Minichromosome Maintenance Complex Is a ... - ACS Publications

Subscriber access provided by University of Cincinnati Libraries

Article

The MCM complex is a critical node in the miR-183 signaling network of MYCN-amplified neuroblastoma cells Marco Lodrini, Gereon Poschmann, Victoria Schmidt, Jasmin Wünschel, Daniel Dreidax, Olaf Witt, Thomas Höfer, Helmut E. Meyer, Kai Stuehler, Angelika Eggert, and Hedwig E. Deubzer J. Proteome Res., Just Accepted Manuscript • DOI: 10.1021/acs.jproteome.6b00134 • Publication Date (Web): 30 May 2016 Downloaded from http://pubs.acs.org on June 4, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Proteome Research is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 27

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Proteome Research

The MCM complex is a critical node in the miR-183 signaling network of MYCN-amplified neuroblastoma cells Marco Lodrini1, Gereon Poschmann2, Victoria Schmidt3, Jasmin Wünschel1, Daniel Dreidax4, Olaf Witt3,5, Thomas Höfer6, Helmut E. Meyer7, Kai Stühler2,8, Angelika Eggert1 and Hedwig E. Deubzer1,3,5,9* 1

2

3

4 5

6 7

8

9

Department of Pediatric Hematology/Oncology/Stem Cell Transplantation, Charité - University Hospital Berlin, Campus Virchow-Klinikum, Augustenburger Platz 1, 13353 Berlin, Germany Molecular Proteomics Laboratory, Biological Medical Research Centre, Heinrich-Heine-University Düsseldorf, Universitätsstraße 1, 40225 Düsseldorf, Germany Clinical Cooperation Unit Pediatric Oncology, German Cancer Research Center (DKFZ) and German Consortium for Translational Cancer Research (DKTK), INF 280, 69120 Heidelberg, Germany Division Neuroblastoma Genetics, DKFZ, INF280, 69120 Heidelberg, Germany Center for Individualized Pediatric Oncology (ZIPO) and Brain Tumors, Department of Pediatric Hematology/On- cology, University of Heidelberg and National Center for Tumor Diseases (NCT), INF 430, 69120 Heidelberg, Germany Division of Theoretical Systems Biology, DKFZ, INF280, 69120 Heidelberg Germany Leibniz-Institut für Analytische Wissenschaften – ISAS – e.V., Bunsen-Kirchhoff-Str. 11, 44139 Dortmund, Germany Institute for Molecular Medicine, University Hospital Düsseldorf, Universitätsstraße 1, 40225 Düsseldorf, Germany Junior Neuroblastoma Research Group, Experimental and Clinical Research Center of the Max-Delbrück Center for Molecular Medicine and the Charité – University Medicine Berlin, Lindenberger Weg 80, 13125 Berlin, Germany

Running title: Inhibitory effect of miR-183 on MCM family members Keywords: cell cycle progression, eukaryotic genome replication, genomic integrity, labelfree proteomics, dual-luciferase reporter gene assay, oncogene, systems biology Grant support This work was supported by the BMBF through NGFNplus and e:MED SYSMED-NB (T. Höfer, K. Stühler, A. Eggert, H.E. Deubzer), by the Deutsche Krebshilfe (M. Lodrini, H.E. Deubzer) and by the Berlin Institute of Health (BIH) through TERMINATE-NB (A. Eggert, H.E. Deubzer) and a translational PhD project grant (H.E. Deubzer). *

Corresponding author Hedwig E. Deubzer Charité – University Medicine Berlin Department of Pediatric Hematology/Oncology/Stem Cell Transplantation Augustenburger Platz 1 13353 Berlin, Germany Phone: ++49 30 450 616 157 Fax: ++49 30 450 751 6925 Mail: [email protected] The authors disclosed no potential conflicts of interest. Word count: 3.245 References: 55 Number of Figures: 6 Number of Tables: 2 Number of Supplementary Figures: 2 ACS Paragon Plus Environment

Journal of Proteome Research Lodrini et al.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Inhibitory effect of miR-183 on MCM family members

Number of Supplementary Tables: 2 ABSTRACT MYCN and HDAC2 jointly repress the transcription of tumor suppressive miR-183 in neuroblastoma. Enforced miR-183 expression induces neuroblastoma cell death and inhibits xenograft growth in mice. Here we aimed to focus more closely on the miR-183 signaling network using a label-free mass spectrometric approach. Analysis of neuroblastoma cells transfected with either control or miR-183 expression vectors identified 85 differentially expressed proteins. All six members of the minichromosome maintenance (MCM) complex, which is indispensable for initiation and elongation during DNA replication and transcriptionally activated by MYCN in neuroblastoma, emerged to be down-regulated by miR-183. Subsequent annotation category enrichment analysis revealed a ~14-fold enrichment in the “MCM” protein module category, highlighting this complex as a critical node in the miR-183 signaling network. Down-regulation was confirmed by western blotting. MCMs 2-5 were predicted by in silico methods as direct miR-183 targets. Dual-luciferase reporter gene assays with 3′-UTR constructs of the randomly selected MCMs 3 and 5 experimentally confirmed them as direct targets of miR-183. Our results reveal the MCM complex to be a critical and directly regulated node within the miR-183 signaling network in MYCN-amplified neuroblastoma cells.

2 ACS Paragon Plus Environment

Page 2 of 27

Page 3 of 27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION MicroRNAs (miRNAs) constitute a class of single-stranded non-coding RNAs each about 22 nucleotides long, which contribute to the regulation of fundamental cellular processes such as proliferation, cell cycle arrest, differentiation and apoptosis by influencing mRNA stability and translation. The microRNA 183 (miR-183) forms a cluster together with miR-96 and miR-182 and is encoded at an intergenic site on chromosome 71-2. We have previously shown that miR-183 is the strongest induced microRNA in MYCN-amplified neuroblastoma cells upon treatment with the pan-HDAC inhibitor and cyclic tetrapeptide, Helminothosporium carbonum (HC)-toxin3. Analysis of the upstream regulatory control of miR-183 by chromatin immunoprecipitation (ChIP) experiments demonstrated that transcription of miR-183 is repressed both by the oncogene, MYCN, and the abundantly expressed class I histone deacetylase 2 (HDAC2)3. To investigate the functional role of miR-183 in neuroblastoma, we performed enforced expression studies using both transient transfection or a stable miR-183inducible cell line. These models showed increased levels of cell death, diminished anchorage-independent colony growth in soft agar as well as suppressed growth in subcutaneous mouse xenografts, pointing towards a tumor suppressive role for miR-183 in preclinical models of high-risk neuroblastoma3. Studies measuring miR-183 expression in various cancers reported both elevated4-9 and reduced levels10-12 when compared with corresponding healthy control samples, suggesting that oncogenic transformation influences miR-183 in a niche-dependent manner. Reaching beyond expression profiling, two independent studies demonstrated at the phenotypic level that triggering miR-183 expression in osteosarcoma12 and lung cancer13 cell lines attenuates migration and invasion while downregulation of miR-183 triggered the migration-invasion cascade. The membrane protein ezrin (EZR) was functionally validated as one of the first known miR-183 targets in these studies1213

. Three further direct miR-183 targets with a reported role in neuroblastoma biology were

predicted and functionally proven in other cancer cell lines. One of which was the integrin 3 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


subunit beta 1 (ITGB1) that was shown to be a target in Hela cells14, and which promotes programmed cell death in neuroblastoma cells15. The BMI1 proto-oncogene and polycomb ring finger (BMI1) mRNA was shown to be a target in pancreatic and colon cancer cell lines16, and was previously shown17 to counteract MYCN-mediated programmed cell death in neuroblastoma cells, to support anchorage-independent colony formation in neuroblastoma cells in vitro and to promote neuroblastoma xenograft growth in vivo when strongly expressed. MicroRNA profiling studies revealed strong expression of miR-183 in high-grade gliomas18, and subsequent studies employing glioblastoma cell lines identified upregulated expression of the hypoxia inducible factor 1 alpha subunit (HIF1A) through down-regulation of the mitochondrial isocitrate dehydrogenase (NADP(+)) 2 (IDH2) by miR-18318. Enforced IDH2 expression in the neuroblastoma cell line, SH-SY5Y, was previously shown to increase resistance to alkaloid-triggered cell death through an increase in the mitochondrial NADPH and glutathione levels and blockage of ROS production19. Based upon our previous observation that high miR-183 levels favorably influence the malignant behavior of neuroblastoma cells, we here aimed at illuminating details of the miR-183 signaling network in an unbiased approach using label-free mass spectrometry. EXPERIMENTAL SECTION Cell culture The BE(2)-C cell line was obtained from the European Collection of Animal Cell Cultures (Salisbury, UK) and the Kelly cell line from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany). BE(2)-C and Kelly neuroblastoma cell lines were cultured in Dulbecco's Modified Eagle Medium (DMEM) or Roswell Park Memorial Institute (RPMI) 1640 Medium supplemented with 10% fetal calf serum (Sigma-Aldrich, Munich, Germany) and 1% non-essential amino acids (Invitrogen, Darmstadt, Germany) at 37 °C, 5% CO2. Cell lines were monitored for infections by high-throughput multiplex cell 4 ACS Paragon Plus Environment

Page 4 of 27

Page 5 of 27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


contamination testing20. Cell line authenticity was validated by high-throughput SNP-based assays21. Pre-miR and plasmid transfection miRNA precursor (pre-miR) for hsa-miR-183 (Applied Biosystems, Darmstadt, Germany) was transfected at a concentration of 30 nM using HiPerFect (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The Pre-miR miRNA Precursor-Negative Control #1 (Applied Biosystems) served as the negative control3. Plasmids were transfected using the Effectene method according to the manufacturer’s instructions (Qiagen)3. RNA isolation and quantitative RT-PCR Total RNA was isolated from cell cultures using the miRNeasy Mini Kit (Qiagen). M-MLV reverse transcriptase (Invitrogen) and random hexamer primers (Invitrogen) were used to transcribe cDNAs. Quantification of mature miR-183 was performed using TaqMan® microRNA assays (Applied Biosystems). Detection of mature miR-183 was previously confirmed by sequencing3. RNU6B and RNU48 were used for normalization3. All expression analyses were performed using Applied Biosystems Prism software and the ∆∆Ct method22. Proteome analysis using label-free mass spectrometry Intact BE(2)-C cells were washed two times with ice-cold PBS, then scraped from the dish using a rubber policeman into 1 ml ice-cold PBS. Pelleted cells were washed three times with ice-cold PBS by centrifugation at 3,000 rpm for 3 min. Supernatants were discarded, and pellets were shock-frozen in liquid nitrogen and stored at -80 °C. Cells from six independent biological experiments were lysed in 1.4 µl 30 mM Tris-HCl, 2 M thiourea, 7 M urea, 4 % (w/v) CHAPS buffer (pH 8.0) per mg cells and homogenized on ice. Homogenates were sonicated six times in 10 sec pulses in an ice water bath and centrifuged at 16,000 x g for 15 min. The resulting supernatants from two sonication/centrifugation steps were combined, and protein concentrations were measured using the Bradford method (Bio-Rad, Munich, 5 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Germany). Protein lysates were stacked in an SDS-polyacrylamide gel at a running distance of approximately 4 mm (Life Technologies, Darmstadt, Germany). After MS-compatible silver staining, protein bands were stripped with destaining solution (50 mM potassium ferricyanide, 15 mM sodium thiosulfate in water) and washed twice each sequentially with 10 mM ammonium bicarbonate in water and 5 mM ammonium bicarbonate in 1:1 (v/v) water/acetonitrile. Proteins were digested with a trypsin-to-substrate ratio of 1:50 (w/w) overnight. Resulting peptides were extracted using an 1:1 (v/v) solution of acetonitrile and 0.1% trifluoroacetic acid, vacuum dried then reconstituted in aqueous 0.1% trifluoroacetic acid. In total, 500 ng peptides per sample were subjected to liquid chromatography (LC) and separated over a 120-min LC gradient using the UltiMate 3000 Rapid Separation LC system (Thermo Scientific, Idstein, Germany) equipped with an Acclaim PepMap 100 C18 column (75 µm inner column diameter, 2 µm particle size, 25 cm column length; Thermo Scientific). MS was carried out on an Obitrap Velos High Resolution Instrument (Thermo Scientific) operated in positive mode and equipped with a nano-electrospray ionization source. Capillary temperature was set to 275 °C and source voltage to 1.4 kV. Survey scans were carried out in the Orbitrap analyzer over the 300 to 2000 m/z mass range at a resolution of 30,000 at 400 m/z. The target value for the automatic gain control was 1,000,000 and the maximum fill time was 500 ms. Altogether, the 20 most intense peptide ions were isolated, transferred to the linear ion trap in the instrument and fragmented using collision-induced dissociation. The minimal signal intensity was 500, and single-charged ions were excluded. Peptide fragments were analyzed in the LTQ part of the instrument using a maximum fill time of 10 ms, an automatic gain control target value of 30,000 and the scan rate setting of “normal”. Already fragmented ions were excluded from fragmentation for 45 sec. The instrument was controlled by Xcalibur 2.1.0, LTQ Orbitrap Velos MS 2.6.0.1050 software. Raw files were further processed for peptide/protein identification and quantification using the MaxQuant software suite version 1.4.1.2 (Max Planck Institute of Biochemistry, Planegg, Germany). Acquired 6 ACS Paragon Plus Environment

Page 6 of 27

Page 7 of 27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mass spectra were matched against the theoretical trypsin fragments produced from the 88,277 H. sapiens sequences downloaded from the UniProt/SwissProt database (release 09.2013) using a sequential 2-pass search with increasing mass tolerance. A first search was performed with a precursor mass tolerance of 20 ppm, then nonlinear mass recalibration was carried out based on the first pass identifications. A second search was conducted with a precursor mass tolerance set to 4.5 ppm. The mass tolerance for fragment spectra recorded in the LTQ part of the instrument was set to 0.5. Search settings allowed for variable modifications by methionine oxidation and acetylation at protein N-termini. Assignments for peptides, proteins and modification were accepted at a false discovery rate (FDR) < 1%. Protein identification required that at least two peptides and were accepted at a FDR < 1%. Label-free quantification was carried out using the “match between runs” option with a 1 min match and a 20 min alignment window. MS data were deposited to the ProteomeXchange Consortium with the dataset identifier PXD003596 via the PRIDE partner repository23. Western blot analysis Cells were lysed for western blotting in 20 mM Tris-HCl, 7 M urea, 0.01% buffer containing Triton X-100, 100 mM dithiothreitol, 40 mM MgCl2 and Complete® protease inhibitor cocktail (Roche, Mannheim, Germany) in three biological replicates, and 30 µg was loaded per lane on 10% SDS-PAGE. Western detection used the goat polyclonal anti-MCM3 (Santa Cruz Biotechnology, Dallas, USA), rabbit polyclonal anti-MCM 5 (Abcam, Cambridge, UK) and rabbit polyclonal anti-Histone H3 (Cell Signaling Technology, Danvers, MA) antibodies. Western blot analyses of the three replicates were independently carried out. Plasmids The 3′-UTRs of the MCM3 and MCM5 genes were subcloned from the G248P88108B6 (WI22237C11) and G248P81252C3 (WI2-821E5) fosmids into the pmirGLO dual-luciferase miRNA target expression vector (Promega, Madison, WI). PCRs were carried out with the 7 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Phusion High Fidelity DNA polymerase (Invitrogen) and primers containing Nhel and SalI restriction sites: 3′-UTR MCM3 forward, 5′-CTA GCT AGC GGA GGC CTC GTC TCT-3′; 3′-UTR MCM3 reverse, 5′-TGC GCT ACA CCA TGT GTA CGA AAT GG-3′; 3′-UTR MCM5 forward, 5′-CTA GCT AGC GTC GCG CCG CCT AC-3′; 3′-UTR MCM5 reverse, 5′TGC GGT CGA CTA CCT GAA CAC ACC GTG GC-3′. The QuikChange Primer Design software and QuikChange II Site-Directed Mutagenesis Kit (both Agilent Technologies) were used to construct mutated MCM3 and MCM5 3′-UTR sequences. The mutated MCM3 3′-UTR sequence was generated in two steps using the following primers: Step 1, 3′-MCM3mut forward, 5′-GGA ATG GGT CAT GAA AGC ACG CAT GGG GTG AGG AAA GAG-3′; step 1, 3′-MCM3mut reverse, 5′-CTC TTT CCT CAC CCC ATG CGT GCT TTC ATG ACC CAT TCC-3′; step 2, 3′-MCM3mut forward, 5′-ATG GGT CAT GAA AAD CAC GGT AGG GGT GAG GAA AGA GGA G -3′; step 2, 3′-MCM3mut reverse, 5′-CTC CTC TTT CCT CAC CCC TAC CGT GCT TTC ATG ACC CAT-3′. The MCM5 3′-UTR sequence was generated in a single step using: 3′-MCM5mut forward, 5′-CGC CCC TCC TGC CGC TGC CAC GGT ATG ACA ATG TTG CTG GGA CC-3′;

3′-MCM5mut reverse, 5′-GGT CCC

AGC AAC ATT GTC ATA CCG TGG CAG CGG CAG GAG GGG CG-3′. PCR products and plasmids were validated by sequencing. Dual-luciferase reporter gene assay Cells were assayed for Firefly and Renilla luciferase activities using the dual-luciferase reporter gene assay (Promega) and the FLUOstar OPTIMA microplate reader (BMG Labtech, Ortenberg, Germany). Firefly luciferase values were normalized using Renilla luciferase values to correct for transfection efficacy. Assays were independently performed in at least four biological replicates. Statistical analysis


Page 8 of 27

Page 9 of 27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Data obtained by label-free quantitative MS coupled with LC-MS map alignment were statistically analyzed using Perseus version 1.4.0.20 (Max Planck Institute of Biochemistry, Planegg, Germany). The MaxLFQ quantification algorithm implemented in MaxQuant24 was employed to normalize intensities for quantification. Unique and razor peptides were used for quantification, and normalization was done with the minimal ratio count set to “2”. Proteins with at least four valid values per analyzed group were included in the analysis. The significance analysis of microarrays (SAM) algorithm25 implemented in Perseus was used on log-transformed data to identify proteins regulated by miR-183 (permutation-controlled FDRthreshold < 1%; constant S0 = 0.25). This algorithm accounted for both changes in protein abundance and the standard deviation of measurements. Implementations for the Gene Ontology Biological Process (GOBP), Kyoto Encyclopedia of Genes and Genomes (KEGG) and Simple Modular Architecture Research Tool (SMART) algorithms in Perseus were used for annotation enrichment analysis. FDR correction was performed according to Benjamini and Hochberg26, applying a threshold of 0.01, and Fisher’s exact t-test was used for significance testing. DIANAmT27, miRanda28, miRWalk29, PicTar530, RNA2231 and Targetscan7.032 were used to predict miRNA targets. STRING10 software33 was used to visualize known and predicted interactions among proteins differentially regulated after enforced miR-183 expression. Treatment groups in Western blot densitometry and dualluciferase reporter assays were compared using the paired t-test in the SigmaPlot 9.0 package. P values below 0.05 were considered statistically significant. RESULTS AND DISCUSSION The MCM complex is a critical node in the miR-183 network in neuroblastoma We used the in vitro BE(2)-C cell model with basal versus enforced miR-183 expression to define relevant candidate proteins and biological processes involved in the network controlled by miR-183 in neuroblastoma. We have previously shown that cell death is induced in this 9 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


model and that it is characterized by attenuated anchorage-independent colony formation and subcutaneous xenograft growth3. We identified and quantified a total of 1185 proteins using a label-free MS approach (Fig. 1 and Fig. 2A). Statistical analysis revealed 35 significantly upregulated proteins, and 50 significantly down-regulated proteins including EZR, IDH2 and ITGB1, which are known to be targeted by miR-183 (Fig. 2A, Tables S-1 and S-2). MCM proteins 2-7 were down-regulated approximately 40% by enforced miR-183 expression (Fig. 2B). Principal component analysis showed a distinct separation of cells expressing basal versus enforced levels of miR-183 (Fig. S-1), and a heat map presentation of all differentially regulated proteins visualized the significant and for miRNA-networks typically mild regulation upon enforced miR-183 expression (Fig. S-2). Annotation enrichment analyses using the GOPB, KEGG and SMART algorithms all identified eight different categories related to ‘DNA replication’, ‘cell cycle’, ‘RNA metabolic process’ or ‘cardiomyopathy’ (Table 1). The category with the highest enrichment factor,13.9, and the highest corrected P value, 2.9E-05, was ‘minichromosome maintenance complex (MCM)’, reflecting MCM2-7 down-regulation after enforced miR-183 expression (Fig. 2B, Tables 1-2). The MCM proteins 2-7 summarized under this term were also listed under ‘DNA geometric change’, ‘DNA replication’, ‘meiosis – yeast’, ‘cell cycle – yeast’ and ‘cell cycle’ (Table 1). The network diagram of proteins regulated by miR-183 constructed using STRING10 also highlighted MCM proteins 2-7 as a potential critical node (Fig. 3). MCM3 and MCM5 were randomly selected for re-analysis by western blotting. That enforcing miR-183 expression downregulates MCM3 and MCM5 expression in BE(2)-C cells was confirmed (Fig. 4A), and the association was also shown in the Kelly neuroblastoma cell line (Fig. 4B). Taken together, enforced miR-183 expression down-regulated all six members of the MCM complex in neuroblastoma cells. High-level MCM expression is associated with aggressiveness in carcinomas 10 ACS Paragon Plus Environment

Page 10 of 27

Page 11 of 27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Several replication factors precisely orchestrate initiation of DNA replication once during each cell cycle to ensure genomic integrity. Among them are the MCM proteins 2-7, the chromatin licensing and DNA replication factor 1 (CDT1), the cell division cycle genes 6, 7 and 45 (CDC6, CDC7 and CDC45) and the DNA replication inhibitor, geminin (GMNN, reviewed in 34 and 35). A review of the literature indicated that MCM family members are overexpressed in multiple cancers. Two independent large-scale studies investigating the prognostic potential of MCM2 expression in invasive ductal breast cancer showed a strong correlation between high-level expression and high proliferative activity as well as advanced stage disease36,37. MCM2 expression in large B-cell lymphoma38, gastric cancer39, renal cell carcinoma40 and squamocellular carcinomas of the oral cavity, esophagus and larynx41-43 also correlated with unfavorable prognosis and was predictive for shorter survival. Papillary thyroid carcinomas were shown to express higher levels of MCM3 than healthy thyroid tissue, and MCM3 quantification was a more reliable marker to predict tumor aggressiveness than the Ki-67 index44. Non-small cell lung cancers (NSCLC) expressed higher levels of MCM4 than adjacent normal bronchial epithelial cells, and down-regulation of MCM4 expression by small interfering RNAs reduced proliferation in NSCLC cell lines45. MCM5 levels in urine were recently reported to serve as a reliable biomarker for primary and recurrent bladder carcinoma detection46. High-level MCM2 and MCM5 expression in ovarian adenocarcinomas strongly correlated with unfavorable patient outcome in both univariate and multivariate analyses47. MCM6 mRNA and protein levels measured in plasma from hepatocellular carcinoma patients by qRT-PCR and enzyme-linked immunosorbent assays were also significantly higher than in plasma from cirrhotic and healthy individuals, and high MCM6 plasma levels correlated with advanced tumor stage48. Semi-quantitative scoring of immunohistochemically detected high-level MCM7 expression in colorectal cancers49, lung adenocarcinomas50 and oral squamous cell carcinomas51 compared to unaffected tissue of origin was an independent prognostic factor for unfavorable patient survival in representative 11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


studies, underlining the prognostic significance of MCM7 expression in these cancer entities. Altogether, the data suggest that de-regulated expression of MCM complex members plays an important role in uncontrolled cell proliferation and, ultimately, aggressiveness of multiple carcinomas arising mainly in adulthood. MCM genes are transcriptionally activated by MYCN Three studies investigated the role of MCM proteins in embryonic tumors arising in infancy and early childhood to date. Depletion of MCM2, 3 or 7 in medulloblastoma cell lines triggered cell cycle arrest and inhibited anchorage-independent colony formation, migration and invasion in transwell Boyden chamber assays, whereas, enforced expression increased malignant characteristics52. Immunohistochemistry showed a strong expression of MCM2, 3 and 7 in primary medulloblastoma tumor sections, and strong MCM3 expression correlated with unfavorable patient prognosis52. Shohet and colleagues demonstrated in 2002 that MYCN transcriptionally activated MCM7 in neuroblastoma cells53. To investigate the role of MCM7 in tumorigenesis beyond its use as a biomarker for proliferative cancer tissues, they generated a mouse model with high-level MCM7 expression in the basal layer of the epidermis54. When subjected to a chemical carcinogenesis protocol, mice had a significantly higher incidence of squamous cell carcinoma compared with untreated controls, and 90% of the tumors harbored KRAS mutations54. These data indicate that increased MCM7 expression actively contributes to tumorigenesis. Koppen and colleagues showed that not only the wellstudied MCM7 gene, but also all other related members of the MCM complex, MCM2-6, are transcriptionally activated by MYCN in neuroblastoma cells55. MCMs are direct miR-183 targets The identification of the MCM complex as a critical node of the miR-183 network in neuroblastoma prompted us to experimentally test whether two randomly selected MCM family members, MCM3 and MCM5, are direct miR-183 targets. The dual-luciferase reporter 12 ACS Paragon Plus Environment

Page 12 of 27

Page 13 of 27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


gene assay was employed to experimentally test direct interaction. Activities of both luciferase reporter plasmids, MCM3-3′-UTR and MCM5-3′-UTR, were reduced by enforced miR-183 expression (Fig. 5A-B). Direct miR-183 regulation was confirmed by the significant loss of reporter activity when constructs with mutated miRNA target sites were used (Fig. 5AB). These data confirmed our results from in silico target prediction using DIANAmT, miRanda, miRWalk, PicTar5, RNA22 and Targetscan7.0, which identified MCM2-5 as direct miR-183 targets. Altogether, these data indicate a pivotal role of the MCM complex in the miR-183 regulatory network in neuroblastoma cells (schematic model shown in Fig. 6). CONCLUSIONS We and others have shown that pharmacological inhibition of histone deacetylase (HDAC) activity triggers cell death or cell cycle arrest and differentiation in preclinical models of neuroblastoma. The exhaustive exploitation of microRNA datasets obtained after histone deacetylase inhibitor treatment of MYCN-amplified neuroblastoma cells identified miR-183 as the strongest induced microRNA, and ChIP qRT-PCR analyses identified the MYCN and HDAC2 as transcriptional repressors of miR-183. Here we focused on unraveling the miR183 signaling network, and revealed DNA replication licensing factors as direct miR-183 targets and identified the heterohexameric minichromosome maintenance protein complex as a critical node in the tumor suppressive phenotype mediated by miR-183 in neuroblastoma. MCM2-7 are indispensable for initiation of DNA replication, and were previously shown to be directly transcriptionally activated by MYCN and to be strongly expressed in primary neuroblastomas harboring MYCN amplifications. These results implicate the direct and indirect intervention of MYCN at different cellular levels to ensure rapid replication of highly malignant neuroblastoma cells by triggering transcription of MCM2-7 as key regulatory components of cell cycle progression.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website at DOI: List of the files and their contents (tables and figures) with descriptive titles. •

Supplementary Table S-1. Differential abundance analysis of proteins extracted from miR-183 overexpressing versus control transfected BE(2)-C cells at 72 hours.

•

Supplementary Table S-2. Identifications and relative quantifications for proteins that exhibit statistically-significant differences in quantity.

•

Supplementary Figure S-1. Principal component analysis (PCA) displaying the influence of enforced miR-183 expression on BE(2)-C neuroblastoma cells.

•

Supplementary Figure S-2. Enforced miR-183 expression induces significant protein expression changes in neuroblastoma cells.

Acknowledgements The authors wish to thank Markus Sohn for excellent technical assistance, and Kathy Astrahantseff for comments on and editing of the manuscript. REFERENCES 1.

2. 3.

4. 5. 6.

7.

Chien, C. H.; Sun, Y. M.; Chang, W. C.; Chiang-Hsieh, P. Y.; Lee, T. Y.; Tsai, W. C.; Horng, J. T.; Tsou, A. P.; Huang, H. D., Identifying transcriptional start sites of human microRNAs based on high-throughput sequencing data. Nucleic Acids Res 2011, 39, (21), 9345-56. Ozsolak, F.; Poling, L. L.; Wang, Z.; Liu, H.; Liu, X. S.; Roeder, R. G.; Zhang, X.; Song, J. S.; Fisher, D. E., Chromatin structure analyses identify miRNA promoters. Genes Dev 2008, 22, (22), 3172-83. Lodrini, M.; Oehme, I.; Schroeder, C.; Milde, T.; Schier, M. C.; Kopp-Schneider, A.; Schulte, J. H.; Fischer, M.; De Preter, K.; Pattyn, F.; Castoldi, M.; Muckenthaler, M. U.; Kulozik, A. E.; Westermann, F.; Witt, O.; Deubzer, H. E., MYCN and HDAC2 cooperate to repress miR-183 signaling in neuroblastoma. Nucleic Acids Res 2013, 41, (12), 6018-33. Yoshino, H.; Seki, N.; Itesako, T.; Chiyomaru, T.; Nakagawa, M.; Enokida, H., Aberrant expression of microRNAs in bladder cancer. Nat Rev Urol 2013, 10, (7), 396-404. Motoyama, K.; Inoue, H.; Takatsuno, Y.; Tanaka, F.; Mimori, K.; Uetake, H.; Sugihara, K.; Mori, M., Over- and under-expressed microRNAs in human colorectal cancer. Int J Oncol 2009, 34, (4), 1069-75. Bandres, E.; Cubedo, E.; Agirre, X.; Malumbres, R.; Zarate, R.; Ramirez, N.; Abajo, A.; Navarro, A.; Moreno, I.; Monzo, M.; Garcia-Foncillas, J., Identification by Real-time PCR of 13 mature microRNAs differentially expressed in colorectal cancer and non-tumoral tissues. Mol Cancer 2006, 5, 29. Schaefer, A.; Jung, M.; Mollenkopf, H. J.; Wagner, I.; Stephan, C.; Jentzmik, F.; Miller, K.; Lein, M.; Kristiansen, G.; Jung, K., Diagnostic and prognostic implications of microRNA profiling in prostate carcinoma. Int J Cancer 2010, 126, (5), 1166-76.


Page 14 of 27

Page 15 of 27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

8.

9.

10.

11.

12. 13. 14. 15. 16.

17. 18.

19.

20. 21. 22.

23.

24.

25. 26. 27.

28. 29. 30. 31.

32. 33.

34.


Zhang, Q. H.; Sun, H. M.; Zheng, R. Z.; Li, Y. C.; Zhang, Q.; Cheng, P.; Tang, Z. H.; Huang, F., Meta-analysis of microRNA-183 family expression in human cancer studies comparing cancer tissues with noncancerous tissues. Gene 2013, 527, (1), 26-32. Li, J.; Fu, H.; Xu, C.; Tie, Y.; Xing, R.; Zhu, J.; Qin, Y.; Sun, Z.; Zheng, X., miR-183 inhibits TGF-beta1-induced apoptosis by downregulation of PDCD4 expression in human hepatocellular carcinoma cells. BMC Cancer 2010, 10, 354. Dahiya, N.; Sherman-Baust, C. A.; Wang, T. L.; Davidson, B.; Shih Ie, M.; Zhang, Y.; Wood, W., 3rd; Becker, K. G.; Morin, P. J., MicroRNA expression and identification of putative miRNA targets in ovarian cancer. PLoS One 2008, 3, (6), e2436. Shimono, Y.; Zabala, M.; Cho, R. W.; Lobo, N.; Dalerba, P.; Qian, D.; Diehn, M.; Liu, H.; Panula, S. P.; Chiao, E.; Dirbas, F. M.; Somlo, G.; Pera, R. A.; Lao, K.; Clarke, M. F., Downregulation of miRNA-200c links breast cancer stem cells with normal stem cells. Cell 2009, 138, (3), 592-603. Zhu, J.; Feng, Y.; Ke, Z.; Yang, Z.; Zhou, J.; Huang, X.; Wang, L., Down-regulation of miR-183 promotes migration and invasion of osteosarcoma by targeting Ezrin. Am J Pathol 2012, 180, (6), 2440-51. Wang, G.; Mao, W.; Zheng, S., MicroRNA-183 regulates Ezrin expression in lung cancer cells. FEBS Lett 2008, 582, (25-26), 3663-8. Li, G.; Luna, C.; Qiu, J.; Epstein, D. L.; Gonzalez, P., Targeting of integrin beta1 and kinesin 2alpha by microRNA 183. J Biol Chem 2010, 285, (8), 5461-71. Rozzo, C.; Chiesa, V.; Caridi, G.; Pagnan, G.; Ponzoni, M., Induction of apoptosis in human neuroblastoma cells by abrogation of integrin-mediated cell adhesion. Int J Cancer 1997, 70, (6), 688-98. Wellner, U.; Schubert, J.; Burk, U. C.; Schmalhofer, O.; Zhu, F.; Sonntag, A.; Waldvogel, B.; Vannier, C.; Darling, D.; zur Hausen, A.; Brunton, V. G.; Morton, J.; Sansom, O.; Schuler, J.; Stemmler, M. P.; Herzberger, C.; Hopt, U.; Keck, T.; Brabletz, S.; Brabletz, T., The EMT-activator ZEB1 promotes tumorigenicity by repressing stemnessinhibiting microRNAs. Nat Cell Biol 2009, 11, (12), 1487-95. Cui, H.; Hu, B.; Li, T.; Ma, J.; Alam, G.; Gunning, W. T.; Ding, H. F., Bmi-1 is essential for the tumorigenicity of neuroblastoma cells. Am J Pathol 2007, 170, (4), 1370-8. Tanaka, H.; Sasayama, T.; Tanaka, K.; Nakamizo, S.; Nishihara, M.; Mizukawa, K.; Kohta, M.; Koyama, J.; Miyake, S.; Taniguchi, M.; Hosoda, K.; Kohmura, E., MicroRNA-183 upregulates HIF-1alpha by targeting isocitrate dehydrogenase 2 (IDH2) in glioma cells. J Neurooncol 2013, 111, (3), 273-83. Kim, S. J.; Yune, T. Y.; Han, C. T.; Kim, Y. C.; Oh, Y. J.; Markelonis, G. J.; Oh, T. H., Mitochondrial isocitrate dehydrogenase protects human neuroblastoma SH-SY5Y cells against oxidative stress. J Neurosci Res 2007, 85, (1), 139-52. Schmitt, M.; Pawlita, M., High-throughput detection and multiplex identification of cell contaminations. Nucleic Acids Res 2009, 37, (18), e119. Castro, F.; Dirks, W. G.; Fahnrich, S.; Hotz-Wagenblatt, A.; Pawlita, M.; Schmitt, M., High-throughput SNP-based authentication of human cell lines. Int J Cancer 2013, 132, (2), 308-14. Deubzer, H. E.; Ehemann, V.; Westermann, F.; Heinrich, R.; Mechtersheimer, G.; Kulozik, A. E.; Schwab, M.; Witt, O., Histone deacetylase inhibitor Helminthosporium carbonum (HC)-toxin suppresses the malignant phenotype of neuroblastoma cells. Int J Cancer 2008, 122, (8), 1891-900. Vizcaino, J. A.; Csordas, A.; Del-Toro, N.; Dianes, J. A.; Griss, J.; Lavidas, I.; Mayer, G.; Perez-Riverol, Y.; Reisinger, F.; Ternent, T.; Xu, Q. W.; Wang, R.; Hermjakob, H., 2016 update of the PRIDE database and its related tools. Nucleic Acids Res 2016, 44, (D1), D447-56. Cox, J.; Hein, M.Y.; Luber, C.A.; Paron, I.; Nagaraj, N.; Mann, M., Accurate proteome-wide label-free quantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ. Mol Cell Proteomics 2014, 13, (9), 2513-26. Tusher, V. G.; Tibshirani, R.; Chu, G., Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A 2001, 98, (9), 5116-21. Benjamini, Y.; Hochberg, Y., Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing Journal of the Royal Statistical Society. Series B (Methodological) 1995, 57, (1), 289-300. Paraskevopoulou, M. D.; Georgakilas, G.; Kostoulas, N.; Reczko, M.; Maragkakis, M.; Dalamagas, T. M.; Hatzigeorgiou, A. G., DIANA-LncBase: experimentally verified and computationally predicted microRNA targets on long non-coding RNAs. Nucleic Acids Res 2013, 41, (Database issue), D239-45. Enright, A. J.; John, B.; Gaul, U.; Tuschl, T.; Sander, C.; Marks, D. S., MicroRNA targets in Drosophila. Genome Biol 2003, 5, (1), R1. Dweep, H.; Gretz, N., miRWalk2.0: a comprehensive atlas of microRNA-target interactions. Nat Methods 2015, 12, (8), 697. Chen, K.; Rajewsky, N., Natural selection on human microRNA binding sites inferred from SNP data. Nat Genet 2006, 38, (12), 1452-6. Miranda, K. C.; Huynh, T.; Tay, Y.; Ang, Y. S.; Tam, W. L.; Thomson, A. M.; Lim, B.; Rigoutsos, I., A patternbased method for the identification of MicroRNA binding sites and their corresponding heteroduplexes. Cell 2006, 126, (6), 1203-17. Agarwal, V.; Bell, G. W.; Nam, J. W.; Bartel, D. P., Predicting effective microRNA target sites in mammalian mRNAs. Elife 2015, 4. Szklarczyk, D.; Franceschini, A.; Wyder, S.; Forslund, K.; Heller, D.; Huerta-Cepas, J.; Simonovic, M.; Roth, A.; Santos, A.; Tsafou, K. P.; Kuhn, M.; Bork, P.; Jensen, L. J.; von Mering, C., STRING v10: protein-protein interaction networks, integrated over the tree of life. Nucleic Acids Res 2015, 43, (Database issue), D447-52. Das, M.; Singh, S.; Pradhan, S.; Narayan, G., MCM Paradox: Abundance of Eukaryotic Replicative Helicases and Genomic Integrity. Mol Biol Int 2014, 2014, 574850.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

35. 36.

37. 38.

39. 40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

53.

54.

55.


Bell, S. D.; Botchan, M. R., The minichromosome maintenance replicative helicase. Cold Spring Harb Perspect Biol 2013, 5, (11), a012807. Gonzalez, M. A.; Pinder, S. E.; Callagy, G.; Vowler, S. L.; Morris, L. S.; Bird, K.; Bell, J. A.; Laskey, R. A.; Coleman, N., Minichromosome maintenance protein 2 is a strong independent prognostic marker in breast cancer. J Clin Oncol 2003, 21, (23), 4306-13. Kobierzycki, C.; Pula, B.; Wojnar, A.; Podhorska-Okolow, M.; Dziegiel, P., Tissue microarray technique in evaluation of proliferative activity in invasive ductal breast cancer. Anticancer Res 2012, 32, (3), 773-7. Obermann, E. C.; Went, P.; Zimpfer, A.; Tzankov, A.; Wild, P. J.; Stoehr, R.; Pileri, S. A.; Dirnhofer, S., Expression of minichromosome maintenance protein 2 as a marker for proliferation and prognosis in diffuse large B-cell lymphoma: a tissue microarray and clinico-pathological analysis. BMC Cancer 2005, 5, 162. Liu, M.; Li, J. S.; Tian, D. P.; Huang, B.; Rosqvist, S.; Su, M., MCM2 expression levels predict diagnosis and prognosis in gastric cardiac cancer. Histol Histopathol 2013, 28, (4), 481-92. Rodins, K.; Cheale, M.; Coleman, N.; Fox, S. B., Minichromosome maintenance protein 2 expression in normal kidney and renal cell carcinomas: relationship to tumor dormancy and potential clinical utility. Clin Cancer Res 2002, 8, (4), 1075-81. Szelachowska, J.; Dziegiel, P.; Jelen-Krzeszewska, J.; Jelen, M.; Matkowski, R.; Pomiecko, A.; Spytkowska, B.; Jagas, M.; Gisterek, I.; Kornafel, J., Mcm-2 protein expression predicts prognosis better than Ki-67 antigen in oral cavity squamocellular carcinoma. Anticancer Res 2006, 26, (3B), 2473-8. Kato, H.; Miyazaki, T.; Fukai, Y.; Nakajima, M.; Sohda, M.; Takita, J.; Masuda, N.; Fukuchi, M.; Manda, R.; Ojima, H.; Tsukada, K.; Asao, T.; Kuwano, H., A new proliferation marker, minichromosome maintenance protein 2, is associated with tumor aggressiveness in esophageal squamous cell carcinoma. J Surg Oncol 2003, 84, (1), 2430. Chatrath, P.; Scott, I. S.; Morris, L. S.; Davies, R. J.; Rushbrook, S. M.; Bird, K.; Vowler, S. L.; Grant, J. W.; Saeed, I. T.; Howard, D.; Laskey, R. A.; Coleman, N., Aberrant expression of minichromosome maintenance protein-2 and Ki67 in laryngeal squamous epithelial lesions. Br J Cancer 2003, 89, (6), 1048-54. Lee, Y. S.; Ha, S. A.; Kim, H. J.; Shin, S. M.; Kim, H. K.; Kim, S.; Kang, C. S.; Lee, K. Y.; Hong, O. K.; Lee, S. H.; Kwon, H. S.; Cha, B. Y.; Kim, J. W., Minichromosome maintenance protein 3 is a candidate proliferation marker in papillary thyroid carcinoma. Exp Mol Pathol 2010, 88, (1), 138-42. Kikuchi, J.; Kinoshita, I.; Shimizu, Y.; Kikuchi, E.; Takeda, K.; Aburatani, H.; Oizumi, S.; Konishi, J.; Kaga, K.; Matsuno, Y.; Birrer, M. J.; Nishimura, M.; Dosaka-Akita, H., Minichromosome maintenance (MCM) protein 4 as a marker for proliferation and its clinical and clinicopathological significance in non-small cell lung cancer. Lung Cancer 2011, 72, (2), 229-37. Kelly, J. D.; Dudderidge, T. J.; Wollenschlaeger, A.; Okoturo, O.; Burling, K.; Tulloch, F.; Halsall, I.; Prevost, T.; Prevost, A. T.; Vasconcelos, J. C.; Robson, W.; Leung, H. Y.; Vasdev, N.; Pickard, R. S.; Williams, G. H.; Stoeber, K., Bladder cancer diagnosis and identification of clinically significant disease by combined urinary detection of Mcm5 and nuclear matrix protein 22. PLoS One 2012, 7, (7), e40305. Gakiopoulou, H.; Korkolopoulou, P.; Levidou, G.; Thymara, I.; Saetta, A.; Piperi, C.; Givalos, N.; Vassilopoulos, I.; Ventouri, K.; Tsenga, A.; Bamias, A.; Dimopoulos, M. A.; Agapitos, E.; Patsouris, E., Minichromosome maintenance proteins 2 and 5 in non-benign epithelial ovarian tumours: relationship with cell cycle regulators and prognostic implications. Br J Cancer 2007, 97, (8), 1124-34. Zheng, T.; Chen, M.; Han, S.; Zhang, L.; Bai, Y.; Fang, X.; Ding, S. Z.; Yang, Y., Plasma minichromosome maintenance complex component 6 is a novel biomarker for hepatocellular carcinoma patients. Hepatol Res 2014, 44, (13), 1347-56. Nishihara, K.; Shomori, K.; Fujioka, S.; Tokuyasu, N.; Inaba, A.; Osaki, M.; Ogawa, T.; Ito, H., Minichromosome maintenance protein 7 in colorectal cancer: implication of prognostic significance. Int J Oncol 2008, 33, (2), 24551. Fujioka, S.; Shomori, K.; Nishihara, K.; Yamaga, K.; Nosaka, K.; Araki, K.; Haruki, T.; Taniguchi, Y.; Nakamura, H.; Ito, H., Expression of minichromosome maintenance 7 (MCM7) in small lung adenocarcinomas (pT1): Prognostic implication. Lung Cancer 2009, 65, (2), 223-9. Tamura, T.; Shomori, K.; Haruki, T.; Nosaka, K.; Hamamoto, Y.; Shiomi, T.; Ryoke, K.; Ito, H., Minichromosome maintenance-7 and geminin are reliable prognostic markers in patients with oral squamous cell carcinoma: immunohistochemical study. J Oral Pathol Med 2010, 39, (4), 328-34. Lau, K. M.; Chan, Q. K.; Pang, J. C.; Li, K. K.; Yeung, W. W.; Chung, N. Y.; Lui, P. C.; Tam, Y. S.; Li, H. M.; Zhou, L.; Wang, Y.; Mao, Y.; Ng, H. K., Minichromosome maintenance proteins 2, 3 and 7 in medulloblastoma: overexpression and involvement in regulation of cell migration and invasion. Oncogene 2010, 29, (40), 5475-89. Shohet, J. M.; Hicks, M. J.; Plon, S. E.; Burlingame, S. M.; Stuart, S.; Chen, S. Y.; Brenner, M. K.; Nuchtern, J. G., Minichromosome maintenance protein MCM7 is a direct target of the MYCN transcription factor in neuroblastoma. Cancer Res 2002, 62, (4), 1123-8. Honeycutt, K. A.; Chen, Z.; Koster, M. I.; Miers, M.; Nuchtern, J.; Hicks, J.; Roop, D. R.; Shohet, J. M., Deregulated minichromosomal maintenance protein MCM7 contributes to oncogene driven tumorigenesis. Oncogene 2006, 25, (29), 4027-32. Koppen, A.; Ait-Aissa, R.; Koster, J.; van Sluis, P. G.; Ora, I.; Caron, H. N.; Volckmann, R.; Versteeg, R.; Valentijn, L. J., Direct regulation of the minichromosome maintenance complex by MYCN in neuroblastoma. Eur J Cancer 2007, 43, (16), 2413-22.


Page 16 of 27

Page 17 of 27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TABLES Table 1. Enriched annotation categories. Category column

Category value

Enrichment factor

P value

P value after FDR correction

SMART GOBP

Minichromsome maintenance∗ DNA geometric change∗

13.9 8.1

1.2E-07 4.3E-06

2.9E-05 0.0011

KEGG KEGG

DNA replication∗ Hypertrophic cardiomyopathy

8.1 7.0

4.3E-06 0.0003

0.00097 0.011

KEGG KEGG

Dilated cardiomyopathy

7.0 6.4

0.0003 0.00012

0.013 0.0068

KEGG KEGG

Cell cycle - yeast∗ Cell cycle∗ RNA metabolic process

5.7 5.1

7.5E-05 6.3E-05

0.0056 0.0071

0.5

0.00022

0.03

GOBP ∗

Meiosis - yeast∗

Value contains the six MCM proteins, MCM2 – MCM7.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 27


Table 2. All members of the MCM complex are significantly down-regulated upon enforced miR-183 expression in BE(2)-C cells. Protein

Gene

Intensity ratio miR-183/control

P value t-test

DNA replication licensing factor MCM2 DNA replication licensing factor MCM3

MCM2 MCM3

0.62 0.64

3.89E-04 3.40E-06

DNA replication licensing factor MCM4

MCM4

0.62

9.31E-06


MCM5

0.60

3.11E-05


MCM6

0.57

5.41E-07


MCM7

0.58

1.44E-08


Page 19 of 27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


FIGURE LEGENDS Figure 1. Work flow and experimental scheme aiming at the identification of miR-183 regulated proteins in BE(2)-C neuroblastoma cells upon enforced expression of miR-183 versus negative control (NC) transfection using (i) tryptic digestion, (ii) liquid chromatography (LC) mass spectrometry (MS) and (iii) MS map alignment. Six independent biological samples per group were individually processed and measured. Figure 2. Overview of proteome data. (A) Flow chart showing both the overall number of proteins identified and the number of differentially expressed proteins in BE(2)-C cells upon enforced expression of miR-183 for 72 hours (n = 6 per group; FDR < 1%). (B) Volcano plot representing all proteins identified. The x axis of the volcano plot shows the relative difference in protein abundance as calculated by the SAM method, and the y axis shows the log t-test P value of the group-wise comparison of protein abundances. Squares and circles represent individual proteins. Proteins symbolized by blue circles showed a significant miR183 induced abundance change (P < 0.05). Minichromosome maintenance (MCM) proteins 27 are highlighted in red as the term “MCM proteins” was strongly enriched in the protein annotation analysis SMART. Figure 3. Network diagram of miR-183 regulated proteins in BE(2)-C neuroblastoma cells highlighting potential critical nodes as identified by enrichment analysis using the STRING10 program. Figure 4. Western blot analyses confirm down-regulation of MCM3 and MCM5 expression upon miR-183 enforced expression. (A) BE(2)-C and (B) Kelly cells were transiently transfected with negative control (NC) or miR-183 in three biological replicates, and MCM3 and -5 protein levels were measured at 72 hours by western blot analysis. Histone H3 served as a loading control. ImageJ quantification is shown below the representative blots (mean ± SD, n = 3). *P < 0.05; **P < 0.01. 19 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. MCM3 and MCM5 are direct miR-183 targets. BE(2)-C cells were transfected with negative control (NC) or miR-183 and, 24 hours later, with dual-luciferase reporter constructs containing either the complete wildtype 3′-UTRs of MCM3 (A) and MCM5 (B) (miR-183 target sites visualized by microna.org; upper panel) or the 3′-UTRs with the mutated miR-183 seed sequence (nucleotides 2-7; red). Firefly and Renilla luciferase activities were measured 72 hours after miR-183 and 48 hours after plasmid transfection (mean ± SD, n ≥ 4). *P < 0.05; ***P < 0.001. Figure 6. Schematic model summarizing the opposing effects of MYCN and miR-183 on the MCM complex in neuroblastoma cells. Dashed lines, inhibitory effects; continuous green lines, transcriptional activation; continuous black lines, physical interaction.


Page 20 of 27

Page 21 of 27


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For TOC only



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 27

Lodrini et al.

Figure 1

NC

miR-183 BE(2)-C HDAC2

MYCN

miR-183

?

?

?

X

tryptic peptides

?

? ?

?

?

LC-MS/MS ? ?

? peptide identification

NC

miR-183

NC

X MS map alignment

peak intensity

ACS Paragon Plus Environment

? ?

miR-183

>

X

protein X

Page 23 of 27

Lodrini et al.

Figure 2

B

A

8

1185

MCM7

7 identified and quantified proteins

85 differentially expressed proteins

- log t-test P value

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


significantly regulated not regulated

MCM6

6

MCM4 MCM3

5

MCM5

4 MCM2

3 2 1 0

50 proteins

35 proteins

-4

-3 -2 -1 0 1 2 relative difference in regulation


3

Lodrini et al. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


activation inhibition binding phenotype catalysis post-translational modification reaction expression


Figure 3 Page 24 of 27

Lodrini Page 25 ofet 27al.

A

B

BE(2)-C NC

miR-183

Kelly NC

miR-183 MCM3

MCM5

H3

relative protein levels

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4


*

**

**

*

MCM3

MCM5

MCM3

MCM5

1.0

0.5

0


NC miR-183

Lodrini et al.

A

B

hsa-miR-183

3‘ UCACUUAAGAUGGUCACGGUAU 5‘

MCM3 3‘UTR wildtype 170: 5‘ AUGGGUCAUGAAAGCUGCCAUG 3‘ mutated 5‘ AUGGGUCAUGAAAGCACGGTAG 3‘

3‘ UCACUUAAGAUGGUCACGGUAU 5‘

hsa-miR-183 MCM5 3‘UTR wildtype mutated

45: 5‘ CCUCCUGCCGCUGCCUGCCAUU 3‘ 5‘ CCUCCUGCCGCUGCCACGGTAU 3‘

NC miR-183

***

NC miR-183

relative luciferase activity (%)

relative luciferase activity (%)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5 Page 26 of 27


100

50

0

* 100

50

0 wildtype

mutated

MCM3 3‘UTR

wildtype

mutated

MCM5 3‘UTR


Lodrini Page 27 ofet 27al. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 6


MYCN

HDAC2 miR-183

MCM2

MCM7

MCM3

MCM6

MCM4

MCM5

Initiation of DNA replication


Minichromosome Maintenance Complex Is a ... - ACS Publications

Recommend Documents