Micro-environmental stiffness regulates dental papilla cell differentiation

Subscriber access provided by - Access paid by the | UCSB Libraries

Biological and Medical Applications of Materials and Interfaces

Micro-environmental stiffness regulates dental papilla cell differentiation: Implications for the importance of fibronectin-paxillin-#-catenin axis Mingru Bai, Jing Xie, Xiaoyu Liu, Xia Chen, Wenjing Liu, Fanzi Wu, Dian Chen, Yimin Sun, Xin Li, Chenglin Wang, and Ling Ye ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b08450 • Publication Date (Web): 13 Jul 2018 Downloaded from http://pubs.acs.org on July 17, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Micro-environmental stiffness regulates dental papilla cell differentiation: Implications for the importance of fibronectin-paxillin-β-catenin axis Mingru Bai1, Jing Xie1, Xiaoyu Liu1, Xia Chen1, Wenjing Liu1, Fanzi Wu1, Dian Chen1, Yimin Sun1, Xin Li1, Chenglin Wang1, Ling Ye*

1.

State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu

610041, P.R. CHINA

*Corresponding author: Ling Ye Professor of State Key Laboratory of Oral Diseases, Dean of West China Hospital of Stomatology, Sichuan University, Chengdu, Sichuan 610064, CHINA Tel: +86 85503497, E-mail: [email protected]

KEYWORDS: stiffness, dental papilla cells, cell behavior, β-catenin, tooth tissue engineering

ACS Paragon Plus Environment

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT The mechanical stiffness of substrates is recognized to be an important physical cue in the microenvironment of local cellular residents in mammalian species due to its great capacity in regulating cell behavior. Dental papilla cells (DPCs) play an important role in the field of dental tissue engineering for their stem cell-like properties. Therefore, it is essential to provide the suitable microenvironment by combining with the physical cues of biomaterials for DPCs to carry out the function of effective tissue regeneration. However, how the substrate stiffness influences the odontogenic differentiation of DPCs is still unclear. Thus, we fabricated polydimethylsiloxane (PDMS) substrates with varied stiffness for cell behavior. Both cell morphology and focal adhesion were shown to have significant changes in response to varied stiffness. Paxillin, an important protein adaptor of focal adhesion kinase (FAK) protein, was shown to interact with both ectoplasmic fibronectin and cytoplasmic β-catenin by co-immunoprecipitation. The resultant changes of β-catenin by varied stiffness were confirmed by immunofluorescent stain and western blotting. Further, the higher quantity nuclear translocation of β-catenin and the less phospho-β-catenin on the stiff substrate were detected. This nuclear translocation in the stiff substrate finally led to an increase mineralization of DPCs relative to the soft substrate detected by Von Kossa and Alizarin Red stain. Taken together, this work not only points out that the substrate stiffness can regulate the odontogenic differentiation potential of DPCs via fibronectin/paxillin/β-catenin pathway, but also provides significant consequence for biomechanical control of cell behavior in cell based tooth tissue regeneration. KEYWORDS: stiffness, dental papilla cells, cell behavior, β-catenin, tooth tissue engineering

ABBREVIATION Dental papilla cells (DPCs) Extracellular matrix (ECM) Intracellular matrix (ICM) Polydimethylsiloxane (PDMS) Atomic force microscope (AFM) Scanning electron microscope (SEM) Alkaline phosphatase (Alp)


Page 2 of 24

Page 3 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1. INTRODUCTION Stem cells and their local microenvironment communicate through soluble cues and physical cues to regulate cell behavior and fate.1,2 The passive physical cues have been confirmed to show time-independent influences on stem cell proliferation and differentiation.2,3 The mechanical stiffness of substrates is one such physical cue to provide the local microenvironment for cells to sense and respond.4,5 The relationship between stiffness and stem/progenitor cell differentiation has been reported in a great many lineages. Mimicking 3D bone marrow stiffness (20-60Pa) with methylcellulose hydrogels improved mouse bone marrow progenitor cell maturation into megakaryocyte with situ–like morphology and higher ploidy and proplatelet formation reported by Alicia Aguilar.6 Analogously, after being cultured with the serum-free neuronal differentiation media, adult neural stem cells had a peak level expression of the neural marker, β-tubulin III, which was observed on the substrates with the stiffness (500Pa) near the physiological brain tissue.7 Adam J. Engler in 2006 reported that the stiffness could direct human mesenchymal stem cell lineage specification with characters of primary neurons, myoblasts and osteoblasts，with cells seeded on the substrates of three stiffness moduli (1KPa, 10KPa, 100KPa) mimicking brain, muscle and crosslinked collagen of osteoids respectively.8 Dental papilla cells (DPCs), derived from dental mesenchymal stem cells, have become important in the field of dental tissue engineering for their stem cell-like qualities with the potential of self-renewal and multilineage differentiation.9-11 Compared with dental pulp and apical papilla developing from tooth germ and existing in the adults, dental papilla cells are directly isolated from tooth germ in the early time of the tooth development which are headed by pluri-potential stem cells and committed progenitor cell populations.12-14 To generate functional new tissue, it is essential to provide the suitable environment for DPCs to carry out the appropriate function under the controlled conditions15. In that way, to more efficiently direct dental papilla cell fate, manipulation of the micro-environmental stiffness could offer us an exciting new tool.16 In recent years, several reports showed a tendency that the dental pulp cells had the odontogenic differentiation potential on the stiffer substrates both in vivo and in vitro.17-19 However, DPCs, another kind of important seed cells for tissue engineering, have rarely been reported with respect to the influence of different stiffness on their differentiation in accordance with our research. Furthermore, it is rarely known that the mechanism including the mechanosensing and mechanotransducing relates with the effect of substrate stiffness on odontogenic differentiation in cells from dental tissue. The elastic moduli of dental tissue vary from about 5.5 kPa for the pulp to 70 GPa for the enamel.20,21 In addition, it was reported that relatively stiff substrates (> 75 kPa) might be required for significant mineralization of dental pulp stromal cell cultures.17 Therefore, in this article, we focused mainly on the effect of various stiffness on the dental papilla cell odontogenic differentiation in the Young’s moduli in a range from about 50 kPa to 1 MPa, combined with the tailored biomaterial system-PDMS. Furthermore, we demonstrated that signals were partly transduced from the extracellular matrix (ECM) to the intracellular matrix (ICM) by fibronectin/paxillin and imported into the nuclei by β-catenin. The progress of differentiation was affected, as the downstream protein of



β-catenin signaling (LEF-1) recognized the binding sites at the promoter of Runx2 or Alp (alkaline phosphatase) genes.

2. MATERIALS AND METHODS 2.1. Cell Culture. Dental papilla cells were isolated and cultured from dental papillae of 1 to 3 days old C57 mice as previously described.12 The mice were sacrificed by spinal dislocation and disinfected by 75% alcohol. Papillae was separated from molars of maxillary and mandible and digested by trypsin for 20 min before type I collagenase (0.3mg/ml) (Sigma-Aldrich, MO, USA) digestion for about 6 h. After being centrifuged at 1500 r/min for 5min and removed the supernatant, the obtained cells were mixed with Dulbecco modified Eagle medium (Hyclone, Logan, UT) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT) and 1% penicillin-streptomycin (Hyclone, Logan, UT), then were seeded on substrates with different stiffness and peri-dish (Corning, Tewksbury MA, USA) in a humidified atmosphere at 37 °C and 5% CO2. 2.2. PDMS Substrates Model Establish. By mixing Sylgard 184 (Corning, NY, USA) and curing agent into the oligomeric base in 4 different volume ratios, PDMS substrates with different stiffness were prepared. (Sylgard184/oligomeric base =1:5, 1:15, 1:30, 1:45). After flowed to cover the peri-dish and left overnight, it was baked at the temperature of 60~70 °C for 24 h. Then the substrates were coated twice in 24 h with dopamine hydrochloride (Sigma-Aldrich, MO, USA) to improve the ability of cell adhesion which was socked in the Tris-HCl and adjusted to PH8, followed by sterilization with UV radiation for 2 h. 2.3. Atomic Force Microscope (AFM). For imaging, the AFM (NanoscopeIIIa system, Digital Instruments, Santa Barbara, CA, USA) was used to form an image of the three-dimensional shape (topography) of a sample surface at a high resolution in tapping mode with 512 × 512 pixel data acquisition. This is achieved by raster scanning the position of the sample with respect to the tip and recording the height of the probe that corresponds to a constant probe-sample interaction. The surface topography was displayed as a pseudo-color plot. 2.4. Scanning Electron Microscope (SEM). After 24 h incubation, cell culture dish was cut into square（1cm × 1cm）, and fixed with 2.5% glutaraldehyde, followed by dehydration with the gradient of ethanol (50%, 70%, 80%, 90%, 100%) for 15 min at each level. After coated with gold, the samples were scanned by SEM. 2.5. Immunofluorescence and Confocal Laser Scanning Microscope (CLSM). The samples were fixed with 4% paraformaldehyde for 30 min after washed with PBS for three times and penetrated with 0.5% Triton X-100 for 10 min. Then they were blocked with 5% Bull Serum Albumin (BSA) (Sigma-Aldrich, St. Louis, MO, USA) for 1 h before interaction with antibody. Primary antibodies included anti-paxillin (rabbit monoclonal, diluted 1:200, Abcam, ab32084), anti-vinculin (rabbit monoclonal, diluted 1:200, Abcam, ab196579), anti-β-catenin (mouse monoclonal, diluted 1:200, Invitrogen, 13-8400), anti-fibronectin (mouse monoclonal, diluted 1:200, Thermo Fisher, MA5-11981), anti-integrin(rabbit polyclonal, diluted 1:200, Sigma, SAB4300361), Alexa Fluor 647 goat


Page 4 of 24

Page 5 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


anti-mouse IgG (diluted 1:200, Abcam, ab150115), Alexa Fluor 647 donkey anti-rabbit IgG (diluted 1:200, Abcam, ab150075). After incubation with the necessary primary antibody overnight, the cells were washed with PBS and incubated with secondary fluorescent antibody and 50 µg/mL fluorescent Phalloidin (Sigma-Aldrich, St. Louis, MO, USA) conjugate solution in PBS for 2 h each at RT. Later, they were stained with 10ug/mL Hoechst 33258 (Sigma-Aldrich, St. Louis, MO, USA) for 10 min and washed with ddH2O. Stained cells were visualized using confocal. (Leica, Germany). 2.6. Western Blotting. The protein was extracted by using radio immunoprecipitation assay (RIPA) lysis buffer containing protease inhibitor PDMS and then was boiled at 100 °C for 5 min. Proteins were separated in 8-12% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) (in accordance with the molecular weights) and transferred to a PVDF membrane at 200 mA for 2 h at RT. The samples were blocked with 5% Bull Serum Albumin (BSA) (Sigma-Aldrich, St. Louis, MO, USA) for 2 h before three times washes with TBST and incubation with the primary antibody overnight at 4 °C. Next day, the PVDF membrane (Millipore Billerica, MA) was incubated with secondary antibody for 2 h at RT after 3 times washes with TBST and proteins were visualized using super signal (Pierce Biotechnology, Thermo Scientific, Waltham, USA) enhanced chemiluminescence. The primary antibody not mentioned above was phosphorylated β-catenin (Thr 41/Ser 45, diluted 1:1000, Cell Signaling Technology, 9565). β-actin (diluted 1:1000, Santa Cruz, sc-47778) was the internal control for total proteins. LaminB1 (diluted 1:1000, Bioworld Technology, BS3547) was the internal control for nuclear proteins. 2.7. Quantitative Real-Time PCR (QPCR). The total ribonucleic acid (RNA) was extracted from cells by using Trizol and purified with a genomic DNA eliminator. After test of concentration by Nano, cDNA was synthesized by reverse transcription with reverse transcript kits. (Thermo scientific, Vilnius, Lithuania) and subsequently used in a QPCR System (Applied Biosystems, Foster City, CA) with SYBR Premix Ex Taq (Takara, Tokyo, Japan). Glyceraldehyde-3-phosphate dehydrogenase GAPDH were used as internal controls. The RT-PCR amplification process was as follows: Denaturation for 30s at 94℃，followed by 40 cycles, consisting 5 s at 94 °C and 34 s at 50 °C Standard curves were used to determine the effectiveness of primers. The primers sequence was as follows. Alp (Forward primer: CTTCATAAGCAGGCGGGGGA Reverse primer: GAGCCCAGATGGTGGGAAGA). Gapdh (Forward primer: AGGTTGTCTCCTGCGACTTCA; Reverse primer: CCAGGAAATGAGCTTGACAAA). Runx2 (Forward primer AACGATCTGAGATTTGTGGGC; Reverse primer CCTGCCTGGGATTTCTTGGTT) 2.8.

Co-immunoprecipitation

(Co-IP).

Cells

were

lysated

according

to

protocol

of

Pierce®

Co-immunoprecipitation Kit (Lot#SB240573B). The antibody of anti-prey protein was used at ratio of 1:25 to pull the bait protein out of the solution to the resin. The samples were eluted with elution buffer, collected and tested by western blotting. 2.9. Von Kossa Stain and Alizarin Red Stain. DPCs were plated in 24-well plates and treated with odontogenic induction medium (OM, 50 µg/ml ascorbic acid, 10 mM β-glycerophosphate, 0.1 µM dexamethasone) with 10% FBS to induce differentiation. Media was changed every 2 days. (Sigma-Aldrich, MO, USA) Then, the samples



were fixed with 4% paraformaldehyde for 30 min after 3 times washes with PBS and added 1% AgNO3 before UV radiation or 2% Alizarin Red S solution (pH 4.3, Sigma-Aldrich, MO, USA) for 15 min. After 3 times washes, the images were taken by stereo microscope (Olympus-SZX16-3111, Japan). 2.10. Statistical Analysis. All experiments were repeated at least 3 times and Statistical analysis was determined by one-way analysis of variance (ANOVA). The critical significance level was set to be p < 0.05

3. RESULTS 3.1. Topography Characterization of Substrates with Different Stiffness. PDMS has advantages of biocompatibility, inexpensiveness and non-toxic, especially adjustable stiffness or elasticity.22,23 We manipulated Young’s moduli of PDMS by mixing the base with the curing agent in different volume ratios (Sylgard184/oligomeric base: 1:5, 1:15, 1:30, and 1:45, from the stiffer to the softer). The moduli were shown to

be about 1.00 MPa, 0.45 MPa, 0.20 MPa and 0.05 MPa for 1:5, 1:15, 1:30 and 1:45 PDMS substrates respectively. (Figure 1C). For the surface topography, the petri-dish as we traditionally used was shown to have the rougher topography, while the ones coated with PDMS were obviously smoother by AFM (Figure 1A,B). Additionally, we scanned the surfaces of all groups by SEM, and further showed that all groups had no significant difference in surface topography (Figure 1D, the PDMS surface lane). Thus, in this study, we established a group of PDMS substrates which were shown to have different stiffness as we previously reported，but with the same surface topography.24 3.2. Cytoskeleton Changes of DPCs in Response to Substrates with Different Stiffness. We first seeded DPCs on these PDMS substrates and found that spreading area of cells was varied with variation of the stiffness (Figure 1D). The cells spread more widely on the stiff surfaces, however, showed small and round shapes on the soft ones. To further confirm the changes of cell spreading area, we next explored the cytoskeleton of DPCs by characterizing F-actin distribution by CSLM (Figure 2). On the PDMS substrates with the stiffer stiffness, the cells were shown to have the broader cytoskeleton distribution, compared with on the PDMS substrates with the softer stiffness, the cells were shown to be confined to a limited area without elongation of the F-actin protein (boxed area). 3.3. Potential Adhesion Capacity Changes of DPCs in Response to Different Stiffness. Owing to the same varying trend of cytoskeleton with stiffness, we chose the stiffest one (1:5 group) and the softest one (1:45 group) to further explore the potential mechanism for cell mechanosensing and machanotransducing. We first checked the adhesion capacity changes of DPCs. It was found that vinculin, as an ECM-cytoskeleton linker to regulate adhesion by binding to actin, stimulating actin polymerization and recruiting actin remodeling proteins,25,26 distributed more widely in the stiffer group than in the softer one (Figure 3A,B). It was further found that integrin αvβ3, as an important member of integrins in the process of vinculin-regulated interaction between cells and the matrix,27,28


Page 6 of 24

Page 7 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was shown to have the higher expression in the 1:5 group, especially in the region of nuclei and periphery cell membrane relative to the 1:45 group (Figure 3C). The higher protein expression in the 1:5 group was further confirmed by western blotting (Figure 3D,E). 3.4. Signaling Transduction from the Extracellular Matrix (ECM) to the Intracellular Matrix (ICM) by Fibronectin and Paxillin Interaction. Fibronectin, as the ligand for a dozen members of the integrin receptor family, could bind these receptors to achieve the transduction of environmental signals to the cell interior.29 We examined its distribution and expression (Figure 4A,B). It was found fibronectin had the broader distribution and expression in the stiffer group relative to that in the softer group. Interestingly, paxillin, an intracellular protein adaptor for engagement of integrins, also showed the broader distribution and the higher expression in the stiffer group relative to that in the softer group (Figure 4D,E). What’s more, fibronectin had an interaction with paxillin to achieve signal transduction from the ECM to the ICM which was detected by co-immunoprecipitation (co-IP) (Figure 4C). 3.5. Paxillin Interacted with Cytoplasmic β-catenin and β-catenin signaling achieved partial nuclear translocation. To confirm the cytoplasmic signal transduction, we further found that paxillin could directly interact with cytoplasmic β-catenin (Figure 5A). Moreover, β-catenin was shown to have the higher expression both in the cytoplasm and the nuclei in the stiffer group compared with that in the softer group (Figure 5B), which was confirmed by the followed protein expression quantification (Figure 5C). By CSLM, we further found the DPCs showed the higher quantity of cytoplasmic and nuclear β-catenin expression in the stiff group (Figure 5F). This nuclear translocation was further confirmed by linear fit analysis (Figure 5G). Additionally, it was verified that the total phosphorylated β-catenin protein expressed less in the stiffer substrate which meant the β-catenin signaling achieved partial nuclear translocation (Figure 5D,E). 3.6. Substrate Stiffness Modulated DPC Differentiation Through Osteogenic Transcriptional Factors. Finally, we explored the DPC differentiation in response to the substrate stiffness. The isolated cells were seeded on substrates with different stiffness, and were induced odontogenic differentiation by conditional medium for 7, 14, and 21 days. We examined the changes of osteogenic well known markers including Runx2 and Alp and found the mRNAs were up-regulated in the stiffer group. Through bioinformatics, we found that downstream protein of β-catenin signaling (LEF-1) had potential binding sites at the promoter of Runx2 and Alp genes (Figure 6 A,B). As a common histochemical technique to detect calcium deposits in mineralized tissue and culture, the positive Alizarin Red stain has been demonstrated to represent calcium phosphate and osteoblast culture mineralization .30,31 By the Alizarin Red stain, we next found that the mineralization increased as the substrate becoming stiffer (Figure 6C). By the Von Kossa stain, we further confirmed the increased mineralization on the stiffer substrates (Figure 6D). It was reported that the petri dish had the stiffness of 1 GPa, about three orders of magnitude greater than PDMS max stiffness (1MPa) in our article.32 Thus, the mineralization was more obvious in the petri-dish group than each of PDMS groups, which also verified our results above.



4. DISCUSSION The polydimethylsiloxane (PDMS) substrate was used to mimic physiological and pathological body tissue with different stiffness to study cell behavior for its wide elastic moduli, good biocompatibility, flexibility and optical clarity.33 In the present study, four various stiffness substrates of PDMS were fabricated (curing agent to oligomeric base, 1:5, 1:15, 1:30 and 1:45) with Young’s moduli from 50 kPa to 1 MPa. As the surfaces of PDMS substrates were smooth shown by AFM and SEM, compared with the rough surface of the peri-dish, we could exclude the influence of the surface topology on cell behavior (Figure 1). Then, we sat our eyes on the impact of gradient stiffness on the change of F-actin cytoskeleton by CLSM and cell morphology by SEM (Figure 2). It is well established that the physiological microenvironment including stiffness, geography, is crucial to cell proliferation and differentiation.1,2,5,8 Stiffness and geography play a key role in the dental mesenchymal cell behavior. Graziano A et al reported that dental pulp stem cells on the surfaces with concave geometry showed the superiority in the aspects of quicker differentiation, cellular activity and matrix formation, which verified the importance of the scaffold’s surface texture in the tissue engineering.34 It is generally accepted that dental pulp stem cells can modulate their phenotypes and cell function in response to substrate stiffness. For example, Tiejun Qu et al revealed that the scaffold used in subcutaneous implantation with the high-stiffness facilitated dental pulp stem cell differentiation to form the mineralized tissue, compared with the soft pulp-like tissue formation on the scaffold with the low-stiffness.18 Furthermore, Williams et al reported that dental pulp stromal cells only showed significant mineralization on very stiff (> 75kPa) substrates by testing Alkaline phosphatase activity, osteopontin production, and mineralization.17 Protein markers expression related to osteogenic/odontogenic differentiation were also reported significantly increased as the substrate stiffness increased, including ALP (alkaline phosphatase), OCN (osteocalcin), OPN (osteopontin), RUNX-2 (runt-related transcription factor-2), BMP-2 (bone morphogenetic protein-2), DSPP (dentin sialophosphoprotein) and DMP-1(dental matrix protein 1).19 Although there are a number of reports on change of dental mesenchymal cell differentiation capacity with different stiffness, it rarely known about the precise biophysical signal mechanisms. The interaction between the material interface and cells could create a complex and dynamic microenvironment where cells could sense the properties of the material such as stiffness and translate signal information into fate decisions.35 Cellular responses to biophysical cues are through highly localized junctions, known as the focal adhesion of cells attached to the substrates, which is the protein-rich region responsible to transmit and sense cues via integrins between the ECM and the ICM. Vinculin, as the talin-binding protein, promotes integrin-mediated cell adhesion.36 Integrins as transmembrane proteins have the function of connecting the cytoskeleton and modulating intracellular signals, with respect to the cell adhesion.27 Integrins are αβ heterodimeric and integrin β1 is the most ubiquitously expressed subunit, which links with a number of subunits resulting in diverse function.37 In recent


Page 8 of 24

Page 9 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


years, integrin β3 has entered our line of sight. As integrin β3 knockout mice were established successfully, McHugh in 2014 demonstrated their histological and radiographical evident osteosclerosis with age.28 Also, in keeping with the severity of their osteopetrosis, the osteoclasts of DAP/β3−/−mice effectively differentiated but appeared strikingly abnormal in vitro and in vivo.38 Integrins as transmembrane proteins have the function of connecting the cytoskeleton and modulating intracellular signals besides cell adhesion.27 Therefore, in our article we also demonstrated that the expressions of the ECM receptor-integrinαvβ3 and the mechano-sensing protein-vinculin were higher in the cells on the rigid substrate (Figure 3), which echoed with the spread and polygon morphology above and mechano-transduction below. The change of morphology and adhesiveness reminded us to explore the intrinsic nature. In this work, we investigated the binding between fibronectin and paxillin and their both higher expression in the stiff group, which suggested their role in partly transducing signals from the ECM to the ICM (Figure 4). Paxillin is known as a member of the focal adhesion associated scaffolding proteins and acts as the docking protein to recruit signal molecules to regulate downstream signals in the substrate controlled morphology and mechanism.39,40 Paxillin has been reported to interact with the signaling proteins through its multiple domains, of which LIM-1,2 and LIM-3,4 domains were demonstrated to play a key role in its interaction with β-catenin.41 Additionally, it has been identified that four-and-a-half-LIM-2 overexpression enhanced nuclear accumulation of β-catenin by using a yeast-two-hybrid screen.42 Our co-IP result also verified that paxillin bound β-catenin physically. Furthermore, as the western blotting result showed phosphorylated-β-catenin decreased and a great amount of β-catenin translocated into the nuclei in the stiff group, we speculated that the signal was delivered from the ICM to the nuclei partly through β-catenin. (Figure 5). Aiming at mineralization, β-catenin has been reported to be required for pluripotent mesenchymal cells to differentiate into osteoblasts during the early stages of fracture repair and for pre-osteoblasts to differentiate into osteoblasts in the later stages of repair.43 As to teeth, Kim showed that β-catenin strongly expressed in odontoblast-lineage cells and was required for root formation.44 It was also reported that a high percentage of intense nuclear positivity staining could be detected in the dental papilla in the early bell stage which suggested a pivotal role of β-catenin in the tooth tissue formation.45 The protein β-catenin has been verified to play an essential role in the above-mentioned tissue related to mineralization. We also predicted three sites on the promoter of Runx2 and Alp by bioinformatics analysis where the downstream protein of β-catenin (LEF-1) might bind to improve the mineralization. By β-catenin translocating into the nuclei, dental papilla cells took advantage of the stiff substrates to differentiate (Figure 6). We also demonstrated that signals in DPC odontogenic differentiation regulated by micro-environmental stiffness were transduced from the ECM to the ICM by fibronectin/paxillin/β-catenin by schematic diagram (Figure 7).



Page 10 of 24

5. CONCLUSION Dental papilla cells are promising seed cells for tooth tissue engineering. However, to better manipulate DPCs to carry out the precise function, we utilized biomaterials to change a kind of physical cues – substrate stiffness. In this study, we demonstrated that DPCs were most potent in odontogenic differentiation on the stiff substrate (1MPa).

Furthermore,

we

investigated

the

active

mechanosensing

and

mechanotransducing,

i.e.,

fibronectin/paxillin/β-catenin signaling, in DPCs triggered by stiffness based on PDMS substrates. These changes were due to not only the changes of the actin cytoskeleton and focal adhesion, but also the changes of gene transcription of DPCs. To sum up, we provided a probable mechanical pathway (fibronectin/paxillin/β-catenin) to promote the better manipulation of DPCs in tooth tissue engineering combined with the biomaterial.

ACKNOWLEDGEMENTS This study was supported by the funding of the Innovation Team of Sichuan Province (2015TD0011) to Ling Ye and funding of NSFC grants (81600840, 81771047) to Jing Xie. We acknowledged Dr. Chenghui Li in the Analytical & Testing Center of Sichuan University for her support in CLSM imaging.

COMPETING INTERESTS The authors declare that no competing interests exist.

REFRENCE (1) Vining, K. H.; Mooney, D. J. Mechanical Forces Direct Stem Cell Behavior in Development and Regeneration. Nat. Rev. Mol. Cell. Biol. 2017, 18, 728-742. (2) Kumar, A.; Placone, J. K.; Engler, A. J. Understanding the Extracellular Forces that Determine Cell Fate and Maintenance. Development. 2017, 144, 4261-4270. (3) Li, Z.; Gong, Y.; Sun, S.; Du, Y.; Lü, D.; Liu, X.; Long, M. Differential Regulation of Stiffness, Topography, and Dimension of Substrates in Rat Mesenchymal Stem Cells. Biomaterials. 2013, 34, 7616-7625. (4) Katayama, Y.; Battista, M.; Kao, W. M.; Hidalgo, A.; Peired, A. J.; Thomas, S. A.; Frenette, P. S. Signals from the Sympathetic Nervous System Regulate Hematopoietic Stem Cell Egress from Bone Marrow. Cell. 2006, 124, 407-421. (5) Shih, Y. R.; Tseng, K. F.; Lai, H. Y.; Lin, C. H.; Lee, O. K. Matrix Stiffness Regulation of Integrin-mediated Mechanotransduction during Osteogenic Differentiation of Human Mesenchymal Stem Cells. J. Bone. Miner. Res. 2011, 26, 730-738.


Page 11 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(6) Aguilar, A.; Pertuy, F.; Eckly, A.; Strassel, C.; Collin, D.; Gachet, C.; Lanza, F.; Léon, C. Importance of Environmental Stiffness for Megakaryocyte Differentiation and Proplatelet Formation. Blood. 2016, 128, 2022-2032. (7) Saha, K.; Keung, A. J.; Irwin, E. F.; Li, Y.; Little, L.; Schaffer, D. V.; Healy, K. E. Substrate Modulus Directs Neural Stem Cell Behavior. Biophys. J. 2008, 95, 4426-4438. (8) Engler, A. J.; Sen, S.; Sweeney, H. L.; Discher, D. E. Matrix Elasticity Directs Stem Cell Lineage Specification. Cell. 2006, 126, 677-689. (9) Chalisserry, E. P.; Nam, S. Y.; Park, S. H.; Anil, S. Therapeutic Potential of Dental Stem Cells. J. Tissue. Eng. 2017, 8, 2041731417702531. (10) Peng, Z.; Liu, L.; Wei, X.; Ling, J. Expression of Oct-4, SOX-2, and MYC in Dental Papilla Cells and Dental Follicle Cells during In-vivo Tooth Development and In-vitro Co-culture. Eur. J. Oral. Sci. 2014, 122, 251-258. (11) Volponi, A. A.; Pang, Y.; Sharpe, P. T. Stem Cell-based Biological Tooth Repair and Regeneration. Trends. Cell. Biol. 2010, 20, 715-722. (12) Shi, S.; Gronthos, S. Perivascular Niche of Postnatal Mesenchymal Stem Cells in Human Bone Marrow and Dental Pulp. J. Bone. Miner. Res. 2003, 18, 696-704. (13) Owen, M.; Friedenstein, A. J. Stromal Stem Cells: Marrow-derived Osteogenic Precursors. Ciba. Found. Symp. 1988, 136, 42-60. (14) Liao, X.; Feng, B.; Zhang, D.; Liu, P.; Zhou, X.; Li, R.; Ye, L. The Sirt6 Gene: Does it Play a Role in Tooth Development? PLoS. One. 2017, 12, e0174255. (15) Guilak, F.; Cohen, D. M.; Estes, B. T.; Gimble, J. M.; Liedtke, W.; Chen, C. S. Control of Stem Cell Fate by Physical Interactions with Extracellular Matrix. Cell. Stem. Cell. 2009, 5, 17-26. (16) Metallo, C. M.; Mohr, J. C.; Detzel, C. J.; de Pablo, J. J.; Van Wie, B. J.; Palecek, S. P.; Engineering the Stem Cell Microenvironment. Biotechnol. Prog. 2007, 23, 18-23. (17) Datko Williams, L.; Farley, A.; Cupelli, M.; Alapati, S.; Kennedy, M. S.; Dean, D. Effects of Substrate Stiffness on Dental Pulp Stromal Cells in Culture. J. Biomed. Mater. Res. A. 2018, 106, 1789-1797. (18) Qu, T.; Jing, J.; Ren, Y.; Ma, C.; Feng, J. Q.; Yu, Q.; Liu, X. Complete Pulpodentin Complex Regeneration by Modulating the Stiffness of Biomimetic Matrix. Acta. Biomater. 2015, 16, 60-70. (19)

Liu, N.; Zhou, M.; Zhang, Q.; Zhang, T.; Tian, T.; Ma, Q.; Xue, C.; Lin, S.; Cai, X. Stiffness Regulates the

Proliferation and Osteogenic/Odontogenic Differentiation of Human Dental Pulp Stem Cells via the WNT Signaling Pathway. Cell. Prolif. 2018, 51, e12435. (20) Ozcan, B.; Bayrak, E.; Erisken, C. Characterization of Human Dental Pulp Tissue Under Oscillatory Shear and Compression. J. Biomech. Eng. 2016, 138, 061006. (21) Zhang, Y. R.; Du, W.; Zhou, X. D.; Yu, H. Y. Review of Research on the Mechanical Properties of the Human Tooth. Int. J. Oral Sci. 2014, 6, 61–69.



(22) Yeh, Y. C.; Corbin, E. A.; Caliari, S. R.; Ouyang, L.; Vega, S. L.; Truitt, R.; Han, L.; Margulies, K. B.; Burdick, J. A. Mechanically Dynamic PDMS Substrates to Investigate Changing Cell Environments. Biomaterials. 2017, 145, 23-32. (23) Aymerich, M.; Gómez-Varela, A. I.; Álvarez, E.; Flores-Arias, M. T. Study of Different Sol-Gel Coatings to Enhance the Lifetime of PDMS Devices: Evaluation of Their Biocompatibility. Materials (Basel). 2016, 9, pii: E728. (24) Xie, J.; Zhang, Q.; Zhu, T.; Zhang, Y.; Liu, B.; Xu, J.; Zhao, H. Substrate Stiffness-regulated Matrix Metalloproteinase Output in Myocardial Cells and Cardiac Fibroblasts: Implications for Myocardial Fibrosis. Acta. Biomater. 2014, 10, 2463-2472. (25) Bays, J. L.; DeMali, K. A. Vinculin in Cell-cell and Cell-matrix Adhesions. Cell. Mol. Life. Sci. 2017, 74, 2999-3009. (26) Xu, W.; Baribault, H.; Adamson, E. D. Vinculin Knockout Results in Heart and Brain Defects during Embryonic Development. Development. 1998, 125, 327-337. (27) Hynes, R. O. Integrins: Bidirectional, Allosteric Signaling Machines. Cell. 2002, 110, 673-687. (28) McHugh, K. P.; Hodivala-Dilke, K.; Zheng, M. H.; Namba, N.; Lam, J.; Novack, D.; Feng, X.; Ross, F. P.; Hynes, R. O.; Teitelbaum, S. L. Mice Lacking Beta3 Integrins are Osteosclerotic because of Dysfunctional Osteoclasts. J. Clin. Invest. 2000, 105, 433-440. (29) Singh, P.; Schwarzbauer, J. E. Fibronectin and Stem Cell Differentiation-lessons from Chondrogenesis. J. Cell. Sci. 2012, 125, 3703-3712. (30) Coelho, M. J.; Trigo, Cabral. A.; Fernandes, M. H.; Human Bone Cell Cultures in Biocompatibility Testing. Part I: Osteoblastic Differentiation of Serially Passaged Human Bone Marrow Cells Cultured in α-MEM and in DMEM. Biomaterials. 2000, 21, 1087–1894. (31) Chang, Y. L.; Stanford, C. M.; Keller, J. C. Calcium and Phosphate Supplementation Promotes Bone Cell Mineralization: Implications for Hydroxyapatite (HA)-enhanced Bone Formation. J. Biomed. Mater. Res. 2000, 52, 270–278. (32) Kolahi, K. S.; Donjacour, A.; Liu, X.; Lin, W.; Simbulan, R. K.; Bloise, E.; Maltepe, E.; Rinaudo, P. Effect of Substrate Stiffness on Early Mouse Embryo Development. PLoS. One. 2012, 7, e41717. (33) Chou, S. Y.; Cheng, C. M.; LeDuc, P. R. Composite Polymer Systems with Control of Local Substrate Elasticity and their Effect on Cytoskeletal and Morphological Characteristics of Adherent Cells. Biomaterials. 2009, 30, 3136-3142. (34) Graziano, A.; d'Aquino, R.; Cusella-De Angelis, M. G.; De Francesco, F.; Giordano, A.; Laino. G.; Piattelli, A.; Traini, T.; De Rosa, A.; Papaccio, G. Scaffold's Surface Geometry Significantly Affects Human Stem Cell Bone Tissue Engineering. J. Cell. Physiol. 2008, 214, 166-172. (35) Murphy, W. L. McDevitt, T. C.; Engler, A. J. Materials as Stem Cell Regulators. Nat. Mater. 2014, 13,


Page 12 of 24

Page 13 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


547-557. (36) Ataollahi, F.; Pramanik, S.; Moradi, A.; Dalilottojari, A.; Pingguan-Murphy, B.; Wan Abas, W. A.1; Abu Osman, N. A. Endothelial Cell Responses in Terms of Adhesion, Proliferation, and Morphology to Stiffness of Polydimethylsiloxane Elastomer Substrates. J. Biomed. Mater. Res. A. 2015, 103, 2203-2213. (37) Nanda, S.Y.; Hoang, T.; Patel, P.; Zhang, H. Vinculin Regulates Assembly of Talin: β3 Integrin Complexes. J. Cell. Biochem. 2014, 115, 1206-1216. (38) Zou, W.; Teitelbaum, S. L. Absence of Dap12 and the αvβ3 Integrin Causes Severe Osteopetrosis. J. Cell. Biol. 2015, 208, 125-136. (39) Chang, T. Y.; Chen, C.; Lee, M.; Chang, Y. C.; Lu, C. H.; Lu, S. T.; Wang, D. Y.; Wang, A.; Guo, C. L.; Cheng, P. L. Paxillin Facilitates Timely Neurite Initiation on Soft-substrate Environments by Interacting with the Endocytic Machinery. Elife. 2017, 6, pii: e31101. (40) Schaller, M. D. Paxillin: A Focal Adhesion-associated Adaptor Protein. Oncogene. 2001, 20, 6459-6472. (41) Dubrovskyi, O.; Tian, X.; Poroyko, V.; Yakubov, B.; Birukova, A. A.; Birukov, K. G. Identification of Paxillin Domains Interacting with β-catenin. FEBS. Lett. 2012, 586, 2294-2299. (42) Renger, A.; Zafiriou, M. P.; Noack, C.; Pavlova, E.; Becker, A.; Sharkova, K.; Bergmann, M. W.; El-Armouche, A.; Zimmermann, W. H.; Zelarayán, L. C. The Four and a Half LIM-domain 2 Controls Early Cardiac Cell Commitment and Expansion via Regulating β-catenin-dependent Transcription. Stem. Cells. 2013, 31, 928-940. (43) Duan, P.; Bonewald, L. F. The Role of the Wnt/β-catenin Signaling Pathway in Formation and Maintenance of Bone and Teeth. Int. J. Biochem. Cell. Biol. 2016, 77, 23-29. (44) Kim, T. H.; Bae, C. H.; Lee, J. C.; Ko, So.; Yang, X.; Jiang, R.; Cho, E. S. β-catenin is Required in Odontoblasts for Tooth Root Formation. J. Dent. Res. 2013, 92, 215-221. (45) Lo Muzio, L.; Lo Russo, L.; Pannone, G.; Santoro, A.; Leonardi, R.; Serpico, R.; Gasparoni, A.; Bufo, P. Expression of Beta-catenin in Human Tooth Germ. Anal. Quant. Cytol. Histol. 2009, 31, 324-331.



Figure legends Figure1. Cell morphological changes of dental papilla cells on substrates with different PDMS stiffness. (A) AFM images showing the topography of the surfaces of the PDMS substrates with different stiffness in an area of 10µm × 10µm. Each topographic image of PDMS film was collected in three independent experiments (n = 3). (B)

Surface roughness characterization by Ra (n = 6). *Significant difference was relative with petri dish control (p < 0.05). (C) Young’s moduli of PDMS substrates. The data were the mean of six independent experiments (n =6), *p < 0.05. (D) SEM images further showing the surface topography of PDMS substrates (the upper) and cell morphology of DPCs (the lower) with the changes of substrate stiffness. The cell images were collected in three independent experiments (n = 3). Scale bar is 75µm. Figure2. Cell cytoskeleton changes of DPCs on substrates with different stiffness. CSLM showing the cytoskeleton changes by characterizing F-actin expression. The cells were stained after being seeded for 24 h. Scale bar is 50 µm. The cell images were collected in three independent experiments (n = 3). Figure3. The expression changes of vinculin and integrinαvβ3 in response to substrate stiffness. (A) The expression changes of vinculin on the stiff (1:5 group) and soft (1:45 group) substrates by CSLM. The red stain showing the expression of vinculin, while the green (F-actin) and blue (Dapi) presenting the cell skeleton on substrates with different stiffness. The cell images were based on three independent experiments (n = 3). (B) Quantification was performed by fluorescence OD method. The statistics was based on three independent experiments (n = 3). *Significant difference was relative with the stiff group (p < 0.05). (C) The expression changes of integrinαvβ3 on the stiff (1:5 group) and soft (1:45 group) substrates by CSLM (red). The cell images were based on three independent experiments (n = 3). (D) Western blotting showing the reduced expression of integrin αvβ3 on the soft substrate relative to that on the stiff substrate. β-actin was used as the internal reference. (E) Quantification was performed to indicate the different expression of integrinαvβ3 by western blotting. The statistics was based on three independent experiments (n = 3). *Significant difference was relative to the stiff group (p < 0.05). Figure 4. The changes of fibronectin in response to substrate stiffness and the changes of paxillin in the cytoplasm adjacent to the membrane. (A) Fibronectin changes of DPCs seeded on the rigid and soft substrates by CSLM (red). The cell images were based on three independent experiments (n = 3). (B) Western blotting detected the different expression changes of fibronectin in the 1:5 and 1:45 group respectively. The statistics was based on three independent experiments (n = 3). *Significant difference presented between the two groups (p < 0.05). (C) Co-IP showing the interaction between fibronectin and paxillin. β-actin was used as an internal reference. Input and IgG were as inner controls. The experiments were repeated at least three times (n = 3). (D) Paxillin changes in DPCs seeded on the rigid group and soft group by CLSM (red). (E) Western blotting detected different expression of paxillin in two groups (n = 3). *Significant difference presented between the two groups (p < 0.05). Figure 5. Paxillin interacted with cytoplasmic β-catenin and β-catenin signaling transduction in DPCs in response


Page 14 of 24

Page 15 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


to substrates with different stiffness. (A) Co-IP showing the interaction between paxillin and β-catenin. Paxillin was used as the bait protein to prey β-catenin. β-actin was used as the internal reference. Input and IgG were as inner controls. (B,C) Western blotting detected β-catenin expression in the 1:5 and 1:45 groups in the nuclei (left) and cytoplasm (right), respectively. Lamin B1 was used as inner controls of nuclear proteins. *Significant difference was presented between the two groups (p < 0.05). (D,E) Western blotting detected total phosphorylated β-catenin expression in the 1:5 and 1:45 groups (n = 3), respectively. *Significant difference presented between the two groups (p < 0.05). (F) β-catenin expression was detected in DPCs seeded on the stiff and soft substrates by CSLM (red). (G) Cellular β-catenin expression in response to the soft and stiff substrates, respectively. Red line denotes β-catenin expression distribution in the cytoplasm and nuclei. Green line denotes F-actin distribution. Blue line denotes nuclear stain (DAPI). Data presented as means ± SD, *p < 0.05, **p < 0.01, ***p < 0.001. Figure 6. Different mineralization capacities of DPCs in response to substrates with different stiffness. (A) The bioinformatic analysis showing the binding sites of the downstream protein (LEF-1) of β-catenin in the nuclei to the osteogenic transcriptional factor, Runx2, in the left lane. qPCR showing the mRNA changes of Runx2 in DPCs in response to substrate stiffness (right lane, n = 3). *p < 0.05, **p < 0.01. (B) The bioinformatic analysis showing the binding sites of the downstream protein (LEF-1) of β-catenin in the nuclei to the osteogenic marker, Alp, in the left lane. qPCR showing the mRNA changes of Runx2 in DPCs in response to substrate stiffness (right lane, n = 3). *p < 0.05, **p < 0.01. (C) Alizarin Red stain showing different mineralization capacities of DPCs cultured on substrates with different stiffness for 7 days. (D) Von Kossa stain further showing different mineralization capacities of DPCs cultured on different PDMS substrates for 7, 14 and 21days, respectively (from upper to lower lane). The experiments were repeated at least three times (n = 3). Figure 7. The schematic diagram elucidating the path which substrate stiffness modulates differentiation of DPCs. The grey parts are involved in the cytoskeleton rearrangements as reported. In our study, the purple arrows indicated the substrate stiffness-modulated odontogenic differentiation through fibronectin/paxillin/β-catenin pathway.




Page 16 of 24

Page 17 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure1. Cell morphological changes of dental papilla cells on substrates with different PDMS stiffness. (A) AFM images showing the topography of the surfaces of the PDMS substrates with different stiffness in an area of 10µm × 10µm. Each topographic image of PDMS film was collected in three independent experiments (n = 3). (B) Surface roughness characterization by Ra (n = 6), *Significant difference was relative with petri dish control (p < 0.05). (C) Young’s moduli of PDMS substrates. The data were the mean of six independent experiments (n =6), *p < 0.05. (D) SEM images further showing the surface topography of PDMS substrates (the upper) and cell morphology of DPCs (the lower) with the changes of substrate stiffness. The cell images were collected in three independent experiments (n = 3). Scale bar is 75µm.



Figure2. Cell cytoskeleton changes of DPCs on substrates with different stiffness. CSLM showing the cytoskeleton changes by characterizing F-actin expression. The cells were stained after being seeded for 24 h. Scale bar is 50 µm. The cell images were collected in three independent experiments (n = 3).


Page 18 of 24

Page 19 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure3. The expression changes of vinculin and integrinαvβ3 in response to substrate stiffness. (A) The expression changes of vinculin on the stiff (1:5 group) and soft (1:45 group) substrates by CSLM. The red stain showing the expression of vinculin, while the green (F-actin) and blue (Dapi) presenting the cell skeleton on substrates with different stiffness. The cell images were based on three independent experiments (n = 3). (B) Quantification was performed by fluorescence OD method. The statistics was based on three independent experiments (n = 3). *Significant difference was relative with the stiff group (p < 0.05). (C) The expression changes of integrinαvβ3 on the stiff (1:5 group) and soft (1:45 group) substrates by CSLM (red). The cell images were based on three independent experiments (n = 3). (D) Western blotting showing the reduced expression of integrin αvβ3 on the soft substrate relative to that on the stiff substrate. β-actin was used as the internal reference. (E) Quantification was performed to indicate the different expression of integrinαvβ3 by western blotting. The statistics was based on three independent experiments (n = 3). *Significant difference was relative to the stiff group (p < 0.05).



Figure 4. The changes of fibronectin in response to substrate stiffness and the changes of paxillin in the cytoplasm adjacent to the membrane. (A) Fibronectin changes of DPCs seeded on the rigid and soft substrates by CSLM (red). The cell images were based on three independent experiments (n = 3). (B) Western blotting detected the different expression changes of fibronectin in the 1:5 and 1:45 group respectively. The statistics was based on three independent experiments (n = 3). *Significant difference presented between the two groups (p < 0.05). (C) Co-IP showing the interaction between fibronectin and paxillin. β-actin was used as an internal reference. Input and IgG were as inner controls. The experiments were repeated at least three times (n = 3). (D) Paxillin changes in DPCs seeded on the rigid group and soft group by CLSM (red). (E) Western blotting detected different expression of paxillin in two groups (n = 3). *Significant difference presented between the two groups (p < 0.05).


Page 20 of 24

Page 21 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. Paxillin interacted with cytoplasmic β-catenin and β-catenin signaling transduction in DPCs in response to substrates with different stiffness. (A) Co-IP showing the interaction between paxillin and βcatenin. Paxillin was used as the bait protein to prey β-catenin. β-actin was used as the internal reference. Input and IgG were as inner controls. (B,C) Western blotting detected β-catenin expression in the 1:5 and 1:45 groups in the nuclei (left) and cytoplasm (right), respectively. Lamin B1 was used as inner controls of nuclear proteins. *Significant difference was presented between the two groups (p < 0.05). (D,E) Western blotting detected total phosphorylated β-catenin expression in the 1:5 and 1:45 groups (n = 3), respectively. *Significant difference presented between the two groups (p < 0.05). (F) β-catenin expression was detected in DPCs seeded on the stiff and soft substrates by CSLM (red). (G) Cellular β-catenin expression in response to the soft and stiff substrates, respectively. Red line denotes β-catenin expression distribution in the cytoplasm and nuclei. Green line denotes F-actin distribution. Blue line denotes nuclear stain (DAPI). Data presented as means ± SD, *p < 0.05, **p < 0.01, ***p < 0.001.



Figure 6. Different mineralization capacities of DPCs in response to substrates with different stiffness. (A) The bioinformatic analysis showing the binding sites of the downstream protein (LEF-1) of β-catenin in the nuclei to the osteogenic transcriptional factor, Runx2, in the left lane. qPCR showing the mRNA changes of Runx2 in DPCs in response to substrate stiffness (right lane, n = 3). *p < 0.05, **p < 0.01. (B) The bioinformatic analysis showing the binding sites of the downstream protein (LEF-1) of β-catenin in the nuclei to the osteogenic marker, Alp, in the left lane. qPCR showing the mRNA changes of Runx2 in DPCs in response to substrate stiffness (right lane, n = 3). *p < 0.05, **p < 0.01. (C) Alizarin Red stain showing different mineralization capacities of DPCs cultured on substrates with different stiffness for 7 days. (D) Von Kossa stain further showing different mineralization capacities of DPCs cultured on different PDMS substrates for 7, 14 and 21days, respectively (from upper to lower lane). The experiments were repeated at least three times (n = 3).


Page 22 of 24

Page 23 of 24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7. The schematic diagram elucidating the path which substrate stiffness modulates differentiation of DPCs. The grey parts are involved in the cytoskeleton rearrangements as reported. In our study, the purple arrows indicated the substrate stiffness-modulated odontogenic differentiation through fibronectin/paxillin/βcatenin pathway.



A table of contents (TOC) graphic 210x92mm (127 x 127 DPI)


Page 24 of 24

Micro-environmental stiffness regulates dental papilla cell differentiation

Recommend Documents