Metformin Protects against LPS-Induced Intestinal Barrier Dysfunction

Subscriber access provided by Washington University | Libraries

Article

Metformin protects against LPS-induced intestinal barrier dysfunction by activating AMPK pathway Weiche Wu, Yizhen Wang, Tizhong Shan, Sisi Wang, and Qing Liu Mol. Pharmaceutics, Just Accepted Manuscript • DOI: 10.1021/acs.molpharmaceut.8b00332 • Publication Date (Web): 03 Jul 2018 Downloaded from http://pubs.acs.org on July 4, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Molecular Pharmaceutics

Metformin protects against LPS-induced intestinal barrier dysfunction by activating AMPK pathway Weiche Wu1, Sisi Wang1, Qing Liu1, Tizhong Shan1*, Yizhen Wang1* 1

College of Animal Science, Zhejiang University; Key Laboratory of Animal

Nutrition & Feed Sciences, Ministry of Agriculture; Zhejiang Provincial Laboratory of Feed and Animal Nutrition; No. 866 Yuhangtang Road, Hangzhou, Zhejiang, 310058, P. R. China *Corresponding authors: Yizhen Wang, Ph.D., Professor 866 Yuhangtang Road, Hangzhou, China Phone: +86-0571-88982102 Email: [email protected] Tizhong Shan, Ph.D., Professor 866 Yuhangtang Road, Hangzhou, China Phone: +86-0571-88982102 Email: [email protected]

1

ACS Paragon Plus Environment

Molecular Pharmaceutics 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 41

Abstract Metformin not only regulates energy metabolism, but also participates in many cellular processes. In this study, we investigated the effect of metformin on lipopolysaccharide (LPS)-induced intestinal barrier damage. We found that LPS treatment

decreased

the

expression

of

tight

junction

proteins,

caused

pro-inflammatory response and oxidative stress in intestine. Interestingly, metformin treatments attenuated LPS-induced intestinal barrier damage, inflammation and oxidative stress. We found that metformin improved the expression of intestinal tight junction proteins (ZO1, Occludin and Claudin1) that were reduced by LPS stimulation. Moreover, metformin alleviated LPS-induced NF-κB phosphorylation, promoted Nrf2 nuclear translocation and increased the expression of the anti-oxidative genes (HO-1 and NQO-1), leading to reduced intestinal ROS content. Mechanistically, we found that metformin protects against LPS-induced intestinal barrier dysfunction by activating AMPK. These results reveal the potential of metformin as an effective therapy for treating intestinal diseases. Key Words: intestinal barrier, metformin, intestinal inflammation, oxidative stress, AMPK

2


Page 3 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Intestinal epithelial barrier functions as a defender preventing against the invasion of various pathogens and antigens1. Impaired intestinal epithelial barrier function tends to be associated with a large variety of both intestinal and systemic diseases, including inflammatory bowel disease (IBD) 2. Intestinal epithelial barrier function depends on mucosal structural components that can be dynamically regulated when responding to stimulation3. Tight junction (TJ) plays the primary role in determining barrier function. The TJ complexes consist of a number of protein components including Zonula occludens (ZO), claudins and occludin2. ZO1 and ZO2 are two crucial factors in assembly and maintaining tight junction by interacting with other proteins, such as claudins and occludin4. Claudins are barrier-forming proteins which define the tight junction permeability. Mutation or deletion of Claudins results in intestinal barrier dysfunction and increased paracellular permeability5, 6. Occludin is the first identified transmembrane TJ protein which interacts directly with claudins and actin7, 8. Intestinal inflammation has been uncovered to be associated with the intestinal epithelial barrier disruption. Plenty of researches have revealed that intestinal epithelial inflammation could damage TJ by downregulating the expression of TJ proteins through inflammatory signaling transduction9, 10. Nuclear Factor κB (NF-κB) is a key transcription factor that regulates inflammatory response by modulating the transcription of various cellular genes, which has long been a therapeutic target for treating the intestinal inflammation and IBD11. Upon stimulation, NF-κB is phosphorylated and activated by I-κBα and then translocates into the nucleus from the 3



cytoplasm, in which it binds to promoter regions of target genes and promotes the secretion of pro-inflammatory cytokines such as Tumor necrosis factor (TNF-α), interleukin-6 (IL-6) and interleukin-1β (IL-1β)12-14. Mitogen-activated protein kinases (MAPKs) that include ERK, JNK and p38 have been found to regulate the activation of NF-κB15. Indeed, these three MAPK pathways are profoundly involved in the production of pro-inflammatory cytokines and inhibition of MAPKs has been shown to improve IBD symptoms16, 17. Intestinal epithelial oxidative stress, characterized by excess reactive oxygen species (ROS) production, is found to disrupt intestinal epithelial barrier and cause mucosal diseases18. In addition, enhanced generation of ROS could promote inflammatory response in intestine, resulting in the pathogenesis of IBD19, 20. Nuclear factor (erythroid-derived-2)-like 2 (Nrf2) is recognized as the master cellular sensor of oxidative stress21. Nrf2 is a basic-leucine zipper transcription factor, which locates in the cytoplasm, bounding to kelch-like ECH-associated protein 1 (Keap1) under homeostatic conditions. When cells are exposed to oxidative stress, Nrf2 dissociates from Keap1 and translocates into the nucleus where it binds to the antioxidant responsive element (ARE), leading to the elevated expression of antioxidant genes such as hemeoxygenase-1 (HO-1) and NAD(P)H:quinone acceptor oxidoreductase-1 (NQO-1)21, 22. Therefore, Nrf2 is considered as a promising therapeutic target for treating intestinal oxidation stress-related diseases23. Metformin is widely known as a pharmacotherapy for the treatment of Type 2 Diabetes (T2D)24. Recently, emerging evidence reveal that metformin exerts a 4


Page 4 of 41

Page 5 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


beneficial role in alleviating intestinal dysbiosis. Metformin has been found to maintain gut microbial balance in Type 2 Diabetes, at least partially25. Furthermore, it has been discovered that metformin improves epithelial barrier function in IL10 KO mice26. In a very recent study, Deng et al provided convincing evidence indicating that metformin could protect against dextran sulfate sodium (DSS)-induced intestinal barrier damage and intestinal inflammation27. Moreover, several experimental findings suggest metformin suppresses the activation of inflammatory signaling pathways both in in vivo and in vitro inflammatory models, thus resulting in the reduced inflammation responses14, 28. These data together indicate that metformin is capable of regulating intestinal barrier homeostasis. Mechanistically, the beneficial effects of metformin in regulating intestinal function are found largely due to activation of AMP-activated protein kinase (AMPK)

14, 26-28

. AMPK is the key factor

that controls systemic energy metabolism29. Also, AMPK is an attractive target for maintaining intestinal barrier function. Epithelial AMPK knockout impaired the assembly of tight junction protein and resulted in intestinal barrier dysfunction in vivo30. Besides, deletion of AMPK in intestine exaggerates DSS-induced colitis, suggesting the involvement of AMPK in the etiology of IBD30. In addition, AMPK can protect LPS-induced barrier dysfunction by ameliorating TJ proteins expression via the suppression of ROS production31. Indeed, AMPK activation is able to counteract oxidative stress and maintain cellular metabolic homeostasis by reducing ROS production in various types of cells32-34. Nevertheless, whether metformin can prevent against LPS-induced intestinal barrier damage or not is still elusive. 5



Furthermore, more studies are needed to reveal the underlying mechanisms on how metformin regulates intestinal homeostasis. In this study, we investigated the protective effects of metformin on intestinal barrier function. Our results suggest that metformin could maintain the stabilization of intestinal tight junction proteins, suppress the activation of pro-inflammatory pathways and reduce the production of ROS both in vitro and in vivo under LPS challenge conditions. These beneficial effects of metformin are dependent on the activation of AMPK. These data reveal the potential possibility of metformin for treating intestinal barrier damage related diseases. MATERIALS AND METHODS Materials. Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), Lipofectamine 3000, and Opti-MEM medium were purchased from Invitrogen (Grand Island, NY, USA). Metformin and Compound C were obtained from Selleck (Houston, USA). LPS (Escherichia coli 055:B5) and other chemicals were from Sigma (Santa Clara, USA). Antibodies against NF-κB, p65 NF-κB, ERK, Nrf2, NQO-1 were from Abcam (Cambridge, UK). Antibodies against I-κBα, p-I-κBα, p-JNK, p-ERK, p-p38 and histone H3 were obtained from Cell Signaling Technology Inc. (Danvers, MA). Rabbit monoclonal antibodies against ZO-1, Occludin, JNK, p38, GAPDH were from Proteintech (Chicago, USA). Antibodies against β-actin and HO-1 were from Hua An bio (Hangzhou, China). Animals and experiment design. Forty 8-weeks old C57BL/6 male mice were obtained from the Laboratory Animal Center of the Chinese Academy of Sciences 6


Page 6 of 41

Page 7 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(Shanghai, China). Animals were housed under pathogen-free conditions on a 12 h light/dark cycle with water and food ad libitum. Mice were randomly divided into five groups, including vehicle (control), LPS, LPS plus metformin (250 mg/kg), LPS plus metformin (500 mg/kg) and metformin (250 mg/kg) groups. Mice were orally administered either vehicle (saline) or metformin (250 or 500 mg/kg) for 3 days. On day 3, mice in LPS and LPS + metformin (250 and 500 mg/kg) groups were intraperitoneally injected with LPS (10 mg/kg) after the last saline/metformin administration. In the meanwhile, the other two groups were injected with a same volume of saline. Then 6 h after the injection, blood and tissue samples were collected and prepared for subsequent biochemical analysis. All the procedures were approved by the Animal Care and Use Committee of Zhejiang University. ELISA. The levels of the cytokines TNF-α and IL6 in the tissues or cell culture medium were determined using ELISA kits (Raybiotech, Norcross, GA). For the measurement of the levels of DAO and DLA in the serum, specific ELISA kits (Boster Wuhan, China) were applied according to the manufacturer’s instructions. H&E staining and immunostaining. Intestinal tissues of the jejunum and colon were harvested and fixed in 4% paraformaldehyde (PFA) solution immediately. Then the tissues were embedded into paraffin, blocked and cut 3-10 µm and were deparaffinized in xylene, followed by H&E staining. Whole slide digital images were collected with a DM3000 microscope (Leica Microsystems, Wetzlar, Germany). The villous heights of the jejunum were measured using Image-Pro software (Media Cybernetics, Rockville, MD). 7



For the immunohistochemical analysis of MPO, the sections were blocked with 1 % w/v BSA for 1 h, and anti-MPO antibody (Abcam, UK) was added and then incubated overnight at 4℃. Next, the samples were treated with HRP-conjugated rabbit anti-goat IgG (Hua An bio, Hangzhou, China), followed by DAB (DAKO USA) addition. Then hematoxylin was used to counterstain the slices. At last, the samples were dehydrated in an ethanol (70–100%) gradient and treated with xylene to increase the transparency of slides. For immunofluorescence staining, cross-sections or cultured cells were fixed in 4 % PFA in PBS for 10 min, blocked in blocking buffer (5% goat serum, 2% bovine serum albumin, 0.1% Triton X-100 and 0.1% sodium azide in PBS) for at least 1 h as previous reported35. Then the samples were incubated with primary antibodies against Claudin1, ZO-1, Occludin and Nrf2 overnight at 4℃. After washing with PBS, the samples were treated with secondary antibodies and DAPI for one hour at room temperature. Images of immunofluorescent samples were captured with an Eclipse Ti-SR microscope with a DS-U3 Image-Pro system (Nikon). In situ TUNEL assay for cell apoptosis detection. Slides were fixed in 4% PFA for 10 min, then subjected to TUNEL staining using the TUNEL Assay Apoptosis Detection Kit (Roche) according to the manufacturer's instructions. Images were taken as mentioned above. Transmission electron microscopy. The jejunum tissues were cut into small pieces and post-fixed in 1% osmic acid for 1–2 h after washed with PBS. Thereafter, the samples were washed in PBS and dehydrated in a gradient ethanol series which 8


Page 8 of 41

Page 9 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


include 50%, 75%, 85%, 95% and 100% ethanol, each for 15 min. Next, the samples were embedded in Epon resin and then were cut into 60-nm ultrathin sections, and sections were counterstained with uranyl acetate and lead citrate. Digital electron micrographs were acquired with a Hitachi HT7700 electron microscope. Cell Culture and Treatment. IPEC-J2 cells were cultured in DMEM-F12 medium supplemented with 10% FBS (Life Technologies) in a humidified 5% CO2 incubator at 37℃.For metformin treatment, cells were pre-treated with metformin (0.5 mM, 1 mM and 2 mM) for 24h, followed by LPS (1 µg/ml) stimulation for 6h. For Compound C treatment, 1µM Compound C was added to the culture medium and the monolayers were cultured 24h before LPS stimulation. Measurement of transepithelial electrical resistance (TER). IPEC-J2 cells were seeded in 12-well transwell chambers with a membrane area of 1.12 cm2 and a pore size of 0.4 µm (Corning Incorporated, Corning, NY, USA). After 21d culture, the monolayers were treated with metformin or metformin plus Compound C for 24h, followed by LPS treatment. At different times (0, 1, 2, 4, 8, 12 and 24 h), TEER values of different groups were measured using an Evom2 epithelial voltohmmeter according to the manufacturer’s instructions. Measurement of IPEC-J2 Cell Permeability to FD4. 100 µL of FD4 (1 mg/mL) was added to to the upper compartments immediately after the last measurement of TEER value. Then, the plates were cultured in incubator for another 30 min. Thereafter, 100 µL of medium from each lower compartments were collected to detect

9



the fluorescence intensity at an excitation wavelength of 480 nm and an emission wavelength of 520 nm. siRNA transfection. An AMPKα1 siRNA and a negative control (siCTRL) were designed and produced by RiboBio Company (Guangzhou, China). The cells were seeded into plates without any antibiotics 24h before transfection. Then, 100 nM siAMPKα1 or siCTRL was transfected into IPEC-J2 cells using Lipofectamine 3000 (Invitrogen) as described before36. Detection of ROS generation. For detection of ROS generation in mouse intestine, fresh mouse intestinal segments were collected and frozen at −80 °C. Then these samples were sliced into pieces and stained with DHE at 37 °C for 30 min. Next, the nuclei were stained with DAPI for 10min, and finally, these sections were sealed and images were captured by fluorescence microscopy. For detection of ROS level in IPEC-J2 cells, an ROS detection kit (Beyotime, China) was applied according to the manufacturer’s instructions. Briefly, cells were incubated with 10 µM DCFH-DA for 20 min, and then the cells were washed with FBS-free medium three times and imaged under fluorescence microscopy. For evaluating ROS generation by flow cytometry, cells were digested and collected into tubes after staining with DCFH-DA according to the standard protocol as mentioned above. RNA extraction and quantitative RT-PCR. The total RNA from cells were extracted by using the TRIzol Reagent (Invitrogen). RevertAid Reverse Transcriptase (Fermentas) was applied to synthesize cDNA. Real-time PCR was performed in the 10


Page 10 of 41

Page 11 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


StepOnePlusTM Real Time System (Applied Biosystems) and the reaction steps are as follows: 50 °C for 2 min, 95 °C for 10 min followed by 40 cycles at 95 °C for 10 s, and then 60 °C for 30 s. The primers for RT-PCR to amplify IL-10, IL-1β and GAPDH (internal standard) are as follows (where F represents forward and R represents reverse): IL-10 (F), GGGAAAGCTAGTGGGCTATTT; IL-10 (R), TCCTATGAGTGTAAGCGACTTTG;

IL-1β

(F),

GACCTTAGGGATCAAGGGAAAG; IL-1β (R), CCATGTCCCTCTTTGGGTATC; GAPDH

(F),

CCTCCACTACATGGTCTACA;

GAPDH

(R),

ATGACAAGCTTCCCGTTCTC. The 2−∆∆Ct method was used to quantify mRNA expression relative to GAPDH. Protein extraction and Western blot analysis. IPEC-J2 cells were seeded in 12-well or 6-well plates. After treatments, the total, cytoplasmic, and nuclear extracts were extracted according to the protocols supplied by the manufacturer (Sangon, Shanghai, China). Next, identical amounts of proteins were separated by SDS-PAGE, then blotted onto nitrocellulose membranes. The membranes were blocked with 5% non-fat skim milk as described elsewhere37. They were then incubated with conjugated goat anti-rabbit or anti-mouse antibodies at 4 °C overnight. Thereafter, the membranes were incubated with the secondary antibody for 1 h at room temperature. Finally, the membranes were detected using the EZ-ECL (Biological Industries). Statistical analyses. Quantitative analysis of the protein level and fluorescence intensity was conducted using Image-Pro Plus 6.0. All data presented were as the mean ± SEM and all statistical tests were carried out with the SPSS 22 software. 11



One-way analysis of variance (ANOVA) was used to determine the statistical significance for multiple comparisons, and Student’s t-test was used for the comparisons of two groups. A p value of less than 0.05 was considered statistically significant. RESULTS Metformin protects against LPS-induced downregulation of intestinal TJ proteins As shown in Figure 1A, metformin treatment had no obvious impact on the change of body weights between groups, which is similar with previous report14, suggesting the little toxicity of metformin administration on mice. Next, we found that both 250 mg/kg and 500 mg/kg metformin attenuated LPS-induced villous atrophy in jejunum (Figure 1B), which was further confirmed by analysis of villous heights using Image J (Figure 1C). Additionally, we assessed the histopathological modification in colon and noticed that both metformin plus LPS groups had attenuated the colonic colitis caused by LPS challenge, leading to the ameliorative macroscopic damage index (Figure 1C and D). These data indicate that metformin alleviated LPS-induced intestine tissues injury. TJ exerts the primary role in maintaining intestinal barrier function2, thus we investigated the effect of metformin on intestinal TJ. First, we found that metformin administration reduced the elevated serum diamine oxidase (DAO) and D-Lactate (D-LA) contents after intraperitoneal injection of LPS (Figure 2A, B). Furthermore, pre-treatment with 250 mg/kg and 500 mg/kg metformin markedly decreased 12


Page 12 of 41

Page 13 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


epithelial cell apoptosis resulting from LPS administration (Figure 2C, D). These evidence suggest that metformin ameliorates intestinal barrier dysfunction caused by LPS challenge. By conducting transmission electron microscopy, we observed that LPS destroyed the TJ structure in jejunum, which was strongly fixed by metformin treatments (Figure 2E). In addition, the immunofluorescence results showed that both 250 mg/kg and 500 mg/kg metformin increased ZO1 and Claudin1 protein expressions that were down-regulated by LPS stimulation (Figure 2F, G). Consistently, western blot analysis confirmed that metformin could improve the levels of tight junction proteins (ZO1 and Occludin) which were reduced after LPS injection (Figure 2H, I). Taken together, these results indicate that metformin restores the damaged tight junction caused by LPS in mice. In parallel, we determined the effect of metformin on LPS-induced intestinal barrier dysfunction in vitro. After 21d culture in transwell, IPEC-J2 cells were pre-treated with metformin (0.5 mM, 1 mM or 2 mM) for 24h, followed by LPS stimulation for 6h. TER measurement results showed that LPS markedly destroyed intestinal barrier after 1h, and the TER value remained approximately 40% of the baseline value since then (Supplementary Figure 1A). However, in the cells pretreated with metformin, the TER values were considerably elevated after 1h and reached approximately 80% of the baseline values eventually under LPS treatment condition (Supplementary Figure 1A). As shown in Supplementary Figure 1B, LPS induced a 3.0-fold increase in FD4 permeation over that in control group, which was significantly attenuated by metformin. At the molecular level, we found that 13



metformin treatments upregulated the protein levels of ZO1 and Occludin as well as the fluorescence of Claudin1 that were decreased by LPS (Supplementary Figure 1C-E). These results indicate that metformin has a positive effect on recovering LPS-induced intestinal barrier damage in vitro. Metformin alleviates LPS-induced intestinal inflammation Intestinal inflammation is associated with intestinal barrier dysfunction. Myeloperoxidase (MPO) is recognized in tissues as a hallmark of inflammation38. In our study, we observed that LPS significantly enhanced MPO activity in jejunum compared with control mice as shown by MPO immunohistochemistry (Figure 3A). Metformin administration (250 mg/kg and 500 mg/kg) obviously decreased MPO content, revealing the attenuated intestinal inflammatory response after LPS challenge (Figure 3A). Similarly, by performing ELISA, we found that both metformin treatments reduced the contents of inflammatory markers TNF-α and IL-6 in jejunum compared with that in LPS-stimulated mice (Figure 3B, C). NF-κB is involved in the pathogenesis of intestinal inflammation11. The phosphorylation of NF-κB in mice jejunum significantly increased after LPS stimulation. Pretreatment with both concentrations of metformin reversed the increase (Figure 3D). Moreover, we investigated the phosphorylation of I-κBα after treated with LPS and metformin. Our results showed that metformin treatments down-regulated the levels of p-I-κBα compared with LPS group (Figure 3D). Besides, we noticed that the phosphorylation of MAPKs (JNK, ERK and p38) were all enhanced after LPS challenge, but were inhibited by metformin i.p. injection (Figure 3E). These results suggest that 14


Page 14 of 41

Page 15 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


metformin can inhibit LPS-induced intestinal inflammation, and regulate intestinal NF-κB activity via I-κBα and MAPK pathways. Meanwhile, we conducted in vitro experiments to confirm the effect of metformin on intestinal inflammation. We treated IPEC-J2 cells with metformin for 24h and then LPS for 6h. By carrying out ELISA analysis on culture media, we found that LPS stimulation markedly increased TNF-α and IL-6 concentrations while all three metformin treatments reduced the excessive concentrations of inflammatory factors (Supplementary Figure 2A, B). At the transcriptional level, metformin inhibited the elevated mRNA levels of IL-10 and IL-1β that were due to LPS stimulation (Supplementary Figure 2C). Phosphorylation of NF-κB and I-κBα was significantly increased in LPS treatment group, but metformin supplementation considerably diminished such changes (Supplementary Figure 2D). In addition, metformin rectified the increase of ERK, JNK, and p38 MAPK phosphorylation that were caused by LPS challenge (Supplementary Figure 2E). These findings are consistent with that in vivo. Metformin ameliorates LPS-induced intestinal oxidative stress To investigate the effect of metformin on intestinal oxidative stress, we performed ROS staining on mice jejunum tissues. We found that compared with control group, LPS stimulation manifestly promoted ROS generation, in the meanwhile, both 250 mg/kg and 500 mg/kg metformin noticeably reduced the ROS accumulation caused by LPS stimulation (Figure 4A), which was verified by ROS generation statistics (Figure 4B). ROS has been shown to cause lipid peroxidation, 15



thus leads to generate Malondialdehyde(MDA)39. The content of MDA was about 2.0-fold higher after LPS i.p. injection, however, metformin treatments markedly counteracted this increase (Figure 4C). Western blot analysis revealed that orally administration of metformin significantly enhanced Nrf2 protein levels in mice jejunum. Consistently, NQO-1 and HO-1 were both upregulated in metformin groups (Figure 4D, E). Collectively, these data indicate that metformin can mitigate LPS-induced intestinal oxidative stress. Simultaneously, we evaluated the effect of metformin on cellular oxidative stress. After treatments, IPEC-J2 cells were stained with 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA) and then fluorescent images were captured. LPS stimulation remarkably increased ROS content in IPEC-J2 cells, which was quite inhibited by metformin treatments (Supplementary Figure 3A). Furthermore, we performed flow cytometry, and results showed that all metformin treatments could considerably reduce the excessive ROS contents that were caused by LPS (Supplementary Figure 3B, C). Nrf2 has been found to translocate to the nucleus under oxidative stress21. As shown in Supplementary Figure 3D, LPS alone induced little nuclear translocation of Nrf2, while metformin treatments significantly enhanced the nuclear translocation of Nrf2 in LPS treated cells. We also found that metformin alone (1 mM) could promoted Nrf2 translocating into nucleus. As expected, metformin significantly promoted the expression of Nrf2 target genes NQO-1 and HO-1 (Supplementary Figure 3E). These results are in agreement with that in vivo.

16


Page 16 of 41

Page 17 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


AMPK is required for the beneficial effect of metformin on protecting LPS-induced intestinal TJ disruption We next determined whether AMPK is involved in the metformin action on protecting intestinal barrier. Indeed, AMPK was inhibited by LPS but activated when treated with LPS plus metformin in mice intestinal tissues (Supplementary Figure 4A, B). Moreover, phosphorylation of AMPK is also decreased in LPS treated IPEC-J2 cells, which was reversed by metformin (Figure S4C). Metformin alone notably upregulated AMPK activity both in vivo and in vitro (Supplementary Figure 3A-C). Subsequently, we pre-treated IPEC-J2 monolayers with metformin and AMPK inhibitor Compound C for 24h and then LPS for 6h after 21d culture in transwell. TER results showed that LPS rapidly destroyed intestinal barrier function in 1h and kept about 40% of the baseline value thereafter, as well as the LPS plus metformin and Compound C group, both of which had a higher FD4 permeation compared with control group (Figure 5A, B). On the other hand, metformin significantly diminished the TER value decline that was caused by LPS, which was further confirmed by FD4 permeation measurements (Figure 5A, B). We next treated IPEC-J2 cells with siRNA to knock down AMPKα1 expression (also known as Prkaa1, the predominate subunit in intestine30). As shown in Figure 5C, AMPKα protein level was 70% off after siRNA-mediated interference. Rapid reduction of ZO-1 and Occludin protein levels by LPS were suppressed by metformin in IPEC-J2 cells, but this effect was abolished by AMPK knockdown (Figure 5D). These data suggest that AMPK is essential for

17



metformin to protect against LPS-induced intestinal barrier dysfunction and tight junction disruption. AMPK is indispensable for metformin action on alleviating LPS-induced intestinal inflammation To ascertain the involvement of AMPK in the protective effects of metformin against LPS-induced intestinal inflammation, we examined the effect of AMPK siRNA on metformin action. The inhibitory effect of metformin on the excessive production of TNFα and IL-6 by LPS were partially but significantly attenuated by Prkaa1 siRNA (Figure 6A, B). Next, we examined the effect of Prkaa1 siRNA on the metformin-induced phosphorylation of I-κBα and NF-κB. Metformin noticeably alleviated the increased phosphorylation of both I-κBα and NF-κB induced by LPS. Conversely, Prkaa1 siRNA treatment considerably abolished those changes (Figure 6C). Likewise, compared with control group, Prkaa1 knockdown blunted metformin action on the ERK, JNK and p38 MAPKs inactivation (Figure 6D). Taken together, our results indicate that AMPK is indispensable for metformin action on inhibiting intestinal inflammation induced by LPS. siRNA-mediated AMPK knockdown diminished the effect of metformin on reducing ectopic intestinal ROS production As shown in Figure 7A, 1 mM metformin could conspicuously attenuated the ectopic accumulation of ROS induced by LPS in IPEC-J2 cells. When cells were treated with siPrkaa1, the effect of metformin on ROS generation was eliminated as shown by fluorescence. Moreover, we performed flow cytometry and results revealed 18


Page 18 of 41

Page 19 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the similar phenomenon as mentioned above (Figure 7B). These data together suggest AMPK is imperative for metformin to attenuate LPS-stimulated intestinal oxidative stress. Nrf2 plays the key role in sensing cellular oxidative stress21. As confirmed above, metformin treatment promoted Nrf2 translocation into the nucleus. In AMPK knockdown cells, metformin-induced nuclear translocation of Nrf2 under LPS stimulation was significantly reduced (Figure 7C). Consequently, inhibition of AMPK blocked the promotion effect of metformin on Nrf2 target genes HO-1 and NQO-1 expression (Figure 7D). Collectively, our results indicate that AMPK is vital in the metformin action on reducing ectopic ROS production caused by LPS. Discussion In this study we identified a beneficial effect of metformin on protecting against LPS-induced intestinal barrier dysfunction. We found that metformin treatment could ameliorate

intestinal

tight

junction

protein

abundance,

alleviate

intestinal

inflammation and reduce ROS generation under LPS stimulation condition, thus leading to improved intestinal barrier function. Furthermore, we elucidated the underlying mechanism through which metformin protected intestinal barrier. Our study provides critical understandings of the effect of metformin on regulating intestinal barrier homeostasis. Tight junction complex plays crucial roles in determining intestinal barrier function2, while it could be disrupted by LPS stimulation40. Metformin has been discovered to be able to maintain tight junction. It is reported that metformin 19



Page 20 of 41

treatment prevents P. aeruginosa-induced disruption of airway epithelial tight junction41. Additionally, metformin improves tight junction protein expression and thus reduces blood-brain barrier disruption42. Recently, researches indicate that metformin upregulates tight junction protein levels in injured intestinal epithelial cells, which may through targeting Myosin light chain kinase (MLCK)-Myosin light chain (MLC) signaling pathway27,

43

. Another study shows that metformin treatment

protects against the loss of intestinal tight junction proteins induced by fructose44. In this study, we found that metformin (250 mg/kg and 500 mg/kg) significantly enhanced tight junction proteins expression that was decreased by LPS stimulation both in vivo and in vitro. Combined with above results, these data reveal a protective role of metformin on intestinal tight junction. Emerging evidence suggest that AMPK is imperative for maintaining tight junction. Activation of AMPK by 5-aminoimidizole-4-carboxamide riboside facilitates tight junction assembly upon calcium switch in MDCK cells45,

46

.

Overexpression of AMPK in Caco-2 cells leads to faster ZO-1 assembly during calcium switch compared with control and/or AMPK mutant group. Mechanistically, AMPK modulates the expression of caudal type homeobox 2 (CDX2) to promote intestinal differentiation30. Furthermore, AMPK has been found to fortify epithelial tight junction by targeting its effector GIV/Girdin during energetic stress47. In the present study, we confirmed that metformin treatment significantly upregulated intestinal AMPK activity both in vivo and in vitro. When AMPK activity was inhibited, metformin failed to ameliorate LPS-induced tight junction protein levels 20


Page 21 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


reduction and resulted in increased intestinal permeability in IPEC-J2 cells. These results indicate that the protective effect of metformin on intestinal tight junction is dependent on AMPK. Intestinal inflammation is largely associated with tight junction disruption and barrier dysfunction9. Deng et al report that metformin markedly alleviates colitis by decreasing the contents of pro-inflammatory cytokines IL-6, TNF-a and IL-1β both in colon and in serum27. Likewise, in murine macrophages, metformin can suppress LPS-induced inflammatory response, mainly through reducing LPS-induced NF-κB (p65) binding to promoter regions, and thus inhibiting the excessive production of TNF-α and IL-614. In this study, we provided evidence suggesting that metformin treatments (250 mg/kg and 500 mg/kg) could significantly prohibit LPS-induced pro-inflammatory cytokines IL-6 and TNF-α generation in mice intestinal tissues, leading to ameliorative intestinal morphology. Moreover, metformin notably mitigated NF-κB (p65) phosphorylation levels after LPS stimulation in mice jejunum and in IPEC-J2 cells via inhibiting I-κBα activity. ERK, JNK, and p38 MAPK pathways are activated in pro-inflammatory response16 and can be modulated by metformin14, 27, 48. We found that metformin suppressed ERK, JNK, and p38 MAPK phosphorylation under condition of LPS stimulation both in intestinal tissue and in intestinal epithelial cell. As MAPKs regulate NF-κB activity15, it can be concluded that metformin may control NF-κB action by targeting MAPKs signaling cascades, which could be considered as a novel strategy to manage the inflammatory diseases.

21



Our results showed that inhibition of AMPK diminished the effect of metformin on NF-κB activity in intestinal epithelial cells. NF-κB is the key regulator of innate immunity and inflammation, and a large amount of studies illustrate that as a repressor of inflammation, AMPK can inhibit the activation of NF-κB system through several pathways such as p53/FoxO, Sirt1 and oxidative stress 49. Kim et al prove that in murine macrophages, AMPK governs NF-κB binding to promoter regions in nucleus by targeting ATF3 when cells are treated with metformin under LPS stimulation condition14. In addition, AMPK has been found to regulate I-κBα phosphorylation and then affect NF-κB activity upon stimulation50. In this study, metformin reduced I-κBα degradation by inhibiting I-κBα phosphorylation, but this effect was abolished by AMPK knockdown. Another pathway involved in the regulation of NF-κB activity is MAPKs15. Reportedly, AMPK can modulate MAPKs signaling cascades in pathogenesis of diabetic cardiomyopathy51. In line with previous findings in macrophages14, we noticed that AMPK inhibition diminished the suppression effect of metformin on ERK, JNK, and p38 MAPK phosphorylation, which might be the cause of elevated NF-κB activity and aggravated inflammatory response in intestinal epithelial cells treated with LPS. One key finding of this study is that metformin remarkably alleviated intestinal ROS generation induced by LPS stimulation. Excessive intestinal ROS is associated with pathogenesis of intestinal inflammation, which leads to intestinal barrier disruption18-20. Metformin could decrease ROS generation and oxidative stress upon hyperglycaemia induction in endothelial cells52, 53. Further investigation reveals that 22


Page 22 of 41

Page 23 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


metformin can increase the intracellular NADH/NAD+ ratio through mitochondrial respiratory chain complex I, thus resulting in the decreased intracellular ROS54. Our study provided explicit evidence that metformin scavenged LPS-induced intestinal ROS and alleviated oxidative stress, which, to our knowledge, is the first time reporting the beneficial role of metformin on inhibiting intestinal oxidative stress upon LPS stimulation. These findings contribute to understand the effect of metformin on maintaining intestinal barrier homeostasis. Nrf2 plays a vital role in responding and modulating intracellular oxidative stress21. The anti-oxidative effect of Nrf2 is basically depending on its nuclear translocation and stabilization. Under basal condition, Nrf2 stays with the inhibitory protein Keap-1, and these two proteins form an inactive complex, sequestered in the cytoplasm; upon stimulation, Nrf2 dissociates from Nrf2/Keap-1 complex and translocates to nucleus where it binds to the antioxidant responsive element (ARE)21, 55

. As antioxidant response elements, when Nrf2 is activated, HO-1 and NQO-1

expressions are significantly upregulated22. Increasing evidence suggest that metformin could activate Nrf2 via its nuclear translocation, which leads to activation of antioxidant response elements56, 57. Consistently, in the present study, we found metformin markedly promoted Nrf2 nuclear translocation in intestinal epithelial cells, followed by activating antioxidant response effectors HO-1 and NQO-1, which eventually resulted in alleviated cellular oxidative stress under LPS stimulation. Nevertheless, further studies are needed to reveal the exact regulatory mechanism of metformin on Nrf2 action. 23



Recently, the crosstalk between Nrf2 cascades and AMPK pathway has been frequently noted. In Human umbilical vein ECs, activation of AMPK by AICAR enhances Nrf2 protein level in a dose-dependent manner but inhibition of adenosine kinase by 5’-iodotubercidin counteracts this promotion effect, indicating the necessity of AMPK activity for the activation of Nrf258. Moreover, Mo et al report that either pharmacologically or genetically inactivated AMPK diminishes the activation of Nrf2 induced by berberine in macrophages59. They also notice that inhibition of AMPK blocks berberine-induced Nrf2 nuclear translocation, and leads to decreased HO-1 and NQO-1 expression. Similarly, we found that when AMPK was knockdown in intestinal epithelial cells, metformin-induced Nrf2 nuclear translocation was obviously inhibited, accompanied with reduced HO-1 and NQO-1 protein levels. These results confirm the essential role of AMPK in the Nrf2 action responding to cellular oxidative stress. Metformin has long been proved to activate AMPK60. In addition, researches reveal that the action of metformin on LPS-induced injury is mediated by activating AMPK61-63. However, increasing evidence indicate that metformin may function in AMPK-independent pathways64. Kalender et al found that metformin inhibits mTORC1 depending on the Rag GTPases instead of AMPK in mouse embryonic fibroblasts (MEF)65. Moreover, metformin has been shown to suppress LPS-induced inflammation in rat primary microglial cultures through AMPK-independent signaling66. Do et al found that metformin regulated Nrf2/HO-1 signaling via Raf-ERK pathway rather than AMPK in cancer cells67. In the present study, we 24


Page 24 of 41

Page 25 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


demonstrated that metformin alleviated LPS-induced oxidative stress, inflammation and tight junction disruption through activating AMPK by conducting siPrkaa1 transfection in IPEC-J2 cells. Together with previous studies14, 27, it can be concluded that, although AMPK can be modulated by metformin, whether metformin action is mediated by activating AMPK is not always certain and possibly depending on cell types. In conclusion, our study for the first time demonstrates that metformin mitigates intestinal tight junction dysfunction, inflammation and oxidative stress both in LPS-shocked intestinal epithelial cells and mice. We further verify that AMPK signalling is indispensable in the beneficial effect of metformin on protecting LPS-induced intestinal barrier dysfunction. This finding provides new insights on the metformin-mediated signal transduction and gene regulations involved in intestinal barrier homeostasis. Such knowledge may provide an opportunity to develop a novel therapeutic drug to treat intestinal barrier disorders. ACKNOWLEDGEMENTS This work was supported by the Key Program of the National Natural Science Foundation of China (3163000269). We thank the staff at the Electronic Microscopy Center and Agricultural, Biological, and Environmental Test Center in Zhejiang University for their assistance. Supporting Information description Supplementary Figure 1, Figure 2, Figure 3 and Figure 4.

25



Page 26 of 41

References 1.

Turner, J. R.

Intestinal mucosal barrier function in health and disease. Nat Rev Immunol 2009, 9,

(11), 799-809. 2.

Odenwald, M. A.; Turner, J. R.

The intestinal epithelial barrier: a therapeutic target? Nat Rev

Gastroenterol Hepatol 2017, 14, (1), 9-21. 3.

Marchiando, A. M.; Graham, W. V.; Turner, J. R.

Epithelial barriers in homeostasis and disease.

Annu Rev Pathol 2010, 5, 119-44. 4.

Fanning, A. S.; Anderson, J. M.

Zonula Occludens-1 and-2 Are Cytosolic Scaffolds That Regulate

the Assembly of Cellular Junctions. Ann Ny Acad Sci 2009, 1165, 113-120. 5.

Gunzel, D.; Yu, A. S.

Claudins and the modulation of tight junction permeability. Physiol Rev

2013, 93, (2), 525-69. 6.

Amasheh, S.; Fromm, M.; Gunzel, D.

Claudins of intestine and nephron - a correlation of

molecular tight junction structure and barrier function. Acta Physiol 2011, 201, (1), 133-140. 7.

Furuse, M.; Hirase, T.; Itoh, M.; Nagafuchi, A.; Yonemura, S.; Tsukita, S.; Tsukita, S.

Occludin - a

Novel Integral Membrane-Protein Localizing at Tight Junctions. J Cell Biol 1993, 123, (6), 1777-1788. 8.

Al-Sadi, R.; Khatib, K.; Guo, S.; Ye, D.; Youssef, M.; Ma, T.

Occludin regulates macromolecule flux

across the intestinal epithelial tight junction barrier. Am J Physiol Gastrointest Liver Physiol 2011, 300, (6), G1054-64. 9.

Schulzke, J. D.; Ploeger, S.; Amasheh, M.; Fromm, A.; Zeissig, S.; Troeger, H.; Richter, J.; Bojarski, C.;

Schumann, M.; Fromm, M.

Epithelial tight junctions in intestinal inflammation. Ann N Y Acad Sci

2009, 1165, 294-300. 10. Guo, S. H.; Nighot, M.; Al-Sadi, R.; Alhmoud, T.; Nighot, P.; Ma, T. Y.

Lipopolysaccharide

Regulation of Intestinal Tight Junction Permeability Is Mediated by TLR4 Signal Transduction Pathway Activation of FAK and MyD88. J Immunol 2015, 195, (10), 4999-5010. 11. Schottelius, A. J.; Baldwin, A. S., Jr.

A role for transcription factor NF-kappa B in intestinal

inflammation. Int J Colorectal Dis 1999, 14, (1), 18-28. 12. Tak, P. P.; Firestein, G. S.

NF-kappaB: a key role in inflammatory diseases. J Clin Invest 2001, 107,

(1), 7-11. 13. Yang, H. L.; Lin, M. W.; Korivi, M.; Wu, J. J.; Liao, C. H.; Chang, C. T.; Liao, J. W.; Hseu, Y. C. Coenzyme Q0 regulates NFkappaB/AP-1 activation and enhances Nrf2 stabilization in attenuation of LPS-induced inflammation and redox imbalance: Evidence from in vitro and in vivo studies. Biochim Biophys Acta 2016, 1859, (2), 246-61. 14. Kim, J.; Kwak, H. J.; Cha, J. Y.; Jeong, Y. S.; Rhee, S. D.; Kim, K. R.; Cheon, H. G.

Metformin

suppresses lipopolysaccharide (LPS)-induced inflammatory response in murine macrophages via activating transcription factor-3 (ATF-3) induction. J Biol Chem 2014, 289, (33), 23246-55. 15. Schulze-Osthoff, K.; Ferrari, D.; Riehemann, K.; Wesselborg, S.

Regulation of NF-kappa B

activation by MAP kinase cascades. Immunobiology 1997, 198, (1-3), 35-49. 16. Johnson, G. L.; Lapadat, R.

Mitogen-activated protein kinase pathways mediated by ERK, JNK,

and p38 protein kinases. Science 2002, 298, (5600), 1911-2. 17. Kaminska, B.

MAPK signalling pathways as molecular targets for anti-inflammatory therapy -

from molecular mechanisms to therapeutic benefits. Bba-Proteins Proteom 2005, 1754, (1-2), 253-262. 18. Bhattacharyya, A.; Chattopadhyay, R.; Mitra, S.; Crowe, S. E.

Oxidative stress: an essential factor

26


Page 27 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in the pathogenesis of gastrointestinal mucosal diseases. Physiol Rev 2014, 94, (2), 329-54. 19. Regmi, S. C.; Park, S. Y.; Ku, S. K.; Kim, J. A.

Serotonin regulates innate immune responses of

colon epithelial cells through Nox2-derived reactive oxygen species. Free Radical Bio Med 2014, 69, 377-389. 20. Dijkstra, G.; Moshage, H.; van Dullemen, H. M.; de Jager-Krikken, A.; Tiebosch, A. T.; Kleibeuker, J. H.; Jansen, P. L.; van Goor, H.

Expression of nitric oxide synthases and formation of nitrotyrosine and

reactive oxygen species in inflammatory bowel disease. J Pathol 1998, 186, (4), 416-21. 21. Kaspar, J. W.; Niture, S. K.; Jaiswal, A. K.

Nrf2:INrf2 (Keap1) signaling in oxidative stress. Free

Radic Biol Med 2009, 47, (9), 1304-9. 22. Ma, Q.

Role of nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol Toxicol 2013, 53,

401-26. 23. Aleksunes, L. M.; Manautou, J. E.

Emerging role of Nrf2 in protecting against hepatic and

gastrointestinal disease. Toxicol Pathol 2007, 35, (4), 459-73. 24. Pernicova, I.; Korbonits, M.

Metformin-mode of action and clinical implications for diabetes

and cancer. Nat Rev Endocrinol 2014, 10, (3), 143-156. 25. Forslund, K.; Hildebrand, F.; Nielsen, T.; Falony, G.; Le Chatelier, E.; Sunagawa, S.; Prifti, E.; Vieira-Silva, S.; Gudmundsdottir, V.; Pedersen, H. K.; Arumugam, M.; Kristiansen, K.; Voigt, A. Y.; Vestergaard, H.; Hercog, R.; Costea, P. I.; Kultima, J. R.; Li, J. H.; Jorgensen, T.; Levenez, F.; Dore, J.; Nielsen, H. B.; Brunak, S.; Raes, J.; Hansen, T.; Wang, J.; Ehrlich, S. D.; Bork, P.; Pedersen, O.; Consortium, M.

Disentangling type 2 diabetes and metformin treatment signatures in the human

gut microbiota. Nature 2015, 528, (7581), 262-+. 26. Xue, Y.; Zhang, H.; Sun, X.; Zhu, M. J.

Metformin Improves Ileal Epithelial Barrier Function in

Interleukin-10 Deficient Mice. PLoS One 2016, 11, (12), e0168670. 27. Deng, J.; Zeng, L.; Lai, X.; Li, J.; Liu, L.; Lin, Q.; Chen, Y.

Metformin protects against intestinal

barrier dysfunction via AMPKalpha1-dependent inhibition of JNK signalling activation. J Cell Mol Med 2018, 22, (1), 546-557. 28. Koh, S. J.; Kim, J. M.; Kim, I. K.; Ko, S. H.; Kim, J. S.

Anti-inflammatory mechanism of metformin

and its effects in intestinal inflammation and colitis-associated colon cancer. J Gastroenterol Hepatol 2014, 29, (3), 502-10. 29. Hardie, D. G.; Ross, F. A.; Hawley, S. A.

AMPK: a nutrient and energy sensor that maintains

energy homeostasis. Nat Rev Mol Cell Bio 2012, 13, (4), 251-262. 30. Sun, X.; Yang, Q.; Rogers, C. J.; Du, M.; Zhu, M. J.

AMPK improves gut epithelial differentiation

and barrier function via regulating Cdx2 expression. Cell Death Differ 2017, 24, (5), 819-831. 31. Zhao, Z. H.; Hu, J.; Gao, X. P.; Liang, H.; Liu, Z.

Activation of AMPK attenuates

lipopolysaccharide-impaired integrity and function of blood-brain barrier in human brain microvascular endothelial cells. Exp Mol Pathol 2014, 97, (3), 386-392. 32. Li, X. N.; Song, J.; Zhang, L.; LeMaire, S. A.; Hou, X. Y.; Zhang, C.; Coselli, J. S.; Chen, L.; Wang, X. L.; Zhang, Y.; Shen, Y. H.

Activation of the AMPK-FOXO3 Pathway Reduces Fatty Acid-Induced Increase in

Intracellular Reactive Oxygen Species by Upregulating Thioredoxin. Diabetes 2009, 58, (10), 2246-2257. 33. Rabinovitch, R. C.; Samborska, B.; Faubert, B.; Ma, E. H.; Gravel, S. P.; Andrzejewski, S.; Raissi, T. C.; Pause, A.; St-Pierre, J.; Jones, R. G.

AMPK Maintains Cellular Metabolic Homeostasis through

Regulation of Mitochondrial Reactive Oxygen Species. Cell Rep 2017, 21, (1), 1-9. 34. Song, P.; Wang, S.; He, C.; Wang, S.; Liang, B.; Viollet, B.; Zou, M. H. 27


AMPKalpha2 deletion


Page 28 of 41

exacerbates neointima formation by upregulating Skp2 in vascular smooth muscle cells. Circ Res 2011, 109, (11), 1230-9. 35. Shan, T.; Xiong, Y.; Zhang, P.; Li, Z.; Jiang, Q.; Bi, P.; Yue, F.; Yang, G.; Wang, Y.; Liu, X.; Kuang, S. Lkb1 controls brown adipose tissue growth and thermogenesis by regulating the intracellular localization of CRTC3. Nat Commun 2016, 7, 12205. 36. Wu, W.; Feng, J.; Jiang, D.; Zhou, X.; Jiang, Q.; Cai, M.; Wang, X.; Shan, T.; Wang, Y.

AMPK

regulates lipid accumulation in skeletal muscle cells through FTO-dependent demethylation of N(6)-methyladenosine. Sci Rep 2017, 7, 41606. 37. Wu, W.; Xu, Z.; Zhang, L.; Liu, J.; Feng, J.; Wang, X.; Shan, T.; Wang, Y.

Muscle-specific deletion

of Prkaa1 enhances skeletal muscle lipid accumulation in mice fed a high-fat diet. J Physiol Biochem 2017. 38. Cenac, N.; Coelho, A. M.; Nguyen, C.; Compton, S.; Andrade-Gordon, P.; MacNaughton, W. K.; Wallace, J. L.; Hollenberg, M. D.; Bunnett, N. W.; Garcia-Villar, R.; Bueno, L.; Vergnolle, N.

Induction

of intestinal inflammation in mouse by activation of proteinase-activated receptor-2. Am J Pathol 2002, 161, (5), 1903-15. 39. Khoo, C.; Martin, M.; Ramos, S.; Mateos, R.; Bravo, L.; Marais, J.; Goya, L.

Phenolic Extracts of

Cranberry Positively Modulate Endogenous Antioxidant Defenses and Signalling Pathways Against Oxidative Challenge. Faseb J 2015, 29. 40. Xie, W.; Wang, H.; Wang, L.; Yao, C.; Yuan, R.; Wu, Q.

Resolvin D1 reduces deterioration of tight

junction proteins by upregulating HO-1 in LPS-induced mice. Lab Invest 2013, 93, (9), 991-1000. 41. Patkee, W. R.; Carr, G.; Baker, E. H.; Baines, D. L.; Garnett, J. P.

Metformin prevents the effects of

Pseudomonas aeruginosa on airway epithelial tight junctions and restricts hyperglycaemia-induced bacterial growth. J Cell Mol Med 2016, 20, (4), 758-64. 42. Liu, Y.; Tang, G.; Li, Y.; Wang, Y.; Chen, X.; Gu, X.; Zhang, Z.; Wang, Y.; Yang, G. Y.

Metformin

attenuates blood-brain barrier disruption in mice following middle cerebral artery occlusion. J Neuroinflammation 2014, 11, 177. 43. Zhou, H. Y.; Zhu, H.; Yao, X. M.; Qian, J. P.; Yang, J.; Pan, X. D.; Chen, X. D.

Metformin regulates

tight junction of intestinal epithelial cells via MLCK-MLC signaling pathway. Eur Rev Med Pharmacol Sci 2017, 21, (22), 5239-5246. 44. Spruss, A.; Kanuri, G.; Stahl, C.; Bischoff, S. C.; Bergheim, I.

Metformin protects against the

development of fructose-induced steatosis in mice: role of the intestinal barrier function. Lab Invest 2012, 92, (7), 1020-32. 45. Zhang, L.; Li, J.; Young, L. H.; Caplan, M. J.

AMP-activated protein kinase regulates the assembly

of epithelial tight junctions. Proc Natl Acad Sci U S A 2006, 103, (46), 17272-7. 46. Zheng, B.; Cantley, L. C.

Regulation of epithelial tight junction assembly and disassembly by

AMP-activated protein kinase. P Natl Acad Sci USA 2007, 104, (3), 819-822. 47. Aznar, N.; Patel, A.; Rohena, C. C.; Dunkel, Y.; Joosen, L. P.; Taupin, V.; Kufareva, I.; Farquhar, M. G.; Ghosh, P.

AMP-activated protein kinase fortifies epithelial tight junctions during energetic stress via

its effector GIV/Girdin. Elife 2016, 5. 48. Zhou, C.; Sun, R.; Zhuang, S.; Sun, C.; Jiang, Y.; Cui, Y.; Li, S.; Xiao, Y.; Du, Y.; Gu, H.; Liu, Q. Metformin prevents cerebellar granule neurons against glutamate-induced neurotoxicity. Brain Res Bull 2016, 121, 241-5. 49. Salminen, A.; Hyttinen, J. M.; Kaarniranta, K.

AMP-activated protein kinase inhibits NF-kappaB

signaling and inflammation: impact on healthspan and lifespan. J Mol Med (Berl) 2011, 89, (7), 667-76. 28


Page 29 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


50. Tsai, S. C.; Tsai, M. H.; Chiu, C. F.; Lu, C. C.; Kuo, S. C.; Chang, N. W.; Yang, J. S.

AMPK-Dependent

Signaling Modulates the Suppression of Invasion and Migration by Fenofibrate in CAL 27 Oral Cancer Cells Through NF-kappa B Pathway. Environ Toxicol 2016, 31, (7), 866-876. 51. Lakshmanan, A. P.; Harima, M.; Sukumaran, V.; Soetikno, V.; Thandavarayan, R. A.; Suzuki, K.; Kodama, M.; Nagata, M.; Takagi, R.; Watanabe, K.

Modulation of AT-1R/AMPK-MAPK cascade plays

crucial role for the pathogenesis of diabetic cardiomyopathy in transgenic type 2 diabetic (Spontaneous Diabetic Torii) rats. Biochem Pharmacol 2012, 83, (5), 653-60. 52. Gallo, A.; Ceolotto, G.; Pinton, P.; Iori, E.; Murphy, E.; Rutter, G. A.; Rizzuto, R.; Semplicini, A.; Avogaro, A.

Metformin prevents glucose-induced protein kinase C-beta2 activation in human

umbilical vein endothelial cells through an antioxidant mechanism. Diabetes 2005, 54, (4), 1123-31. 53. Kukidome, D.; Nishikawa, T.; Sonoda, K.; Imoto, K.; Fujisawa, K.; Yano, M.; Motoshima, H.; Taguchi, T.;

Matsumura,

T.;

hyperglycemia-induced

Araki,

E.

Activation

mitochondrial

reactive

of

AMP-activated

oxygen

species

protein

kinase

production

and

reduces promotes

mitochondrial biogenesis in human umbilical vein endothelial cells. Diabetes 2006, 55, (1), 120-7. 54. Ling, S. B.; Shan, Q. N.; Liu, P.; Feng, T. T.; Zhang, X. Y.; Xiang, P. H.; Chen, K. C.; Xie, H. Y.; Song, P. H.; Zhou, L.; Liu, J. M.; Zheng, S. S.; Xu, X.

Metformin ameliorates arsenic trioxide hepatotoxicity via

inhibiting mitochondrial complex I. Cell Death Dis 2017, 8. 55. McMahon, M.; Itoh, K.; Yamamoto, M.; Hayes, J. D.

Keap1-dependent proteasomal degradation

of transcription factor Nrf2 contributes to the negative regulation of antioxidant response element-driven gene expression. J Biol Chem 2003, 278, (24), 21592-600. 56. Martin-Montalvo, A.; Mercken, E. M.; Mitchell, S. J.; Palacios, H. H.; Mote, P. L.; Scheibye-Knudsen, M.; Gomes, A. P.; Ward, T. M.; Minor, R. K.; Blouin, M. J.; Schwab, M.; Pollak, M.; Zhang, Y.; Yu, Y.; Becker, K. G.; Bohr, V. A.; Ingram, D. K.; Sinclair, D. A.; Wolf, N. S.; Spindler, S. R.; Bernier, M.; de Cabo, R.

Metformin improves healthspan and lifespan in mice. Nat Commun 2013, 4,

2192. 57. Sykiotis, G. P.; Bohmann, D.

Stress-Activated Cap'n'collar Transcription Factors in Aging and

Human Disease. Sci Signal 2010, 3, (112). 58. Liu, X. M.; Peyton, K. J.; Shebib, A. R.; Wang, H.; Korthuis, R. J.; Durante, W.

Activation of AMPK

stimulates heme oxygenase-1 gene expression and human endothelial cell survival. Am J Physiol Heart Circ Physiol 2011, 300, (1), H84-93. 59. Mo, C. F.; Wang, L.; Zhang, J.; Numazawa, S.; Tang, H.; Tang, X. Q.; Han, X. J.; Li, J. H.; Yang, M.; Wang, Z.; Wei, D. D.; Xiao, H. Y.

The Crosstalk Between Nrf2 and AMPK Signal Pathways Is Important

for the Anti-Inflammatory Effect of Berberine in LPS-Stimulated Macrophages and Endotoxin-Shocked Mice. Antioxid Redox Sign 2014, 20, (4), 574-588. 60. Fryer, L. G.; Parbu-Patel, A.; Carling, D.

The Anti-diabetic drugs rosiglitazone and metformin

stimulate AMP-activated protein kinase through distinct signaling pathways. J Biol Chem 2002, 277, (28), 25226-32. 61. Jian, M. Y.; Alexeyev, M. F.; Wolkowicz, P. E.; Zmijewski, J. W.; Creighton, J. R. Metformin-stimulated AMPK-alpha1 promotes microvascular repair in acute lung injury. Am J Physiol Lung Cell Mol Physiol 2013, 305, (11), L844-55. 62. Vaez, H.; Rameshrad, M.; Najafi, M.; Barar, J.; Barzegari, A.; Garjani, A.

Cardioprotective effect

of metformin in lipopolysaccharide-induced sepsis via suppression of toll-like receptor 4 (TLR4) in heart. Eur J Pharmacol 2016, 772, 115-23. 63. Volarevic, V.; Misirkic, M.; Vucicevic, L.; Paunovic, V.; Simovic Markovic, B.; Stojanovic, M.; 29



Page 30 of 41

Milovanovic, M.; Jakovljevic, V.; Micic, D.; Arsenijevic, N.; Trajkovic, V.; Lukic, M. L.

Metformin

aggravates immune-mediated liver injury in mice. Arch Toxicol 2015, 89, (3), 437-50. 64. Rena, G.; Pearson, E. R.; Sakamoto, K.

Molecular mechanism of action of metformin: old or new

insights? Diabetologia 2013, 56, (9), 1898-906. 65. Kalender, A.; Selvaraj, A.; Kim, S. Y.; Gulati, P.; Brule, S.; Viollet, B.; Kemp, B. E.; Bardeesy, N.; Dennis, P.; Schlager, J. J.; Marette, A.; Kozma, S. C.; Thomas, G.

Metformin, independent of AMPK,

inhibits mTORC1 in a rag GTPase-dependent manner. Cell Metab 2010, 11, (5), 390-401. 66. Labuzek, K.; Liber, S.; Gabryel, B.; Okopien, B.

Metformin has adenosine-monophosphate

activated protein kinase (AMPK)-independent effects on LPS-stimulated rat primary microglial cultures. Pharmacol Rep 2010, 62, (5), 827-48. 67. Do, M. T.; Kim, H. G.; Khanal, T.; Choi, J. H.; Kim, D. H.; Jeong, T. C.; Jeong, H. G.

Metformin

inhibits heme oxygenase-1 expression in cancer cells through inactivation of Raf-ERK-Nrf2 signaling and AMPK-independent pathways. Toxicol Appl Pharm 2013, 271, (2), 229-238.

30


Page 31 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure legends Figure 1. The protective effects of metformin on LPS-stimulated intestinal clinical symptoms in mice. (A) The body weight changes of mice (n=8/group) during the experiment. (B, C) Representative images of the jejunum stained with H&E (B) and the villous height (C) (n=6). (D, E) Representative images of the colon stained with H&E (D) and the microscopic score (E) (n=6). Scale bar, 100 µm. Data are expressed as the mean ± SEM. ##p < 0.01 as compared to the control group, and *p < 0.05 and **p < 0.01 as compared to the LPS-treated group. M250/Met250, 250 mg/kg metformin treatment; M500/Met500, 500 mg/kg metformin treatment. Figure 2. Metformin protects LPS-stimulated intestinal barrier damage and tight junction disruption. (A, B) The contents of DAO (A) and D-LA (B) in mice serum, n=8. (C, D) TUNEL staining of jejunum epithelial tissues (C) and related intensity calculation (D) (n=6, original magnification ×200). (E) Transmission electron microscope images of jejunum (scale bars, 0.2µm). (F, G) Representative immunostaining for ZO1 (F) and Claudin1 (G) in the jejunum (Original magnification ×200). (H, I) Western blot analysis of ZO1 and Occludin protein levels (H) and related intensity calculation (D) (n=4-6). Data are expressed as the mean ± SEM. #p < 0.05 and ##p < 0.01 as compared to the control group; *p < 0.05 , **p < 0.01 and ***p < 0.001 as compared to the LPS-treated group. M250/Met250, 250 mg/kg metformin treatment; M500/Met500, 500 mg/kg metformin treatment. Figure

3.

Metformin

alleviates

LPS-induced

intestinal inflammation.

(A)

Immunohistochemical analysis of MPO in the jejunum. Scale bars, 100 µm. (B, C) 31



The contents of TNF-α (B) and IL-6 (C) in jejunum tissues were determined. (D) Phosphorylated levels of NF-κB (p65) and I-κB in the jejunum were determined by Western blot. (E) Phosphorylated levels of MAPKs (JNK, ERK, p38) in the jejunum were measured by Western blot. All results are present as the mean ± SEM, n=6-8. #p < 0.05 and ##p < 0.01 as compared to the control group; *p < 0.05 as compared to the LPS-treated group. Met250, 250 mg/kg metformin treatment; Met500, 250 mg/kg metformin treatment. Figure 4. Metformin suppresses intestinal oxidative stress induced by LPS treatment. (A, B) Effect of metformin on mouse jejunum ROS production. Scale bars, 100 µm. (C) The MDA levels of jejunum were determined. (D, E) Western blot analysis of antioxidative genes Nrf2, HO1 and NQO1 (D) and the relative intensity was quantified (E). All results are present as the mean ± SEM, n=6-8. #p < 0.05 and ##p < 0.01 as compared to the control group; *p < 0.05 and **p < 0.01 as compared to the LPS-treated group. M250, 250 mg/kg metformin treatment; M500, 500 mg/kg metformin treatment. Figure 5. The beneficial effect of metformin on intestinal TJ disruption depends on AMPK. (A, B) The TER values (A) and FD4 flux (B) in IPEC-J2 cells were measured with LPS, LPS plus metformin and LPS plus metformin and Compound C treatment. (C) The AMPKα level was determined after IPEC-J2 cells were treated with AMPKα1 (Prkaa1) siRNA. (D) The effect of AMPK knockdown on TJ expression was investigated by Western blot. All results are present as the mean ± SEM, n=3. *p < 0.05. L, LPS; M, metformin (1 mM); CC, Compound C (1 µM). IPEC-J2 32


Page 32 of 41

Page 33 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


monolayers were treated with metformin and Compound C for 24h and then LPS for 6h after 21d culture in transwell. Figure 6. AMPK knockdown abolishes the effect of metformin on intestinal inflammation under LPS challenge condition. (A, B) Levels of TNF-α and IL-6 in IPEC-J2 cell culture media were determined by ELISA after AMPK expression was interfered. (C) The effects of AMPK siRNA on NF-κB (p65) and I-κB phosphorylation were determined. (D) The effects of AMPK knockdown on MAPKs phosphorylation were examined. All data are present as the mean ± SEM, n=4. *p < 0.05 versus LPS alone; #p < 0.05 versus control siRNA. L, LPS; M, metformin (1 mM). Figure 7. Effect of AMPK knockdown on metformin action against LPS-induced intestinal oxidative stress. (A) ROS was stained and then visualized using a fluorescence microscope with or without AMPK knockdown in IPEC-J2. (B) ROS level of IPEC-J2 cell was measured through flow cytometry. (C) AMPK knockdown suppressed the metformin action on nuclear translocation of Nrf2. (D) AMPK knockdown suppressed the metformin action on the antioxidative genes HO1 and NQO1 expression. L, LPS; M, metformin (1 mM).

33



Figure graphics Figure 1

34


Page 34 of 41

Page 35 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2

35



Figure 3

36


Page 36 of 41

Page 37 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4

37



Figure 5

38


Page 38 of 41

Page 39 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6

39



Figure 7

40


Page 40 of 41

Page 41 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC Graphic

41


Metformin Protects against LPS-Induced Intestinal Barrier Dysfunction

Recommend Documents