Microlens Enhancement of Surface-Tethered ... - ACS Publications

Subscriber access provided by University of Sunderland

Interface-Rich Materials and Assemblies

Microlens Enhancement of Surface-Tethered Molecular Beacons Feiyue Teng, and Matthew R Libera Langmuir, Just Accepted Manuscript • DOI: 10.1021/acs.langmuir.8b02204 • Publication Date (Web): 02 Oct 2018 Downloaded from http://pubs.acs.org on October 4, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Microlens Enhancement of Surface-Tethered Molecular Beacons Feiyue Teng and Matthew Libera*

Department of Chemical Engineering and Materials Science, Stevens Institute of Technology, Hoboken, New Jersey 07030, USA

KEYWORDS: Microarray, Microgel, Microlens, Molecular beacons, Nucleic acid detection

Table of Contents Graphic

ACS Paragon Plus Environment 1

Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 19

ABSTRACT: The tethering of molecular beacon oligonucleotide detection probes to surface-patterned poly(ethylene glycol) microgels has enabled the integration of molecular beacons into a microarray format. The microgels not only localize the probes to specific surface positions but also maintain them in a water-like environment. Here we extend the concept of microgel tethering to include dielectric microlenses. We show that streptavidin-functionalized polystyrene microspheres (3 µm diameter) can be colocalized with molecular beacons using biotinylated PEG gels in patterns ranging from pseudo-continuous microgel pads with lateral dimensions on the order of tens of microns to individual microgels with lateral dimensions on the order of 400-500 nm. We use a simplex assay based on Influenza A detection to study the lensing behavior. The microspheres increase the effective numerical aperture of the collection optics, and we find that a tethered microsphere increases the peak intensity collected from hybridized beacons between 1.5 and 10 times depending on the specific pattern size and areal density of microgels. The highest signal increase occurs when a single microsphere is tethered to a single isolated microgel. The tethering is highly self-directed and occurs in the individual-microgel case only when the microgel is close to the optic axis of the microsphere. This alignment minimizes spherical aberration and maximizes coupling of emitted fluorescent intensity into the collection optics.


Page 3 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

Introduction Molecular beacons1-2 have been used extensively in a variety of oligonucleotide self-reporting detection and signaling applications. They comprise a short (5-7) base-pair stem of ds-DNA connected by a ss-DNA loop that serves as a probe sequence. The stem opens when the probe sequence hybridizes to its complement, which separates a fluorophore and a quencher so the hybridized beacon emits a fluorescent signal. Molecular beacon probes have worked exceptionally well in applications involving liquid assays where there are few constraints on their conformation in an aqueous medium. In contrast, they have seen relatively little use in a microarray format. Proximity to an underlying hard surface can place conformational constraints on the beacons as well as raise the background signal via non-specific interactions that affect fluorophore quenching.3-4 Tethering molecular beacon probes to highly swollen microgels patterned on solid substrates overcomes many of the conformational constraints imposed by solid substrates, because the diffuse interface between a hydrated hydrogel and the surrounding aqueous medium creates as water-like an environment as possible with maximal degrees of conformational freedom while still preserving the surface-location specificity associated with a microarray format.5

A separate development is the use of microlenses to enhance signal collection. In its simplest form, a microlens is a spherically shaped dielectric material, typically glass or polystyrene, which provides focusing action that can be superimposed on other collecting optics. Macroscopically, they are referred to as ball lenses, the optics of which are well established. Complexities arise microscopically when the radius of the microsphere is of the same order as the wavelength of light involved, which can produce so-called photonic nanojets.6-8 Practically speaking, however, microlenses concentrate light emitted from an object and effectively increase the numerical aperture of the optical system.

Rather than place a microlens or microlens array directly into the collection system 9-10 several efforts have placed a dielectric microlens in immediate proximity to the emitter. Yang and Gyjs 11 have, for example, used this approach to increase the signal associated with an immunofluorescent sandwich assay for IgG by a factor of about 3x. They exploited photolithography and electrostatic interactions to immobilize capture antibodies and melamine


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 19

microspheres on glass substrates and showed that a microsphere lens can enhance the signal collection in a model immunofluorescence sandwich assay. Schwartz et al.12 used surface-grafted Cy3-labeled streptavidin (SA) to tether 2 µm diameter TiO2 microspheres immediately adjacent to the fluorophore and showed that the microsphere in combination with a 20x 0.5NA objective lens in air performed as well or better than a 60x 1.45 NA oil-immersion objective lens. Based on the stepwise decrease to background levels of the detected intensity they were able to demonstrate single-molecule detection and then apply the method to study the single-molecule copying kinetics of DNA polymerase at 70 °C.

Here we explore the effect of microlenses on the signal associated with gel-tethered molecular beacons. We exploit the flexible and precise patterning capabilities of electron-beam lithography to create submicron-sized microgels of biotinylated poly(ethylene glycol) [PEG-B] to direct the assembly of streptavidin-functionalized polystyrene microspheres. Using established methods, we then tether molecular-beacon detection probes to the same microgels, and we study the self-assembly and microlensing effects of the microspheres, both of which are optimized when the microsphere is tethered to an individual and isolated sub-micron sized microgel. These findings are relevant to the development of high-density microarrays with micron-scale spot sizes.13

Experimental Methods

Electron-beam patterning

Electron-beam (e-beam) patterned microgels were synthesized on silicon substrates via previously established methods.14-15 Single-crystal Si substrates (5 mm × 5 mm, Ted Pella) were immersed in piranha solution (3:1 mixture of concentrated sulfuric acid and 30% hydrogen peroxide; exercise caution) overnight and washed with deionized (DI) water multiple times. Prior to use, these substrates were exposed to an oxygen plasma. Continuous PEG thin films, ~100 nm thick, were spin cast onto these substrates using a 2 wt% precursor solution of 60 wt% biotinylated poly(ethylene glycol) (PEG-B; Mw = 5 kDa) and 40 wt% hydroxyl-terminated PEG (Mw = 6 kDa) in tetrahydrofuran (THF). A Zeiss Auriga field emission gun (FEG) scanning electron microscope (SEM) with an


Page 5 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

electrostatic beam-blanking system and a Nanometer Pattern Generation System (NPGS, Nabity) was used for patterning (2 keV incident electron energy and a beam current of ∼200 pA). The inter-gel spacing, , could be easily varied. We used  = 250 nm to create pseudo-continuous gel pads of controllable diameters and pad spacings, and we increased  to as large as 3 µm to create arrays of discrete microgels. After electron exposure, the specimens were washed with DI water to remove uncrosslinked PEG.

Microsphere tethering

As-received streptavidin-functionalized polystyrene microspheres (3 µm diameter, supplied at 1 w/v% solids, Bangs Laboratories, Inc.) were washed 3 times in washing/binding buffer (20 mM Tris, pH 7.5; 1 M NaCl; 1 mM EDTA; 0.0005% TritonTMX-100) by centrifuging the microspheres at 10k rpm for 3 min and decanting the supernatant. The microspheres were re-suspended in washing/binding buffer to a concentration of 0.25 w/v%. Twenty µL of the suspension was deposited on each e-beam patterned Si wafer at room temperature and left there for 15 min to enable streptavidin-functionalized microspheres binding to the biotinylated PEG microgels. The wafers were then washed 3 times with washing/binding buffer. They were next incubated in a biotin solution (2 mg/mL in 0.1×PBS (10 mM Na3PO4, 15 mM NaCl, pH 7.0)) at room temperature in order to block excess streptavidin (SA) sites on the microgel-tethered microspheres. After 2 h, the wafers were washed 3 times with 0.1×PBS.

Molecular beacon tethering and hybridization

Molecular beacons (MBs) were tethered on the e-beam patterned microgels via previously established method.5, 16-18 Unreacted biotin groups on the PEG-B microgels were first activated by exposure to 20 µL of SA (200 mg/mL) in PBS (100 mM Na3PO4/150 mM NaCl, pH 7.4) for 2 h and then sequentially washed using PBS containing 0.05% Tween-20, pure PBS, and DI water. The SA-activated microgel samples were exposed to 20 μL of 1 μM biotinylated MB solution in 0.1×PBS for 2 h at room temperature. The samples were then washed with 0.1×PBS twice and with DI water once to remove unreacted MBs. They were subsequently exposed to 20 μL of 1


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 19

µM target DNA in hybridization buffer (4 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl, pH = 8.0) for 2 h. The MB sequence and the complimentary target DNA sequence (Table 1) were derived from a published assay for Influenza A. 19-20 The oligonucleotides were all purchased from Integrated DNA Technologies (Skokie, Illinois). IDT’s UNAFold software predicts a molecular-beacon melting temperature of 61.9 °C in the hybridization buffer used here.

Table 1. Oligonucleotide sequences for detecting Influenza A viruses

Name

Sequence

DNA- synthetic target (viral RNA mimic)

5’CGTCTCAAGGCACCAAACGATCTTACGAAC3’

Molecular Beacona

5’Alexa488-CCAAGCTAAGATCGTTTGGTGCCTTGGCTTGG-BHQ2-Biotin3’

a

The italic portions indicate the (molecular beacon)-target binding region.

Imaging

Bright-field and fluorescent images were collected using a Nikon E1000 upright optical microscope with a mercury lamp and a SensiCam high-sensitivity CCD camera (Cooke) while the specimen was hydrated and covered by a 0.17 mm glass coverslip. Bright-field images were taken using a Nikon Plan Apo 20× (NA = 0.75, working distance = 1.0 mm) objective lens and fluorescent images were taken using a Nikon Plan Apo 40× (NA = 0.95, working distance = 0.14 mm) objective lens. Digital image data were analyzed with Fiji.21-22 To quantify fluorescent intensities, regions of interest were defined using Fiji corresponding to the area of an individual microsphere. Hence, for gel pads with microspheres, fluorescent intensity was collected only from that portion of the pad covered by a microsphere. These intensity values could then be compared to intensities collected from equivalent areas on pads with no microspheres. Reported averages and standard deviations of fluorescent intensity correspond to at least five separate


Page 7 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

measurements (N = 5). SEM images were taken at 1 kV accelerating voltage with the same Zeiss Auriga FEG SEM used for the e-beam patterning process.

Results and Discussion

Gel-tethered molecular beacons

Figure 1 schematically illustrates the e-beam patterning process where energy from the incident focused electron beam both crosslinks the PEG thin film and grafts it to the underlying substrate.14, 23 Since e-beam patterning is a maskless process, userdefined patterns can be easily created, both over large areas and with individual feature sizes in the submicron/nano range. One important variable associated with the patterning process is the microgel spacing, 𝛿. The lower SEM images in Figure 1, for example, illustrate the effect of varying 𝛿 while holding all other irradiation parameters (incident electron energy, dose, focus) constant. For the irradiation conditions used here, individual microgels (Fig. 1 bottom left) typically have diameters on the order of 400-500 nm with a maximum dry height of about 60-80 nm.5 They swell when hydrated but do so very nonuniformly because of the distribution of

Figure 1. Top: Schematic illustration of the electron-beam patterning process. Bottom: SEM images of (dry) individual microgels (left) and a continuous gel pad (right) made using two different inter-gel spacings (𝛿), 1.5 µm and 250 nm, respectively

deposited electron energy.5, 15 The microgel spacing can be decreased such that the microgels overlap to create pseudo-continuous gel pads (Fig. 1 bottom right).


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 19

In contrast to other gel-based microarraying methods where probe oligonucleotides are trapped within the mesh of a spotted gel interior,24-26 the core of an ebeam patterned microgel is effectively impenetrable because of the high radiative dose it receives. The periphery, however, is very lightly crosslinked, so oligonucleotides tethered there find themselves at the microgel surface in a highly hydrated environment with relatively few conformational constraints.15 Figure 2 illustrates the signal generated when gel-tethered molecular beacons are exposed to complementary target.

Figure 2. Molecular–beacon probes (left) can be tethered to streptavidin-activated PEG-B microgel pads, and they fluoresce (right) when hybridized to complementary ssDNA.

Gel-tethered dielectric microspheres


Page 9 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

The same biotin-SA interaction that enables gel tethering of molecular beacons can be exploited to also tether microspheres. SA-functionalized PS microspheres bind specifically to locations where there are PEG-B microgels, and the number and spatial distribution of microspheres can be controlled. Figure 3 shows a typical example. When individual microgels are patterned in a linear array only one microsphere is tethered to a given microgel. Multiple microspheres can bind when the microgel spacing is decreased to form a pseudo-continuous pad (Fig. 3B). The size of the pad furthermore controls the average number of bound microspheres. Figures 3C-E show arrays of gel pads with diameters of 5 µm, 10 µm, and 20 µm, respectively, with the average number of microspheres increasing with increasing pad diameter.

Figure 3. Schematic illustrations (insets) and SEM images of dried samples of streptavidinfunctionalized polystyrene microspheres grafted to SA-activated PEG-B microgels: (a) along a line of individual microgels; and (b) on a continuous microgel pad. Bright-field optical micrographs (c, d, and e) show that microbeads can be patterned in a microarray format where the number of tethered microbeads per pad is controlled by the pad diameter.


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 19

After microsphere tethering, unreacted SA sites on the microsphere can be blocked by exposure to a biotin solution, and molecular beacon probes can be tethered to the underlying microgel. The fact that a tethered microsphere increases the fluorescent signal collected from hybridized molecular beacon probes is illustrated by Figure 4. It shows the Figure 4. Tethered microspheres increase the fluorescent intensity collected from hybridized molecular beacon probes: Bright-field (left) and fluorescence (right) images of hybridized molecular beacons on a 3x3 array of 1 µm diameter gel pads where a subset of the pads also have tethered microspheres.

case of 1 µm diameter gel pads (𝛿 = 250 𝑛𝑚) arrayed with an edge-to-edge spacing of 20 µm. Microsphere tethering conditions were chosen such that a fraction of the pads are uncovered while the rest have a single tethered

microsphere. One can immediately observe that the pads with a tethered microsphere exhibit greater intensity. We measured the total number of fluorescent counts from pads with and without microspheres, and the results are given in the table within Figure 4. In short, in this particular experiment, the microspheres enable over 7x as much fluorescent signal to be collected. As will be discussed below, the fact that the pad size is less than the microsphere diameter is significant.

The magnitude of increased collection depends on the number of microgels contributing fluorescent intensity within the collection angle of the microsphere. To illustrate this effect, we created arrays of 20 µm diameter gel pads, each with a different inter-gel spacing, and measured the fluorescent signal from equivalent areas of gel pad with and without microspheres. Figure 5 shows that the magnitude of measured fluorescent signal decreases by several orders of magnitude, for pads both with and without microspheres, as the inter-gel spacing is increased. This is a consequence of the simple fact that increasing the inter-gel spacing decreases the number of microgels and, hence, the number of fluorescing molecular beacon probes, per unit area. The intensity difference


Page 11 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

from samples of a given inter-gel spacing with and without microspheres asymptotically approaches a constant value as the inter-gel spacing increases. This result makes sense. There will be a threshold spacing beyond which only one microgel is contributing intensity to the microsphere above it. For 3 µm diameter microspheres we would expect that threshold spacing to be about 1.5 µm, which is consistent

Figure 5. The fluorescent intensity decreases, both with (solid blue line) and without (dashed black line) microspheres, as the inter-gel spacing increases. Each data point and error bar represents the average and standard deviation, respectively, of five different measurements.

with Figure 5.

Significantly, for a given inter-gel spacing, the ratio of signal measured from an area with a microsphere to a comparable area without a microsphere increases with increasing inter-gel spacing (Table 2). For the case of a pad with an inter-gel spacing of 250 nm, the ratio is about 1.5. When the inter-gel spacing is 3000 nm, however, that ratio increases to about 10.

Table 2. Ratio of fluorescent intensity from 20 µm diameter microgel pads with and without tethered microspheres (derived from data in Figure 5). Inter-gel spacing (nm)

250

500

750

1000

1250

1500

2000

3000

Bead/Gel Intensity ratio

1.46

1.45

1.66

2.52

2.53

3.98

5.16

9.99


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 19

The high collection efficiency associated with the microsphere action on fluorescence from a single microgel is a consequence of the alignment of the microgel under the microsphere. As illustrated by figure 6A, one can define the optic axis of a microsphere as a vector (the z axis) that is perpendicular to the planar hard substrate as well as perpendicular to both the entrance and exit surfaces of the microsphere. The deviation of the microgel position from this optic axis lies in the xy plane and is given by the parameter ∆ (figure 6B). For the patterning conditions used here (precursor film thickness, incident electron energy, incident electron dose), a hydrated microgel protrudes above the hard substrate by approximately 100 nm. Because the streptavidin-biotin interaction is strong, we can assume that tethering occurs when a microsphere touches the top surface of a microgel. One can then make a geometrical argument that tethering can only occur if ∆ is about 750 nm or less. A small

Figure 6. Schematic illustration of a 3 µm diameter polystyrene microsphere tethered with its optic axis: (A) immediately over a 0.5 µm diameter microgel; and (B) offset by a distance ∆ from the microgel center.

value of ∆ positions the microgel under the microsphere where the aberrations are smallest and where the efficiency with which the fluorescent intensity is coupled into the collection optics is highest. While a pseudo-continuous pad also has emission close to the optic axis where a microgel is tethered, there is also emission from beacons on the pad that are outside the 750 nm radius. Fluorescent emission from this peripheral area is much less effectively coupled into the collecting optics, and, as illustrated by Table 2, the enhancing effect of the microsphere is reduced.


Page 13 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

The microsphere centering over the emitter has important impact on the microlensing effectiveness. We studied this effect by comparing microlensing of a 1 µm diameter microgel pad ( = 250 nm) and an individual microgel, which has submicron dimensions. Figure 7 illustrates the experiment. It shows a 3x3 array of 1 µm diameter gel pads with a 20 µm spacing between each pad. The intersection points of the faint white lines indicate the center of each gel pad. Seven of the 9 pads have a tethered microsphere. It is clear by inspection that the intensity from each microsphere varies and that the more intense microspheres are those whose center coincides most closely with the center of

Figure 7. 1 µm diameter microgel pads on a square grid indicated by the intersection points of the faint white lines. Imperfect microsphere centering leads to significant variation in the measured fluorescent intensity.

the underlying gel pad. We used image data like that in Figure 7 to measure the intensity, I, associated with each microlensed pad as well as the deviation, ∆, of the microsphere center from the pad center. We normalized the microsphere intensity to that of the most intense microsphere, Imax, so Inorm = I/Imax. We studied microspheres tethered to 1 µm diameter pads as well as microspheres tethered to individual microgels. We made over 30 measurements of ∆ and I norm in each case. The results are summarized in Table 3. These data show that the microspheres are better centered on the individual microgels and, as a consequence, there is much less variability in the normalized fluorescent intensity collected from a microsphere tethered to an individual microgel than to a larger gel pad. This alignment phenomenon is consistent with that observed by Brody and Quake,27 who attached a small

Table 3. Individual submicron-sized microgels more reproducibly direct the microsphere tethering than do larger-diameter gel pads.

single microgel

1 µm diameter pad

∆ (Avg ± SD) (µm)

0.38 ± 0.20

0.65 ± 0.45

Inormalized (Avg ± SD)

0.80 ± 0.07

0.61 ± 0.22


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 19

fluorescing microsphere to a larger lensing microsphere and observed their rotational motion in solution. Their measured intensity decreased as the fluorescing microsphere rotated off of the optic axis defined by the lensing microsphere and the microscope optics.

Microgel alignment also enables us to understand the effect of microgel spacing on the lensed intensity reflected by Figure 5 and Table 2. Large inter-gel spacings - e.g. 3 µm - have only one microgel contributing to the lensed signal, and this microgel on average is well aligned close to the optic axis of the microsphere tethered above it. Small inter-gel spacings - e.g. 250 nm - create pseudo-continuous pads below the microsphere. That portion of the pad under the tethering point is efficiently lensed by the microsphere. The fluorescent intensity from microgels located farther away from this tethering point, yet still under the microsphere, is less efficiently coupled by the microsphere into the microscope's collection optics. While there is an enhancement relative to an equivalent unlensed pad - about 1.5x for inter-gel spacings of 250 nm, 500 nm, and 750 nm - that enhancement is thus much less than that for a single well-aligned microgel (~10x).

Summary and Conclusion

We have shown that streptavidin-functionalized polystyrene microspheres can be tethered by a directed self-assembly process to biotinylated PEG-based microgels patterned on a hard surface (silicon). The number and spatial distribution of tethered microspheres can be controlled by the microgel patterning process. After microsphere tethering, molecular beacon detection probes can be tethered to the remaining biotin sites on the microgels. When hybridized to their complementary targets the molecular beacons fluoresce, and the microspheres in immediate proximity to these beacons act as spherical microlenses to couple that fluorescent signal into the collecting objective lens of an optical microscope. Relative to equivalent hybridized beacons with no added microsphere, the lensing effect can increase the collected intensity by as much as ten times. While microspheres and beacons can both be tethered to gel pads tens of microns in diameter, comparable to traditional microarray spots, the


Page 15 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

enhancement effect is strongest when the size of the tethering microgel is substantially smaller than the size of the microsphere. We show under this condition that the directed-assembly process naturally aligns the optic axis of the microsphere over the tethered molecular beacons. This alignment minimizes spherical aberration and takes the fullest possible effect of the coupling effects of the spherical lens.

The practical aspects of these findings are several. While the effect on sensitivity may be small since the background is amplified along with the signal, the microlens effectively increases the numerical aperture of the collecting optics and thus can enable the use of lower-quality lenses in a collection system. Using a lower-quality lens would not only simplify the optics but also increase the field of view, so that in a microarray application, for example, the number of spots that could be simultaneously imaged would increase. Furthermore, resolving an individual sub-micron sized spot by itself and then collecting adequate fluorescent signal from it challenges simple optical collection systems. Tethering a 3 µm diameter sphere to that array spot, however, both provides for easier spot location as well as for an order of magnitude higher signal. Taken together - wider field of view, lower resolution feature identification, and stronger fluorescent signal - these advantages can facilitate the development of densely packed and highly multiplexed microarrays.


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 19

AUTHOR INFORMATION Corresponding Author *Matthew Libera, [email protected]

Author Contributions

The manuscript was written through contributions of both authors. Both authors have given approval to the final version of the manuscript.

ACKNOWLEDGMENT This research project has been supported by the U.S. National Science Foundation via grant number CBET-1402706 and by the Army Research Office via grant number W911NF-17-1-0332.


Page 17 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

REFERENCES

1. Tyagi, S.; Kramer, F. R., Molecular Beacons: Probes that Fluoresce upon Hybridization. Nature Biotechnology 1996, 14, 303. 2.

Chen, T.; Tan, W., Molecular beacons. Springer-Verlag Berlin Heidelberg: 2013.

3. Rao, A. N.; Grainger, D. W., Biophysical properties of nucleic acids at surfaces relevant to microarray performance. Biomater. Sci. 2014, 2 (4), 436-471. 4. Chen, T.; Tan, W., Molecular beacons on solid surfaces. In Molecular Beacons, SpringerVerlag Berlin Heidelberg: 2013; Vol. 9783642391095, pp 75-90. 5. Dai, X.; Yang, W.; Firlar, E.; Marras, S. A. E.; Libera, M., Surface-patterned microgeltethered molecular beacons. Soft Matter 2012, 8 (11), 3067-3076. 6. Guo, H.; Han, Y.; Weng, X.; Zhao, Y.; Sui, G.; Wang, Y.; Zhuang, S., Near-field focusing of the dielectric microsphere with wavelength scale radius. Opt. Express 2013, 21 (2), 2434-2443. 7. Kim, M. S.; Scharf, T.; Mühlig, S.; Fruhnert, M.; Rockstuhl, C.; Bitterli, R.; Noell, W.; Voelkel, R.; Herzig, H. P., Refraction limit of miniaturized optical systems: A ball-lens example. Opt. Express 2016, 24 (7), 6996-7005. 8. Yang, H.; Trouillon, R.; Huszka, G.; Gijs, M. A. M., Super-Resolution Imaging of a Dielectric Microsphere Is Governed by the Waist of Its Photonic Nanojet. Nano Lett. 2016, 16 (8), 4862-4870. 9. Liu, J.; Chang, M. J.; Ai, Y.; Zhang, H. L.; Chen, Y., Fabrication of microlens arrays by localized hydrolysis in water droplet microreactors. ACS Applied Materials and Interfaces 2013, 5 (6), 2214-2219. 10. Zhang, D.; Xu, Q.; Fang, C.; Wang, K.; Wang, X.; Zhuang, S.; Dai, B., Fabrication of a Microlens Array with Controlled Curvature by Thermally Curving Photosensitive Gel Film beneath Microholes. ACS Applied Materials and Interfaces 2017, 9 (19), 16604-16609. 11. Yang, H.; Gijs, M. A. M., Microtextured substrates and microparticles used as in situ lenses for on-chip immunofluorescence amplification. Analytical Chemistry 2013, 85 (4), 20642071.


Langmuir 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 19

12. Schwartz, J. J.; Stavrakis, S.; Quake, S. R., Colloidal lenses allow high-temperature single-molecule imaging and improve fluorophore photostability. Nature nanotechnology 2010, 5 (2), 127-32. 13. Dandy, D. S.; Wu, P.; Grainger, D. W., Array feature size influences nucleic acid surface capture in DNA microarrays. Proc. Natl. Acad. Sci. U. S. A. 2007, 104 (20), 8223-8228. 14. Krsko, P.; Sukhishvili, S.; Mansfield, M.; Clancy, R.; Libera, M., Electron-Beam Surface-Patterned Poly(ethylene glycol) Microhydrogels. Langmuir 2003, 19 (14), 5618-5625. Wang, Y.; Firlar, E.; Dai, X.; Libera, M., Poly(ethylene glycol) as a biointeractive 15. electron-beam resist. Journal of Polymer Science Part B: Polymer Physics 2013, n/a-n/a. Ma, Y.; Dai, X.; Hong, T.; Munk, G. B.; Libera, M., A NASBA on microgel-tethered 16. molecular-beacon microarray for real-time microbial molecular diagnostics. Analyst 2016, 142 (1), 147-155. 17. Ma, Y.; Libera, M., Molecular Crowding Effects on Microgel-Tethered Oligonucleotide Probes. Langmuir 2016, 32 (25), 6551-8. 18. Ma, Y.; Teng, F.; Libera, M., Solid-Phase Nucleic Acid Sequence-Based Amplification and Length-Scale Effects during RNA Amplification. Analytical Chemistry 2018, 90 (11), 65326539. 19. Wat, D.; Gelder, C.; Hibbitts, S.; Cafferty, F.; Bowler, I.; Pierrepoint, M.; Evans, R.; Doull, I., The role of respiratory viruses in cystic fibrosis. Journal of cystic fibrosis : official journal of the European Cystic Fibrosis Society 2008, 7 (4), 320-8. 20. Moore, C.; Hibbitts, S.; Owen, N.; Corden Sally, A.; Harrison, G.; Fox, J.; Gelder, C.; Westmoreland, D., Development and evaluation of a real‐time nucleic acid sequence based amplification assay for rapid detection of influenza A. Journal of Medical Virology 2004, 74 (4), 619-628. 21. Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; Tinevez, J.-Y.; White, D. J.; Hartenstein, V.; Eliceiri, K.; Tomancak, P.; Cardona, A., Fiji: an open-source platform for biological-image analysis. Nature Methods 2012, 9, 676.


Page 19 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Langmuir

22. Schneider, C. A.; Rasband, W. S.; Eliceiri, K. W., NIH Image to ImageJ: 25 years of image analysis. Nature Methods 2012, 9, 671. 23. Kolodziej, C. M.; Maynard, H. D., Electron-Beam Lithography for Patterning Biomolecules at the Micron and Nanometer Scale. Chemistry of Materials 2012, 24 (5), 774-780. 24. Pemov, A.; Modi, H.; Chandler, D. P.; Bavykin, S., DNA analysis with multiplex microarray-enhanced PCR. Nucleic Acids Research 2005, 33 (2). Proudnikov, D.; Timofeev, E.; Mirzabekov, A., Immobilization of DNA in 25. polyacrylamide gel for the manufacture of DNA and DNA-oligonucleotide microchips. Analytical Biochemistry 1998, 259 (1), 34-41. Rendl, M.; Bönisch, A.; Mader, A.; Schuh, K.; Prucker, O.; Brandstetter, T.; Rühe, J., 26. Simple one-step process for immobilization of biomolecules on polymer substrates based on surface-attached polymer networks. Langmuir 2011, 27 (10), 6116-6123. 27. Brody, J. P.; Quake, S. R., A self-assembled microlensing rotational probe. Applied Physics Letters 1999, 74 (1), 144-146.


Microlens Enhancement of Surface-Tethered ... - ACS Publications

Recommend Documents