). The dimers and assembled VLPs were stored at 4 °C. Purity and molecular weight of proteins were assessed by SDS-PAGE. Folding ratios for fluorescent proteins were analyzed by measuring the amount of “folded” form by UV−vis spectrophotometry and assuming that ε(EGFP) = 55 000 (488 nm), ε(EBFP) = 31 000 (383 nm), ε(EBFP2) = 32 000 (383 nm), ε(TagBFP2) = 50 600 (399 nm), ε(DsRed-
■
ASSOCIATED CONTENT
S Supporting Information *
The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.bioconjchem.5b00535. Supplementary figures S1−S7, and primary structure of ELPCP-H6 protein (PDF)
■
AUTHOR INFORMATION
Corresponding Author
*E-mail:
[email protected]. Phone: 0214901339. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS This work was supported by the Science Foundation Ireland (SFI) grants 13/SIRG/2144 (RID) and 12/RC/2276 (DBP). We thank Dr. I. Okkelman for providing EGFP-expression vector, M.A. Fomin and D. Heindl for LC-MS characterization of Pt-complexes, A. Kondrashina for assistance with synthesis, Prof. Jan van Hest and Mark van Eldijk for providing H6ELPCP expression vector and help with expression and 444
DOI: 10.1021/acs.bioconjchem.5b00535 Bioconjugate Chem. 2016, 27, 439−445
Article
Bioconjugate Chemistry
By Monitoring the Respiratory Activity. Angew. Chem. 126, 12679− 12683. (19) Kurokawa, H., Ito, H., Inoue, M., Tabata, K., Sato, Y., Yamagata, K., Kizaka-Kondoh, S., Kadonosono, T., Yano, S., and Inoue, M. (2015) High resolution imaging of intracellular oxygen concentration by phosphorescence lifetime. Sci. Rep. 5, 10657. (20) Dmitriev, R. I., Kondrashina, A. V., Koren, K., Klimant, I., Zhdanov, A. V., Pakan, J. M. P., McDermott, K. W., and Papkovsky, D. B. (2014) Small molecule phosphorescent probes for O2 imaging in 3D tissue models. Biomater. Sci. 2, 853−866. (21) Samaroo, D., Soll, C. E., Todaro, L. J., and Drain, C. M. (2006) Efficient microwave-assisted synthesis of amine-substituted tetrakis (pentafluorophenyl) porphyrin. Org. Lett. 8, 4985−4988. (22) O’Riordan, T. C., Soini, A. E., and Papkovsky, D. B. (2001) Monofunctional derivatives of coproporphyrins for phosphorescent labeling of proteins and binding assays. Anal. Biochem. 290, 366−375. (23) Dmitriev, R. I., Ropiak, H. M., Ponomarev, G. V., Yashunsky, D. V., and Papkovsky, D. B. (2011) Cell-penetrating conjugates of coproporphyrins with oligoarginine peptides: rational design and application for sensing intracellular O2. Bioconjugate Chem. 22, 2507− 2518. (24) Koren, K., Dmitriev, R. I., Borisov, S. M., Papkovsky, D. B., and Klimant, I. (2012) Complexes of IrIII-Octaethylporphyrin with Peptides as Probes for Sensing Cellular O2. ChemBioChem 13, 1184−1190. (25) Dmitriev, R., Borisov, S., Kondrashina, A., Pakan, J. P., Anilkumar, U., Prehn, J. M., Zhdanov, A., McDermott, K., Klimant, I., and Papkovsky, D. (2015) Imaging oxygen in neural cell and tissue models by means of anionic cell-permeable phosphorescent nanoparticles. Cell. Mol. Life Sci. 72, 367−381. (26) O’Riordan, T. C., Zhdanov, A. V., Ponomarev, G. V., and Papkovsky, D. B. (2007) Analysis of Intracellular Oxygen and Metabolic Responses of Mammalian Cells by Time-Resolved Fluorometry. Anal. Chem. 79, 9414−9419. (27) van Eldijk, M. B., Wang, J. C.-Y., Minten, I. J., Li, C., Zlotnick, A., Nolte, R. J., Cornelissen, J. J., and van Hest, J. C. (2012) Designing two self-assembly mechanisms into one viral capsid protein. J. Am. Chem. Soc. 134, 18506−18509. (28) Hynes, J., Nadanaciva, S., Swiss, R., Carey, C., Kirwan, S., and Will, Y. (2013) A high-throughput dual parameter assay for assessing drug-induced mitochondrial dysfunction provides additional predictivity over two established mitochondrial toxicity assays. Toxicol. In Vitro 27, 560−569. (29) Koren, K., Hutter, L., Enko, B., Pein, A., Borisov, S. M., and Klimant, I. (2013) Tuning the dynamic range and sensitivity of optical oxygen-sensors by employing differently substituted polystyrenederivatives. Sens. Actuators, B 176, 344−350. (30) Koren, K., Borisov, S. M., and Klimant, I. (2012) Stable optical oxygen sensing materials based on click-coupling of fluorinated platinum (II) and palladium (II) porphyrinsa convenient way to eliminate dye migration and leaching. Sens. Actuators, B 169, 173−181. (31) Dmitriev, R. I., Zhdanov, A. V., Ponomarev, G. V., Yashunski, D. V., and Papkovsky, D. B. (2010) Intracellular oxygen-sensitive phosphorescent probes based on cell-penetrating peptides. Anal. Biochem. 398, 24−33. (32) Dmitriev, R. I., Zhdanov, A. V., Nolan, Y. M., and Papkovsky, D. B. (2013) Imaging of neurosphere oxygenation with phosphorescent probes. Biomaterials 34, 9307−9317.
purification, Dr. E. Fleming for providing E. coli BL-21[DE3] cells.
■
ABBREVIATIONS EGFP, enhanced green fluorescent protein; ELPCP, elastin-like polypeptide chimeric protein with CCMV capsid protein; FLIM, fluorescence lifetime imaging microscopy; MWCO, molecular weight cutoff; PLIM, phosphorescence lifetime imaging microscopy; PtCP, Pt(II) coproporphyrin I; PtTFPP, Pt(II) meso-tetrakis(pentafluorophenyl)porphyrin; VLP, viruslike nanoparticle
■
REFERENCES
(1) Wolfbeis, O. S. (2013) Editorial: Probes, Sensors, and Labels: Why is Real Progress Slow? Angew. Chem., Int. Ed. 52, 9864−9865. (2) James, M. L., and Gambhir, S. S. (2012) A molecular imaging primer: modalities, imaging agents, and applications. Physiol. Rev. 92, 897−965. (3) Sarder, P., Maji, D., and Achilefu, S. (2015) Molecular Probes for Fluorescence Lifetime Imaging. Bioconjugate Chem. 26, 963−974. (4) You, C., Bhagawati, M., Brecht, A., and Piehler, J. (2009) Affinity capturing for targeting proteins into micro and nanostructures. Anal. Bioanal. Chem. 393, 1563−1570. (5) Samanta, D., and Sarkar, A. (2011) Immobilization of biomacromolecules on self-assembled monolayers: methods and sensor applications. Chem. Soc. Rev. 40, 2567−2592. (6) Crivat, G., and Taraska, J. W. (2012) Imaging proteins inside cells with fluorescent tags. Trends Biotechnol. 30, 8−16. (7) Sletten, E. M., and Bertozzi, C. R. (2009) Bioorthogonal chemistry: fishing for selectivity in a sea of functionality. Angew. Chem., Int. Ed. 48, 6974−6998. (8) You, C., and Piehler, J. (2014) Multivalent chelators for spatially and temporally controlled protein functionalization. Anal. Bioanal. Chem. 406, 3345−3357. (9) Soh, N. (2008) Selective chemical labeling of proteins with small fluorescent molecules based on metal-chelation methodology. Sensors 8, 1004−1024. (10) Shao, S., Geng, J., Yi, H. A., Gogia, S., Neelamegham, S., Jacobs, A., and Lovell, J. F. (2015) Functionalization of cobalt porphyrin− phospholipid bilayers with his-tagged ligands and antigens. Nat. Chem. 7, 438−446. (11) Papkovsky, D. B., and Dmitriev, R. I. (2013) Biological detection by optical oxygen sensing. Chem. Soc. Rev. 42, 8700−8732. (12) Wolfbeis, O. S. (2015) Luminescent sensing and imaging of oxygen: Fierce competition to the Clark electrode. BioEssays 37, 921− 928. (13) Roussakis, E., Li, Z., Nichols, A. J., and Evans, C. L. (2015) Oxygen-Sensing Methods in Biomedicine from the Macroscale to the Microscale. Angew. Chem., Int. Ed. 54, 8340−8362. (14) Nichols, A. J., Roussakis, E., Klein, O. J., and Evans, C. L. (2014) Click-Assembled, Oxygen-Sensing Nanoconjugates for Depth-Resolved, Near-Infrared Imaging in a 3 D Cancer Model. Angew. Chem., Int. Ed. 53, 3671−3674. (15) Dmitriev, R., and Papkovsky, D. (2012) Optical probes and techniques for O2 measurement in live cells and tissue. Cell. Mol. Life Sci. 69, 2025−2039. (16) Dmitriev, R. I., Borisov, S. M., Düssmann, H., Sun, S., Müller, B. J., Prehn, J., Baklaushev, V. P., Klimant, I., and Papkovsky, D. B. (2015) Versatile Conjugated Polymer Nanoparticles for HighResolution O2 Imaging in Cells and 3D Tissue Models. ACS Nano 9, 5275−5288. (17) Dmitriev, R. I., Zhdanov, A. V., Jasionek, G., and Papkovsky, D. B. (2012) Assessment of cellular oxygen gradients with a panel of phosphorescent oxygen-sensitive probes. Anal. Chem. 84, 2930−2938. (18) Wang, X.-H., Peng, H.-S., Yang, L., You, F.-T., Teng, F., Hou, L.L., and Wolfbeis, O. S. (2014) Targetable Phosphorescent Oxygen Nanosensors for the Assessment of Tumor Mitochondrial Dysfunction 445
DOI: 10.1021/acs.bioconjchem.5b00535 Bioconjugate Chem. 2016, 27, 439−445
