Article pubs.acs.org/est
Microbial Community in the Soil Determines the Forest Recovery Post-Exposure to Gamma Irradiation Vishal Shah,†,* Shreya Shah,† Herman Mackey,‡ Murty Kambhampati,‡ Daniel Collins,† Scot E. Dowd,∥ Robert Colichio,§ Kevin T. McDonnell,⊥ and Timothy Green§ †
Department of Biology, Dowling College, 150 Idle Hour Boulevard, Oakdale, New York 11769, United States Department of Natural Sciences, Southern University at New Orleans, 6400 Press Drive, New Orleans, Louisiana 70126, United States § Brookhaven National Laboratory, P.O. Box 5000, Upton, New York 11973, United States ∥ Molecular Research LP, 503 Clovis Road, Shallowater, Texas 79363, United States ⊥ Department of Mathematics and Computer Science, Dowling College, 150 Idle Hour Boulevard, Oakdale, New York 11769, United States ‡
S Supporting Information *
ABSTRACT: Exposure of an ecosystem to ionizing radiation remains a possibility either due to accidents involving nuclear fuel rods or contamination with high-level radioactive wastes. While the short and long-term effect of ionizing radiation on higher eukaryotes has been well documented, we do not have an understanding on the recovery of the microbial community post radiation. Here we report that at a site within Brookhaven National Laboratory that was radiated from 1961 to 1978 with γ rays (Gamma Forest), the ecosystem has not yet fully recovered from the effects of radiation. The current vegetation type in the Gamma Forest varies as one goes away from the source of ionizing radiation, with the region closest to the source having no vegetation. The microbial tag-encoded FLX amplicon pyrosequencing analysis of the soil from different regions suggests that the current microbial community structure is identical in all the Zones. When soil samples from each vegetation zone of the Gamma Forest were radiated with 1.8 kGy γ radiation and survival microbial community analyzed, clear difference in the microbial communities were observed. It is evident based on the experimental data that the colonization of soil with Nitrosomonadaceae is critical for the higher plants in pine barrens to reestablish and grow after the area had been exposed to ionizing radiation. igh concentrations of radioactive isotopes can find their way into the environment mainly during the storage of high-level radioactive wastes,1 including spent nuclear reactor fuels generated by nuclear power plants, wastes generated during reprocessing of these fuels, and wastes generated during development of nuclear weapons.2 High-level radioactive wastes are stored in spent fuel pools or in dry cask storage facilities, pending eventual disposition in national repository sites. During this disposal period, contamination of the natural ecosystem by accidental slow release of high-level radioactive isotopes always remains a possibility.3,4 Occasional release of radioactive isotopes into the environment also happens during accidents involving nuclear fuel rods such as the Chernobyl disaster in 1986 and the tsunami generated damage to the nuclear power plants in Okuma, Japan in 2011. When radioactive isotopes are released into the environment, the emitted ionizing radiation causes irreparable damage to cells and the effects of ionizing radiation on microorganisms in the environment are of relevance to the current study. Several
H
© 2013 American Chemical Society
studies have shown that ionizing radiation immediately changes the microbial population in soil, sediment, and water systems.5−9 The question of whether microbial populations exposed to ionizing radiation recover in natural environments remains unanswered. In the current study, we examine the recovery of microbial diversity in a forest exposed to ionizing radiation. The Gamma Forest was a radiation facility established in 1961 within the pine barrens Forest at Brookhaven National Laboratory, NY, to provide opportunity for systematic study of the effects of ionizing radiation on a terrestrial ecosystem and its components.10 The source of radiation used during the Gamma Forest experiment was a 137 cesium (351 500 GBq) gamma emitter,10 raised remotely via a mast located in the center of the field with the field exposed Received: Revised: Accepted: Published: 11396
February 28, 2013 August 16, 2013 August 22, 2013 September 25, 2013 dx.doi.org/10.1021/es400923k | Environ. Sci. Technol. 2013, 47, 11396−11402
Environmental Science & Technology
Article
Figure 1. The vegetation in the Gamma Forest in 1978 (a) and 2010 (b). The sampling location for the microbial study are shown in Figure 1b. The vegetation type in the forest is shown in differential color format and the key is provided in the legend next to Figure 1b.
20 h/day for 18 years from 1961 until 1978.11 Rates of exposure around the source varied from tens of Gy per day within a few meters of the source to about 0.01739 Gyper day at 130 m distance.10 It has been more than 30 years since exposure of the Gamma Forest to ionizing radiation was terminated. During this period, the Gamma Forest has been restricted to very limited access, thereby preventing any influence of human activity on its recovery. The present study was undertaken to determine if even after 30 years since the termination of exposure, the ecosystem within the Gamma Forest has recovered from the effect of ionizing radiation.
maintenance of stable humidity conditions and permitting aeration but preventing interference from airborne microorganisms. Sterile distilled water was added periodically to maintain moisture content in the soil between 30% and 50%. The microcosms were incubated at room temperature (25 °C ± 2 °C) under stationary conditions for 365 days. EMA Treatment and DNA Isolation. The preradiated and postradiated soil samples were treated with DNA cross-linker ethidium monoazide bromide (EMA) according to Nocker and Camper12 within 24 h. EMA treatment allows us to preferentially analyze viable bacteria and reduce the probability of polymerase chain reaction (PCR) amplification of DNA from dead or moribund cells. DNA was isolated using PowerMax DNA Isolation Kit (MO BIO Laboratories, Inc., Carlsbad, CA). TEFAP. Data on the microbial communities present in the soil was obtained by carrying out pyrosequencing analysis on the DNA. The microbial tag-encoded FLX amplicon pyrosequencing (TEFAP) was performed using primers Gray28F (GAGTTTGATCNTGGCTCAG) and Gray519r (GTNTTACNGCGGCKGCTG) for bacterial populations and ITS1 (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) were used as primers for fungal populations. Initial generation of the sequencing library utilized a one-step PCR with a total of 30 cycles, a mixture of Hot Start and HotStart high fidelity taq polymerases, and amplicons originating and extending from the forward primers.13,14 Tag-encoded FLX amplicon pyrosequencing analyses utilized Roche 454 FLX instrument with Titanium reagents. To determine the identity of microorganisms and evaluate the diversity sequences were denoised, all failed sequence reads, low quality sequence ends and tags and primers were removed along with the sequences collections depleted of reads 6bp, and any nonbacterial/fungal ribosome sequences and chimeras.15,16 Sequences were assembled into OTU clusters and queried using BLASTn algorithm17 against a comprehensive database of high quality rDNA sequences derived from NCBI (01−01−11) and evaluated as described
■
MATERIALS AND METHODS Sample Collection. After the removal of surface litter, soil samples were collected from the different Zones of Gamma Forest between the depth of 0 and 20 cm. While no permits were required to obtain the samples, to keep the impact of sampling on this secured area to minimum, one sample was collected from the center of each Zone. While collecting samples, care was taken not to disturb the surrounding areas, and afterward, each sample collection hole was filled back with the soil. All distinguishable debris and pebbles were removed using sterile forceps, and the soil was mixed thoroughly prior to experimentation. The chemical analysis of the soil samples were performed by Long Island Analytical Laboratories, Holbrook, NY. γ Radiation Exposure. 50 g of homogenously mixed soil sample from each zone were collected in a 50 mL polypropylene tube and irradiated with γ radiation at the Brookhaven National Laboratory ionizing irradiation facility within the Department of Biology. A 137Cesium isotope with current source activity of 58 312 GBq (1576 Ci) was the source of γ radiation, and the soil samples were placed 3 in. from the source. The dose rate was 2.734 Gy/min. Microcosm Incubation. 100 g of soil upon irradiation to 4.0 kGy was immediately packed in 500 mL plastic jars (Millipore Stericup filter systems, Millipore, Billerica, MA). The jars were closed with the supplied caps to allow the 11397
dx.doi.org/10.1021/es400923k | Environ. Sci. Technol. 2013, 47, 11396−11402
Environmental Science & Technology
Article
Table 1. Percentage of 16s rDNA sequences of the Bacterial Families Present in the Soil Before (C) and after Radiation (R) to 1.8 kGy or 4.0 kGy (RR) Gamma Radiationa Zone 1
Zone 2a
Zone 2b
Zone 3
Zone 4
Zone 5
Zone 6
family name
C
R
RR
RR365
C
R
C
R
C
R
C
R
C
R
C
R
Acetobacteraceae Acidobacteriaceae Alcaligenaceae Alicyclobacillaceae Anaerolineaceae Bacillaceae (family) Beijerinckiaceae Bradyrhizobiaceae Burkholderiaceae Caldilineaceae Caulobacteraceae Chlorof lexaceae Desulf urellaceae Desulfobacteraceae Eubacteriaceae Gemmatimonadaceae Geobacteraceae Geodermatophilaceae Holophagaceae Hydrogenophilaceae Hyphomicrobiaceae Ktedonobacteraceae Ktedonobacteria (family) Methylobacteriaceae Micrococcaceae Nitrosomonadaceae Nitrospiraceae Patulibacteraceae Planctomycetaceae Planococcaceae Pseudonocardiaceae Rhizobiaceae Rhodobiaceae Rhodocyclaceae Rhodospirillaceae Sinobacteraceae Solibacteraceae Solirubrobacteraceae Thermosporotrichaceae Xanthomonadaceae
8 24 0 0 0 0 1 6 5 1 2 0 0 0 0 0 0 0 13 0 3 0 0 0 0 8 0 0 0 0 0 5 0 0 1 0 3 0 1 2
1 11 0 0 0 0 0 2 2 25 1 0 0 0 0 0 0 0 8 0 1 3 4 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 30 1
2 5 2 0 4 0 0 0 0 5 0 1 1 0 2 0 7 1 0 0 1 0 0 1 1 0 3 2 1 50 1 1 0 1 1 0 0 1 0 0
1 16 7 0 0 0 0 27 12 0 0 0 0 0 0 1 0 0 0 0 2 7 0 0 0 1 0 0 1 0 0 13 0 0 1 0 0 0 7 0
7 20 0 0 0 0 0 5 12 0 3 0 0 0 0 0 0 0 12 0 1 0 0 0 0 9 0 0 0 0 0 5 0 0 3 0 4 0 0 3
1 7 0 0 0 0 3 1 0 19 0 0 0 0 0 1 0 0 4 0 0 5 3 19 0 2 0 0 0 0 0 1 0 0 0 0 0 0 27 0
7 17 0 0 0 0 1 7 8 2 1 0 0 0 0 1 0 0 14 0 2 0 0 0 0 9 0 0 0 0 0 6 0 0 2 0 1 0 2 4
2 5 0 0 0 0 0 1 0 23 0 0 0 0 0 0 0 0 6 16 0 12 3 0 0 3 0 0 0 0 0 1 0 0 0 0 0 0 17 1
6 20 0 0 0 0 0 4 4 0 3 0 0 0 0 0 0 0 15 0 2 0 0 0 0 16 0 0 0 0 0 8 0 0 1 0 2 0 0 3
4 8 0 0 0 0 1 3 0 11 0 0 0 0 0 0 0 0 11 0 1 6 4 10 0 12 0 0 0 0 0 2 0 0 0 0 0 0 13 1
5 23 0 0 0 0 1 10 5 0 1 0 0 0 0 0 0 0 10 0 1 0 0 0 0 11 0 0 0 0 0 8 0 0 2 0 2 0 0 5
0 2 0 0 0 1 0 1 0 25 0 0 0 0 0 4 0 0 4 0 1 8 2 18 0 3 0 0 0 0 0 1 0 0 0 0 0 0 22 0
2 23 0 0 0 0 2 4 26 0 0 0 0 2 0 0 0 0 12 0 1 0 0 0 0 10 0 0 0 0 0 4 0 0 0 0 2 0 0 5
1 6 0 10 0 3 1 2 0 23 1 0 0 0 0 0 0 0 6 0 1 1 2 1 0 14 0 0 0 0 0 4 0 0 0 0 0 0 14 1
3 33 0 0 0 0 1 2 5 0 2 0 0 0 0 0 0 0 10 0 2 0 0 0 0 12 0 0 0 0 0 6 0 0 2 0 3 0 0 3
1 5 0 5 0 0 4 1 0 23 0 0 0 0 0 1 0 0 2 0 1 0 0 26 0 15 0 0 0 0 0 2 0 0 0 0 0 0 2 1
a
Column labeled RR 365 shows the percentage of 16s rDNA sequences of the bacterial families present in the soil exposed to 4.0 kGy and incubated for 365 days under ambient conditions in a microcosm. The soil sampling locations are shown in Figure 1b. Because of the rounding of numbers, the total may not add up to 100%.
previously.15,16,18,19 Unifrac analysis20 to generate weighted distance matrices were evaluated using principal component analysis and rarefaction analysis was performed using Mothur21 as described previously.15,16,18,19 Two tailed t test was utilized to evaluate the significance of rarefaction data. Dual hierarchal dendrograms based upon Ward’s minimum variance and Manhattan distances were generated using NCSS 2007. Vegetation Classification. The vegetation map shown in Figure 1b was obtained by surveying the entire Gamma Forest. The vegetation present was classified following Gleason and Cronquist.22 Statistical Analysis. To find the correlation between the presence of Nitrosomonadaceae in the soil after exposure to ionizing radiation and the presence of higher vegetation,
correlation analysis was performed using Statistica software v 8.0. The reduction in the % of Nitrosomonadaceae upon radiation was correlated to the presence or absence of high trees. Code of 0 and 1 was assigned for a zone depending on whether high trees were absent or present. Significant correlation was considered for p < 0.05.
■
RESULTS AND DISCUSSION The vegetation survey of the Gamma Forest in summer of 2010 revealed that the forest can be distinctly divided into six different circular zones (Figure 1b). Even after 30 years, there is still no vegetation growing in the area where the 137cesium source was located (Zone 1). Furthermore, Zone 2 could be divided into two areas. An area in the northeast quadrant, Zone 11398
dx.doi.org/10.1021/es400923k | Environ. Sci. Technol. 2013, 47, 11396−11402
Environmental Science & Technology
Article
Table 2. Percentage of 16s rDNA Sequences of the Fungi Families Present in the Soil Before (C) and after Radiation (R) to 1.8 kGy or 4.0 kGy (RR) Gamma Radiationa Zone 1
a
Zone 2a
Zone 2b
Zone 3
Zone 4
Zone 5
Zone 6
family name
C
R
RR
C
R
C
R
C
R
C
R
C
R
C
R
Agaricales (family) Ascomycota (family) Atheliaceae Cantharellales (family) Cephalothecaceae Chaetosphaeriaceae Chaetothyriales (family) Clavicipitaceae Cordycipitaceae Corticiaceae Cortinariaceae Davidiellaceae Dermateaceae Dothideomycetes (family) Eremomycetaceae Filobasidiales (family) Ganodermataceae Helotiaceae Helotiales (family) Herpotrichiellaceae Hygrophoraceae Hypocreaceae Hypocreales (family) Inocybaceae Leotiomycetes (family) Lycoperdaceae Lyophyllaceae Magnaporthaceae Malasseziaceae Mortierellaceae Myxotrichaceae Pleosporales (family) Pluteaceae Pyronemataceae Sarcosomataceae Sporidiobolales (family) Thamnidiaceae Tremellales (family) Trichocomaceae Tricholomataceae Umbelopsidaceae
0 2 2 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 27 13 0 35 0 0 6 0 0 0 0 0 1 0 0 0 0 0 1 4 5 0 0
0 0 0 0 0 0 0 0 0 0 0 0 12 0 0 0 3 0 0 0 0 0 0 0 10 0 0 0 6 0 0 0 0 0 0 0 0 0 69 0 0
0 1 0 0 0 0 0 0 0 0 0 6 5 68 0 0 0 1 0 2 2 0 0 0 0 0 2 0 0 1 0 4 0 0 0 0 0 1 1 0 3
0 1 1 0 0 1 4 0 0 4 0 0 5 0 0 0 0 1 68 1 0 0 1 0 1 0 0 0 0 0 1 0 0 0 0 0 4 1 5 0 0
0 3 7 0 0 0 0 0 0 5 0 0 8 20 0 0 0 0 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 29 0 5 3 0
0 1 0 13 0 0 0 0 0 0 0 0 1 0 0 0 0 0 31 0 0 1 48 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0
2 0 0 0 0 0 12 0 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 12 0 0 0 35 0 18 4 0
0 1 0 0 0 0 0 1 0 2 0 0 3 1 0 5 0 0 17 3 0 17 0 2 7 5 0 0 0 0 6 0 0 8 2 9 2 3 5 0 0
0 0 0 0 0 0 0 0 0 5 0 0 0 10 0 4 0 0 6 0 0 0 1 2 14 1 0 0 0 0 13 0 0 22 3 1 12 1 3 0 0
0 17 0 0 0 2 0 14 0 0 0 0 0 0 2 0 0 0 24 0 0 2 2 0 0 18 0 0 0 0 1 0 0 0 1 0 8 0 7 0 0
0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 6 0 0 0 88 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 1 0 0
0 1 0 0 3 0 0 0 0 0 4 0 4 0 0 0 0 0 33 0 0 0 12 0 2 0 0 0 0 0 3 0 0 0 0 0 34 0 1 0 0
0 0 0 0 10 0 0 0 0 0 0 0 6 0 0 0 0 0 30 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 55 0 0 0 0
0 4 0 0 0 1 0 2 0 1 0 0 2 0 0 0 0 12 5 1 0 2 1 0 5 2 0 0 0 0 0 0 0 0 0 0 11 21 27 0 0
0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 0 0 0 0 0 0 4 0 1 1 0 0 0 0 0 0 0 86 0 0 0 0
The soil sampling locations are shown in Figure 1b. Because of the rounding of numbers, the total may not add up to 100%.
2a, which has growth of blueberries (Vaccinium sp.) and black huckleberries (Gaylussacia baccata (Wangenh.) Koch). While the remaining area in Zone 2 is an empty patch of soil with no vegetation (Zone 2b). Zone 3 is primarily comprised of 68 pitch pine trees (Pinus rigida P. Mill.) scattered uniformly between 5 and 20 m radius. Pine needles cover the floor of the forest uniformly out to 18 m from the source of radiation, after which there is an immediate transition to a total absence of the needles. Moss and lichens appear after a distance of 20 m from the source of radiation. Magnolia virginiana L. (sweet bay) is scattered at the interface of Zones 3 and 4. Pennsylvania sedge (Carex pensylvanica Lam.) and scattered young pitch pine trees (10 years old, based on ring formation) are found in Zone 4. Blueberry shrubs are also randomly scatted within Zone 4. Zone 6 has the composition of a normal pine barrens forest
(Pennsylvania sedge, blueberry, huckleberry, and scarlet oak trees (Quercus coccinea Münchh.)). Between Zones 4 and 6 is a small zone (Zone 5) consisting primarily of Pennsylvania sedge, blueberry, and huckleberry. When one observes the vegetation that survived the ionizing radiation in 1978, five distinct zones were observed (Figure 1a). No vegetation was observed in the immediate 15 m radius around the source of ionizing radiation (Zone 1). Zone 2 showed the presence of Pennsylvania sedge, and Zone 3 had the presence of blueberry and huckleberry, in addition to Pennsylvania sedge. The trees were seen to survive from approximately 35 m outward with Oak trees being the major trees in (Zone 4) and Pine trees seen in Zone 5 along with Oak trees. Comparison of Figure 1a and b yields a conclusion that the regions that received high dosage of ionizing radiation have yet 11399
dx.doi.org/10.1021/es400923k | Environ. Sci. Technol. 2013, 47, 11396−11402
Environmental Science & Technology
Article
Figure 2. Dual Hierarchal clustering of individual samples. Top 50 genera based upon the average relative percentages in each sample were evaluated using Ward’s minimum variance and Manhattan distance. Preradiation samples are denoted with C and postradiation samples denoted with R. There is clear separation of the pre- and postradiation samples based upon the top 50 genera.
to recover from the effects of radiation. Surprisingly there is no correlation between the radiation dosage and the type of vegetation. Zone 3, which received higher dosage of radiation than Zone 4, has older pitch pine trees. This is opposite to what would be expected, considering the high sensitivity of the pitch pine trees to γ radiation.23 Our hypothesis was that the re-establishment of vegetation requires the presence of a balanced microbial community in the soil. Any imbalance in the microbial community would prevent the natural vegetation from growing in the soil. Exposure to ionizing radiation would have decreased the overall microbial diversity, with the radiation sensitive microorganisms being most susceptible. The soil near the radiation source would have
higher percentage of radiation-resistant organisms whereas at greater distances the decreasing radiation intensity would allow the sensitive microorganisms to remain viable along with the resistant ones. Among the sensitive microorganisms could be the key microorganisms required for the growth of higher plants. To test our hypothesis, we obtained surface soil (0−20 cm) from different zones and radiated the samples to 1.8 kGy of γ radiation. The dosage selected is approximately the amount of radiation the soil at 10 m distance from the source would have received in the field study in one year. Preradiated and postradiated soil samples were analyzed using tag-encoded FLX amplicon pyrosequencing (TEFAP) to identify the bacteria and 11400
dx.doi.org/10.1021/es400923k | Environ. Sci. Technol. 2013, 47, 11396−11402
Environmental Science & Technology
Article
Shah et al.26 recently reported that presence of high level of ammonia oxidizing bacteria in soil is critical for the vegetation to grow in pine barrens forest. These bacteria maintain the acidic pH of the soil and keep the nitrogen content low, both of which are essential for vegetation to grow. In the study, they reported that the members of Nitrosomonadaceae family (primarily Nitrosovibrio genus) are the only bacterial population carrying out ammonia oxidation in pine barrens soil.26 If the nitrogen-fixing bacteria increase in concentration relative to the ammonia oxidizers, soil may not be conducive for the growth of normal vegetation of the pine barrens. Results obtained in this study are in line with those reported by Shah et al.26 with Nitrosomonadaceae being the only ammonia oxidizing bacteria. Correlation analysis indicate a strong relationship between the sensitivity of Nitrosomonadaceae in the soil from each zone and the presence of higher plants. Correlation coefficient of 0.92 and p value
