Mitochondrial Surface Engineering for Multidrug Resistance Reversal

Subscriber access provided by UNIV AUTONOMA DE COAHUILA UADEC

Communication

Mitochondrial Surface Engineering for Multidrug Resistance Reversal wei chen, Kun Shi, Bingyang Chu, Xiawei Wei, and Zhiyong Qian Nano Lett., Just Accepted Manuscript • DOI: 10.1021/acs.nanolett.8b05188 • Publication Date (Web): 02 Apr 2019 Downloaded from http://pubs.acs.org on April 2, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Mitochondrial Surface Engineering for Multidrug Resistance Reversal Wei Chen , Kun Shi, Bingyang Chu, Xiawei Wei*, Zhiyong Qian*

State Key Laboratory of Biotherapy and Cancer Center, West China Hospital, Sichuan University and Collaborative Innovation Center for Biotherapy, Chengdu 610041, People’s Republic of China

*Corresponding authors: [email protected] (Wei XW), [email protected] (Qian ZY) Tel: +86- 028-85502796

ACS Paragon Plus Environment

1

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 41

ABSTRACT: Multidrug resistance (MDR) is still a formidable obstacle for the majority of anticancer drugs during chemotherapy. MDR is generally divided into the pump and non-pump

resistances,

which

significantly

and

simultaneously

reduce

drug

accumulation and potency in various cancer cells. In order to concurrently combat the two pathways to completely overcome MDR, a novel siRNA-containing nanomaterialcoated mitochondria complex was developed, which can overcome the barrier of activity lose and electrostatic repulsion to effectively deliver siRNA and mitochondria into the MDR cells. In this way, the functional siRNA could successfully down-regulate pump resistance-related proteins while the transplanted mitochondria efficaciously played its role to improve apoptotic signal activation and transmissions by means of restoring intracellular metabolism environment. We believe this unique organelle-material complex would hold great promise to reverse overall MDR as a result of high spatialtemporal synchronization of potent synthetic and living species.


2

Page 3 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

KEYWORDS: mitochondrial dysfunction • organelle transplantation • MDR reversal • layer-by-layer assembly • RNA interference


3

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 41

Despite the advances in the development of various novel powerful drugs for cancer therapy, the efficiency of clinical chemotherapy still remains poor and unsatisfactory.1 One of the most significant obstacles to the effective pharmacological treatment remains in the intrinsic or acquired resistance of cancer cells to a wide spectrum of structurally and functionally distinct drugs, which is termed as multidrug resistance (MDR).2 Generally, MDR can be divided into two distinct types, pump and non-pump resistances.3-7 The pump resistance arises from overexpression of specific resistance proteins that act as membrane-bound adenosine triphosphate (ATP)dependent active drug efflux pumps to reduce intracellular drug accumulation.8-11 Membrane proteins, ABCB1 (P-glycoprotein (Pgp), MDR1), ABCC1 (multidrug resistance-associated protein, MRP1) and ABCG2 (breast cancer resistance protein, BCRP) have proven to be the main players for pump resistance to diverse anticancer drugs (e.g. doxorubicin, mitoxantrone, paclitaxel and so on).8-11 Meanwhile, the main mechanism of non-pump resistance is the activation of cellular anti-apoptotic defense, mainly associated with mitochondrial dysfunction.12,13 For instance, BCL-2 or BCL-XL proteins, which are mainly found in the inner membrane of mitochondrial, are always


4

Page 5 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

overexpressed and effectively act against cell apoptosis through suppressing the mitochondrial release of cytochrome C and other apoptosis-inducing factors (AIF).14,15 Unfortunately, the two resistant mechanisms are often simultaneously activated and are responsible for the ineffectiveness of most traditional drugs and final failure of clinical chemotherapy. Currently, there is a surge of interest in developing novel small molecular inhibitors or nucleic acid sequences to suppress MDR.16,17 It should be noted that most attempts mainly focus on pump resistance because the structure and function of ABC transports have been extensively studied, which may serve as the specific target for drug design. However, an increasing number of researchers have realized that simply increasing intracellular drug concentration by combating pump resistance is not sufficient to significantly enhance drug sensitivity, and high drug accumulation could not always induce high-level apoptosis.3,7 This should be attributed to intracellular antiapoptotic defense mechanism in which mitochondrial dysfunction plays an important role by altering metabolism environment in cancer cells.12,13 It has been investigated that multiple alterations in mitochondrial content, activity, structure, and function occur in


5

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 41

resistant cancer cells, which are involved in inhibition of apoptosis-related pathway activation due to the reduced mitochondrial membrane permeability to apoptosisinducing

factors

(e.g.

cytochrome

C).18

Although

the

exact

mechanism

of

mitochondrion-mediated non-pump resistance is still under investigation, an alternative strategy, mitochondrial transplantation has been proposed to re-establish the intracellular apoptotic pathway to enhance drug sensitivity and reverse MDR.19,20 Mitochondrial transplantation is currently being explored as means to repair and restore proper organelle function in a variety of inherited and acquired disorders of energy metabolism, which mainly apply direct injection of donor mitochondria into target cells or tissues.21 In order to employ this technique to regulate cellular metabolism, cell internalization is the key point as the mitochondrial membrane is rather negatively charged (-150 to -180 mV), 22 which hinders its spontaneous uptake by cancer cells due to the repulsion between the negative mitochondrial and cell membrane.23 Therefore, a rationally artificial intervene may be introduced to improve mitochondrion-cell interaction to optimize organelle transfer-based strategies.


6

Page 7 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

To modify the mitochondria with minimum disturbance to its inherent bioactivity, layer-by-layer (LbL) technique is an appropriate choice as it allows fabricating diverse polyelectrolytes on numerous surfaces, ranging from various nanomaterial to living organisms.24 After the interaction between negatively charged mitochondrial membrane surface and positively charged polyelectrolytes, the surface potential of mitochondria effortlessly reverses to be positive due to the shielding effect of the polycations. Afterward, a polyanion can be easily anchored onto the surface through electrostatic attractions to continually edit the mitochondrial surface. After certain cycles of deposition and adsorption with oppositely charged polyelectrolytes, a thick-tunable multilayer structure can be generated to tailor its surface to endow mitochondria with a novel artificial exterior, which may enhance its tolerance to the harsh extracellular environment and direct its internalization in target cancer cells. Moreover, in order to concurrently fight mitochondrion-mediated non-pump resistance and typical pump resistance, RNA intervene (RNAi) can be easily applied by integrating specific siRNA (Pgp siRNA) into multiple polymer layers owing to the electrostatic interactions between the nucleic acid molecule and polycations during LbL process.25 The constructed


7

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

system could effectively deliver the encapsulated siRNA

Page 8 of 41

molecules into particular

cancer cells and spontaneously released them in cytoplasm accompanying with polymer layer dissociation, which is mainly resulted from charge neutralization on polymer chains in intracellular ion-rich environments.26 Afterward, siRNA might specifically suppress the expression of ABC transporter by means of formation of RNAinduced silencing complex to overturn pump resistance. Besides, the transplanted healthy mitochondria would restore metabolic abnormality induced by mitochondrial dysfunction, and re-establish the drug-triggered apoptotic pathway to defeat non-pump resistance. In such a way, it is reasonably anticipated that with the help of simultaneous inhibition of drug extrusion and the anti-apoptotic pathway by co-delivery of specific nucleic acid sequence and bio-sourced organelles, the challenging MDR would be overall circumvented as a result of high spatial-temporal synchronization of potent synthetic and living species (Figure 1).


8

Page 9 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Figure 1. Scheme of siRNA-containing nanomaterial-coated mitochondria (NC/siRNA-Mi) synergistically overcoming pump and non-pump drug resistances. After surface modification, the isolated mitochondria could bypass the electrostatic repulsion-based barrier to effectively enter the MDR cancer cells to re-active the drug-induced apoptotic pathway. Besides, the polymer layer-encapsulated siRNA could be largely internalized in the cells and released in the cytoplasm to act as an inhibitor to Pgp proteins. In this way, drug accumulation and potency could be simultaneously enhanced, suggesting that the promising combination of synthetic material and living species may serve as a high potential candidate to combat formidable MDR.


9

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 41

In order to evaluate the MDR reversal effect of the NC/siRNA-Mi complex, drugresistant human breast cancer cell MCF-7/ADR was selected as an ideal model as it has proven to exhibit serious mitochondrial dysfunction and Pgp overexpression.20,27 Meanwhile, non-tumorigenic breast epithelial cell line MCF-12A was chosen as the source of the healthy mitochondria, which maintains the most functions of the organelles and always served as a “normal” cell model.28 Before isolating mitochondria from MCF-12A, a MitoTracer Deep Red probe was applied to label the mitochondria inside the cells. After detecting a steady and evident red fluorescence inside the cells (Figure S1a), the MCF-12A cells were immediately lysed and the mitochondria were subsequently isolated following the standard protocol. In the final suspension (around 4 mg/ml, 6.4×105 mitochondria/ml), the red pellets showed clear red emission, indicated the successful extraction of mitochondria (Figure S1b). The isolated mitochondria were quantitated by using Bio-Rad protein assay kit (Figure S2), and were either directed used immediately or stored at -80 oC for a month. The size of isolated mitochondria was from 500 to 1500 nm (Figure 2a) according to the dynamic light scattering (DLS)


10

Page 11 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

analysis, which may act as nanoscale vehicles to move and transport in the biological environment. It should be noted that free mitochondria showed a negatively charged surface potential (~-24.7 mV, Figure 2b), which may compromise the spontaneous cell internalization process owing to the electrostatic repulsion between mitochondrial and plasma membrane. Moreover, a JC-1 dye was often used to detect the integrity of the isolated mitochondria through testing the electrochemical proton gradient of the inner mitochondrial membrane.29 The purified mitochondria showed aggregation of JC-1 dye (signal can be measured at Ex/Em=530/590 nm) whose intensity could be reduced as a result of membrane potential dissipation by 100 µM Antimycin A (Figure 2c), suggesting most of the mitochondria maintained the intact membrane structures and charges. In order to alter the surface property of the mitochondria to mediate its interaction with cancer cells, an LbL technique was introduced to construct an exterior nanomaterial coat in a thick-controllable and charge-tunable fashion

(Figure 2d). Notably, after

screening various positively and negatively charged polyelectrolytes, chitosan and polyacrylic acid (PAA) were elected as the ideal candidate for surface engineering due to their high compatibility to mitochondria membrane integrity (Figure S3) and low


11

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 41

toxicity to the biosystems.30,31 After six rounds of LbL assembly (over six layers reduced mitochondrial integrity, Figure S4), a nanomaterial coat with the thickness of about 45 nm was clearly observed on the surface of treated mitochondria compared to native organelles, which greatly maintained the membrane integrity without obvious deformation and collapse (Figure 2e,f). The protective effect could be furthered confirmed by tetramethylrhodamine (TMRE) staining (another potentiometric dye to detect membrane integrity which is inhibited by carbonyl cyanide m-chlorophenyl hydrazine CCCP) after certain circles of freezing and thawing processes, demonstrating that polymer coating significantly prevented membrane disruption during storage and recovery (Figure S5). When alternative exposure to various polyelectrolytes, the surface potential of the mitochondria could be well regulated with opposite charges between 21.3 and 23.4 mV (Figure 2g), verifying successful coating of each layer. Moreover, the enzyme activity of the treated mitochondria was mainly characterized by measuring the oxygen consumption (ADP-stimulated respiration), and respiratory control index (RCI; state 3/state 4) for malate-induced complex I and succinate-induced complex II. Interestingly, measurements clearly showed that surface engineered mitochondria were


12

Page 13 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

still respiration competent compared with untreated mitochondria, further suggesting that LbL modification highly biocompatible with negligible disturbance to the native bioactivity of the mitochondria (Figure 2h,i). Based on all the investigations, it is indubitable that LbL may serve as a bio-friendly and quite straightforward method to tailor mitochondrial surface with well-designed polyelectrolytes in a controllable and facile way. The constructed nanomaterial-based coat could provide promising protection to improve mitochondria storage without large membrane break and activity lose. Moreover, this novel artificially modified organelle evidently possessed the advantages of synthetic materials and biological species, which may hold great promise to regulate various biological events including cell response, energetic metabolism, drug sensitivity and so on.


13

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 41

Figure 2. Characterization and surface engineering of isolated mitochondria. (a) DLS analysis of the isolated mitochondria. (b) Zeta potential of the isolated mitochondria. (c) Relative fluorescence units (RFU) of JC-1 dye treated mitochondria, which could be remarkably reduced by Antimycin A. (d) Schematic of LbL modification on the mitochondrial surface. TEM images of native (e) and coated (f) mitochondria. (g)


14

Page 15 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Alternative change of the surface potential of the mitochondria during the LbL modification. (h) State 3 (active) oxygen consumption (ADP-stimulated respiration) of treated and native mitochondria. (i) Respiratory control index (RCI; state 3/state 4) for malate-induced complex I and succinate-induced complex II of treated and native mitochondria.

After editing the surface of the isolated mitochondria, it was assumed that its interaction with the cell membrane could be well regulated due to the shield of negative charge by the polymer coat. Meanwhile, in order to evaluate the possibility of simultaneous delivery of mitochondria and siRNA, a FAM labeled siRNA (FAM siRNA) was directly encapsulated in the polymer multilayers of mitochondria during the LbL assembly as a model to assess siRNA delivery efficiency.25 After labeling the mitochondria with MitoTracer Deep Red probe, cell uptake behavior of FAM siRNAcontaining nanomaterial-coated mitochondria (NC/FAM siRNA-Mi) was observed in MCF-7 cells following a chronological order. As shown in Figure 3a, at the initial time of


15

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 41

the treatment (0.5 h), high uptake of NC/FAM siRNA-Mi was detected in every single cell as evidenced by red and green emission inside the cells. Interestingly, red mitochondria and green siRNA signals overlapped to present yellow fluorescence (Figure 3a), suggesting the mitochondria and siRNA were combined together by the polymer coating (corresponded with the proposed structures). After 12 h, it is clear that two emissions gradually separated in the cytoplasm, demonstrating a spontaneous release of siRNA and mitochondria into cells (Figure 3b). This should be attributed to self-disassembly of polyelectrolyte layers resulted from the charge neutralization by the counter ion in the intracellular conditions.32 The disassembling process inside the cells could be directly observed by Bio-TEM, which showed the morphology alteration of NC/FAM siRNA-Mi complex. In the beginning, the complex exhibited relative lower contrast (Figure 3c) due to the low electron density of polymer layers. Gradually, the polymer coat progressively disappeared with the increase of time and partial mitochondria were released from the complex (Figure 3d). After 24 h only free mitochondria could be investigated in the cytoplasm (Figure 3e), which showed clear cristae and membrane structures (high contrast), indicating the integrity of the released


16

Page 17 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

mitochondria. In addition, free mitochondria were rarely internalized in MCF-7 cells as a result of repulsion between the negative cell membrane and mitochondrial surface, further verifying that polymer coating endowed the mitochondria with a new exterior to alter its interaction with biological species (Figure 3f,g). Moreover, free FAM siRNA also could not enter the cancer cell effectively due to its negative charge and susceptibility to the enzyme-rich environment.33 When encapsulated in polymer nano coat, a remarkably increase of cell uptake of FAM siRNA was investigated (Figure 3h), which is consistent with the phenomenon that polymer-based nano carrier may significantly enhance cellular uptake of various nucleic acid molecules.34,35 I1nterestingly, the release rate was layer-dependent with the result that 6 layers showed a slower release compared to thinner layers, and all the polymer coats disassociated within 24 hours (Figure S6). This kind of enhancement was around 10 fold (Figure 3i) similar to that of coated mitochondria (Figure 3g), further testifying the effective co-delivery of dual components at the same time. It should be emphasized that a simple polymer coating through layerby-layer could revolutionarily alter biological behaviors of the isolated mitochondria (cell recognition and internalization). It was believed that this novel strategy opens a window


17

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 41

to extend the application of mitochondrial translation by achieving spontaneous and effective cell uptakes, largely improving current approaches to mediate intracellular metabolism environment.

.


18

Page 19 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Figure 3. Cell internalization of the NC/FAM siRNA-Mi complex. Fluorescence images of NC/FAM siRNA-Mi treated MCF-7 cells at 0.5 h (a) and 12 h (b). White arrows indicated the overlapped and separated signals. Bio-TEM observation of gradual dissociation of polymer coat from NC/FAM siRNA-Mi complex in the cells at 0.5 h (c), 6 h (d) and 24 h (e). Pink arrows indicated the NC/FAM siRNA-Mi complex and released mitochondria. Flow cytometry (f) and statistical analysis (g) of mitochondria uptake in MCF-7 cells. Flow cytometry (h) and statistical analysis (i) of FAM siRNA uptake in MCF-7 cells.

After confirming the feasibility of organelle modification and internalization regulation, we tested the influence of the NC/siRNA-Mi complex on drug sensitivity in the MDR cancer cells. As shown in Figure 4a,b, compared with drug-sensitive MCF-7 cells, MCF7/ADR cells exhibited obvious high Pgp expression according to RT-PCR and western blot analysis (Figure S7). Free Pgp siRNA showed negligible influence on Pgp expression due to its low uptake (Figure 4a,b and Figure S7). Notably, Pgp siRNAcontaining nanomaterial-coated mitochondria (NC/Pgp siRNA-Mi) induced pregnant


19

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 41

decrease (~80.1%) of Pgp expression, which is comparable with commercial lipofectamine 2000 (~89.2%), suggesting that the delivered siRNA remarkably and effectively exert its functions. Moreover, intracellular drug accumulation showed a similar trend that NC/Pgp siRNA-Mi and lipofectamine 2000 could considerably enhance DOX accumulation compared with free siRNA and NC-Mi treatments (Figure 4c). In this way, they could increase the efficacy of the traditional DOX-based chemotherapy to a certain extent (Figure 4d, red, green and purple curves). In addition, the delivery of healthy mitochondria also played a significant role in MDR reversal, especially to nonpump resistance. As indicated from MTT test, NC/Mi could largely enhance the effect of DOX at each concentration (Figure 4d, orange and red curves), while free mitochondria were highly biocompatible to the cells (Figure 4e, grey curve), demonstrating that mitochondrial delivery re-sensitized the MDR cells to the drugs rather than directly killed the cells. Importantly, NC/Pgp siRNA-Mi showed the most potent effect compared to others (Figure 4d) with an IC50 value of 2.044 µM (Figure S8), which was similar to that of DOX-treated MCF-7 cell lines (1.956 µM) (Figure S8). This should be ascribed to the co-delivery of Pgp siRNA and mitochondria, which could synergistically overcome dual


20

Page 21 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

MDR mechanisms to enhancer drug potency (formulation along showed minor toxicity (Figure S9 and Figure S10)). The hypothesis that mitochondrial delivery could improve drug-induced killability in MDR cells was further evaluated by changing the mitochondria number at an indicated DOX concentration. Results evidently revealed that with the increment of delivered mitochondria, the drug turned out to be increasingly effective, further confirming healthy mitochondria enhanced the drug affectability in MDR cells. Notably, the observed effect enhancement by NC/siRNA-Mi could only be obviously observed in MDR cells rather than drug-sensitive MCF-7 cells (Figure S8 and Figure S11). This is mainly attributed to the low Pgp expression and relatively less dysfunctional mitochondria in MCF-7, which guarantee the drug to be effective, further supporting the necessity to down-regulated Pgp protein and restore mitochondrial function in MDR cancer cells. Moreover, it should be emphasized that mitochondria and siRNA were both indispensable to heighten the drug performance, as simply elevating drug accumulation or drug sensitivity was rarely able to induce a satisfactory apoptotic level in the MDR cells (Figure 4f). Only synergistically alleviating drug efflux and


21

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 41

augmenting drug potency could provoke the maximal apoptotic levels to overcome the MDR (Figure 4f).


22

Page 23 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Figure 4. In vitro MDR reversals. (a) Western blot and (b) RT-PCR analysis of Pgp expression after different treatments. Mean ± S.D. (n = 3). ***P < 0.001. (c) Flow cytometry analysis of DOX accumulation after different treatments. (d) Cell viability after different treatments. (e) Cell viability to DOX treatment with a different amount of mitochondria. (f) Apoptotic analysis of MDR cells after different treatments.

After in vitro MDR reversal evaluation, an in vivo impact of NC/Pgp siRNA-Mi was additionally assessed.

It should be noted that microsized

NC/Pgp siRNA-Mi

(around 1 µm) was not suitable for direct intravenous injection due to quick clearance by the

reticuloendothelial

system (RES)

or

uncontrollable

distribution

(e.g.

lung

accumulation).36,37 Aiming to treat superficial tumor (breast cancer), a local injection was an acceptable pathway and could simultaneously guarantee convenience and efficacy of mitochondria-based treatments (i.v. injection of large-sized systems were inefficient (Figure S12)). Following local treatments of different systems (the traditional administrative pathway for mitochondrial transplantation), DOX (2 mg/ml) was injected


23

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 41

from the tail vein to mimic traditional chemotherapy process (Figure 5a). Palpably, free DOX was not able to remarkably delay tumor growth compared with the PBS-treated group (Figure 5b, black and red curves), indicating a successful establishment of the MDR model. Free siRNA treatment could not provide much help (Figure 5b, blue curve) due to its limited internalization and quick degradation in the biological environment. Intriguingly, NC/Mi injection could partially enhance drug performance (Figure 5b, orange curve) as a result of mitochondria uptake and apoptotic activation. However, its effectiveness was still limited owing to its uselessness on pump resistance. Prominently, NC/Pgp siRNA-Mi treatment exhibited the most potent tumor growth inhibition with a tumor growth inhibition (TGI) value of 66.9% (Figure 5b, purple line). This mainly resulted from the synergistic effect of mitochondria and Pgp siRNA, which concurrently improved intracellular apoptotic activation and inhibited drug efflux. Corresponding with

in vivo detection, ex vivo results (final tumor weight) showed a similar trend (Figure 5c), confirming the curative effect of NC/Pgp siRNA-Mi complex. During the treatments, introducing functional siRNA and healthy mitochondria would not induce additional toxicity or other side effects compared to DOX, which could be verified by body weight


24

Page 25 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

change in different groups (Figure 5d). Survival rate measurements further indicated the NC/Pgp siRNA-Mi to be a highly effective and biocompatible system with low mortality relative to others (Figure 5e). Moreover, western blot analysis to the harvested tumors revealed that the delivered siRNA successfully exert its functions to down-regulate Pgp protein in MDR cells, and the transplanted mitochondria efficacously played its role to activate Bax and Caspase 3-based apoptotic pathways (Figure 5f). Statistical analysis (6 tumors) was shown in Figure S13. All the phenomenon corresponding to the in vitro observations suggested NC/Pgp siRNA-Mi a highly potential candidate to circumvent overall MDR in currently and future clinic applications.


25

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 41

Figure 5. In vivo MDR reversals. (a) MDR tumor-bearing mice model was treated with different systems and then administered by DOX. (b) Growth curve of the tumors under different treatments. (c) The weight of harvest tumors after different system treatments. Mean ± S.D. (n = 3). **P < 0.01; ***P < 0.001. (d) Body weight change during different treatments. (e) Survival curves under different treatments. (f) Apoptotic signal detection in treated tumors. G1: Control; G2: DOX; G3: DOX + Pgp siRNA; G4: DOX + NC/Mi; G5: DOX + Lipofectamine Pgp siRNA; G6: DOX + NC/Pgp siRNA-Mi.


26

Page 27 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

In summary, in order to combat challenging MDR to improve clinical chemotherapy, a novel strategy based on organelle modification and RNA intervene was designed to simultaneously overcome pump and non-pump resistances. Inspired by the organelle transplantation, we isolated healthy mitochondria from normal cells and edited its surface through LbL technique, which may significantly regulate its storage and interaction with the surroundings. Moreover, specific siRNA was successfully encapsulated into the polymer multilayer, which could be spontaneously released in the cytoplasm to inhibit pump resistance-related proteins. Meanwhile, the delivery of healthy mitochondria in MDR tumor cells could largely improve apoptotic signal activation and transmission. In such a way, drug accumulation and potency could be significantly and synergistically enhanced. Different from other strategies, this organelle modificationbased strategy opens a new window to apply natural biological species to treat MDR cancers, which has exhibited large potential to control drug sensitivity with acceptable biocompatibility. We believe this unique organelle-material complex would hold great


27

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 41

promise for biomedical applications by combining the advantages of biological components and synthetic materials, which may serve as a potent candidate in more other diseases treatments by providing a high spatial-temporal synchronization.

Mitochondrial

Surface

Modification

and

siRNA

Incorporation.

The

isolated

mitochondria were dispersed in different concentration (0.1, 0.5, 1 mg/mL) of positive polyelectrolytes, respectively. After 2 min incubation, the mitochondria were separated by centrifugation (12,000 × g for 10 minutes), followed by three times wash in PBS. Then the treated mitochondria were dispersed in different concentration (0.1, 0.5, 1 mg/mL) of negative polyelectrolytes for 2 min. After repeat for several circles, the pellets were collected and directed used immediately or stored at -80 oC for a month. To encapsulate siRNA, purified NC/Mi were mixed with a siRNA solution 4 μ M and positive polyelectrolytes (1 mg/mL), followed by centrifugation (12,000 × g for 10 minutes). Aiming to load the sufficient siRNA molecules, this process could be repeated several times. The siRNA-containing NC/siRNA-Mi could be continuously used for LbL assembly under negative and positive polyelectrolyte (1 mg/mL) treatments.


28

Page 29 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Mitochondrial Activity. A Clark-type electrode (Yellow Springs Instruments Co, Yellow Springs, OH) was used to determine Mitochondrial oxygen

38,39.

Briefly, in the presence

of the substrate malate/glutamate (complex I) or succinate (complex II), introducing adenosine diphosphate (ADP) to isolated mitochondria induced a quick oxygen uptake as the ADP was converted into ATP. After calibration, the oxygen consumption was expressed in nmol O2 /min/ mg of protein. The respiratory control index (RCI) was calculated as the ratio of the state 3/state 4.

Cell Uptake. The MCF-7 cells were grown on coverslips to 60% confluence and incubated with NC/FAM siRNA-Mi (containing 1  106 mitochondria and 100 nM siRNA) in DMEM up to 24 hours. After fixing the cells, DAPI was used to stain the nuclei. All the samples were directly investigated under a confocal laser scanning microscope (CLSM) (FV1000, Olympus, Japan). A flow cytometer (Cytomics FC500, Beckman Coulter, USA) was used to quantitatively analysis of drug uptake.


29

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 41

Biological Transmission Electron Microscopy (Bio-TEM). Bio-TEM of MCF-7 cells cultured with NC/FAM siRNA-Mi were performed by negative staining. Briefly, after incubation for different times, the cells were pre-fixed with cell fixing solution, post-fixed with 1% osmium tetroxide, dehydrated with a series of alcohols and infiltrated with resin. The resin sample block was trimmed, thin-sectioned to a thickness of 70 nm and collected on formvar-coated copper grids. Before examining under the TEM, these grids were stained with uranyl acetate and lead citrate. Samples were observed by Philips/FEI CM200 microscope (USA).

Pgp Expression Detection. The expression of Pgp genes in MCF-7 and MCF-7/ADR cell lines was analyzed by qRT-PCR. Cells were incubated separately for 72 h with different systems (DMEM, Pgp siRNA, NC/Pgp siRNA-Mi, Lipofectamine/Pgp siRNA). siRNA concentrations were fixed at 100 nM. After the treatments, A RNeasy Mini Kit (Qiagen, USA) was used to extract the total RNA in the samples. A CX100 Droplet DigitalTM PCR (Bio-Rad, USA) was used to transcript 600 ng RNA into complementary DNA (cDNA). SYBR Premix Ex Taq (Takara, Japan) was applied to analyze the cDNA


30

Page 31 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

(1 μl). A real-time PCR detection system (IQTM5, BioTek, USA) was employed to quantitatively analysis. A 2-∆∆ct method was used to analyze data. GAPDH was chosen as the internal standard. PCR primers: GAPDH-forward, 5’-CCCTTCATTGACCTCAACTACATG-3’; GAPDH-reverse, 5’-TGGGATTTCCATTGATGACAAGC-3’; Pgp -forward, 5’- GACAGGAGATAGGCTGGTTTGA -3’; Pgp -reverse, 5’- GCCACGTGATTCTTCCACAA -3’.

Western Blotting Analysis. After treatments for 72 hours with various systems (DMEM, Pgp siRNA, NC/Pgp siRNA-Mi, Lipofectamine/Pgp siRNA). siRNA concentrations were fixed at 100 nM, MCF-7/ADR cells (around 4×106) were washed three times with PBS. Then 50 μl lysis buffer supplemented with Roche’s Complete Protease Inhibitor Cocktail Tablets was used to treat the cells. 12% SDS-PAGE electrophoresis was used to separate the cellular proteins (50 μg). After transferring onto nitrocellulose filter membranes (Millipore, USA). 5% bovine serum albumin (BSA) solution was applied to


31

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 41

block non-specific binding sites. The samples were then treated by the monoclonal antibody against GAPDH, Pgp (1:1000, Santa Cruz, USA), following by horse radish peroxidase (HRP) conjugated goat anti-mouse antibody (1:10000, Santa Cruz, USA). An enhanced chemiluminescence (ECL) system (Thermo, USA) was used to detect signals.

Cell Viability. 2-(4,5)-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to evaluate the cytotoxicity. Briefly, MCF-7 or MCF-7/ADR cells (104 cells/well) were seeded in 96-well plates and incubated for 24 hours. Then the cells were treated by different systems (DOX, DOX + Pgp siRNA, DOX+ NC/Mi, DOX + Lipofectamine/Pgp siRNA and DOX + NC/Pgp siRNA-Mi) with different concentrations for 72-hour incubation. If the treatments contained siRNA, the dose was adjusted to 100 nM. After treatment by MTT assay (5 mg/ml, 4h), a Bio-Rad Microplate Reader (Hercules, CA, USA) was applied to measure the absorbance at 550 nm. The SPSS 16.0 software was used to calculate the half maximal inhibitory concentration value


32

Page 33 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

(IC50). Moreover, to test the relationship of mitochondria number and drug sensitivity, MCF-7/ADR cells were cultured with fixed DOX concentration and (0, 0.5 and 2 µM) with different mitochondria number. Cell viability was measured by the same method.

Apoptosis Evaluation. MCF-7 or MCF-7/ADR cell lines were incubated in 6-well plates for 24 hours (80% confluence). Different systems (DOX, DOX + Pgp siRNA, DOX+ NC/Mi, DOX + Lipofectamine/Pgp siRNA and DOX + NC/Pgp siRNA-Mi) were added into the wells. Pgp siRNA and DOX concentrations were adjusted to around 100 nM and 10 μg/ml. After 72 hour incubation, a Dead Cell Apoptosis Kit (ThermoFisher, USA) with Annexin V FITC and propidium iodide (PI) was used to detect the apoptosis level with the help of a flow cytometer (Cytomics FC500, Beckman Coulter, USA).

Animal Test. After the MDR tumor-bearing mice model establishment, the mice were randomly divided into six groups (every group contained 6 mice). When the average tumor volumes reach about 50 mm3 (the day was recorded as day 0), the mice were treated with different formulations: (G1) PBS; (G2) DOX; (G3) DOX + Pgp siRNA; (G4)


33

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 41

DOX + NC/Mi; (G5) DOX + Lipofectamine Pgp siRNA; (G6) DOX + NC/Pgp siRNA-Mi. The DOX was performed by intravenous injection (100 μl in PBS) into the mice with an interval of 4 days (DOX, 4 mg/kg). Other systems were mainly injected locally into the tumor one day before the DOX. The number of mitochondria is around 2  107 and the dose of siRNA was 0.67 mg/kg. The body weight of the mice was recorded every 2 days. The shortest diameter (B) and the longest diameter (L) of the tumor was measured (the volumes equaled 0.5×L×B2). The tumor growth inhibition (TGI) was calculated, TGI = 1-(V30/V0)experimental/(V30/V0)control

(1)

V0 and V30 were the volumes of the tumors on day 0 and day 30, respectively. After sacrificing the mice at day 30, the tumors were weighed and stored in 10% formalin. 200 mg samples were homogenized and proteins were extracted for the following western blot analysis. Moreover, co-delivery of DOX all the formulations through the tail vein was also performed compared with local injection.


34

Page 35 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Statistical Analysis. SPSS statistical software (SPSS 16.0) was applied for statistical analyses and all experiments were repeated at least three times.

ASSOCIATED CONTENT

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.nano-lett..XXXXXXX.

Details of materials and cells used; methods for mitochondrial labeling, mitochondrial isolation, characterization of NC/siRNA-Mi; additional figures (PDF)

AUTHOR INFORMATION *Corresponding authors:

E-mail addresses: [email protected] (Wei XW), [email protected] (Qian ZY)

Tel: +86- 028-85502796

Notes


35

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 41

The authors declare no competing financial interest.

ACKNOWLEDGMENT

This work was supported, in part, by the National Natural Science Foundation of China (31525009, 81602634, 31771096), the China Postdoctoral Science Foundation (2015M570745 and 2016T90815), Natural Science Foundation of Guangdong Province (2016A030310229), Sichuan Innovative Research Team Program for Young Scientists (2016TD0004), Distinguished Young Scholars of Sichuan University (2011SCU04B18), and 1·3·5 project for disciplines of excellence, West China Hospital, Sichuan University.

REFERENCES

(1)

Matsuyama, R.; Reddy, S. and Smith, T. J. Why Do Patients Choose Chemotherapy near the End of Life? A Review of the Perspective of Those Facing Death from Cancer. J. Clin. Oncol. 2006, 24, 3490-3496.

(2)

Mitscher, L. A.; Pillai, S. P.; Gentry, E. J. and Shankel, D. M. Multiple Drug Resistance. Med. Res. Rev. 1999, 19, 477-496.

(3)

Pakunlu, R. I.; Wang, Y.; Tsao, W.; Pozharov, V.; Cook, T. J. and Minko, T. Enhancement of the Efficacy of Chemotherapy for Lung Cancer by Simultaneous


36

Page 37 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Suppression of Multidrug Resistance and Antiapoptotic Cellular Defense: Novel Multicomponent Delivery System. Cancer Res. 2004, 64, 6214-6224. (4)

Saad, M.; Garbuzenko, O. B. and Minko, T. Co-Delivery of siRNA and an Anticancer Drug for Treatment of Multidrug-Resistant Cancer. Nanomedicine 2008, 3, 761-776.

(5)

Li, J.; Wang, Y.; Zhu, Y. and Oupicky, D. Recent Advances in Delivery of DrugNucleic Acid Combinations for Cancer Treatment. J. Control. Release 2013, 172, 589-600.

(6)

Creixell, M. and Peppas, N. A. Co-Delivery of siRNA and Therapeutic Agents Using Nanocarriers to Overcome Cancer Resistance. Nano Today 2012, 7, 367379.

(7)

He, C.; Lu, K.; Liu, D. and Lin, W. Nanoscale Metal–Organic Frameworks for the Co-Delivery of Cisplatin and Pooled siRNAs to Enhance Therapeutic Efficacy in Drug-Resistant Ovarian Cancer Cells. J. Am. Chem. Soc. 2014, 136, 5181-5184.

(8)

Szakács, G.; Paterson, J. K.; Ludwig, J. A.; Booth-Genthe, C. and Gottesman, M. M. Targeting Multidrug Resistance in Cancer. Nat. Rev. Drug Discovery 2006,

5, 219-234. (9)

Sharom, F. J. ABC Multidrug Transporters: Structure, Function and Role in Chemoresistance. Pharmacogenomics 2008, 9, 105-127.

(10)

Szakács, G.; Annereau, J. P.; Lababidi, S.; Shankavaram, U.; Arciello, A.; Bussey, K. J.; Reinhold, W.; Guo, Y.; Kruh, G. D.; Reimers, M.; Weinstein, J. N. and Gottesman, M. M. Predicting Drug Sensitivity and Resistance: Profiling ABC Transporter Genes in Cancer Cells. Cancer Cell 2004, 6, 129-137.

(11)

Gottesman, M. M.; Fojo, T. and Bates, S. E. Multidrug Resistance in Cancer: Role of Atp–Dependent Transporters. Nat. Rev. Cancer 2002, 2, 48-58.

(12)

Griguer, C. E. and Oliva, C. R. Bioenergetics Pathways and Therapeutic Resistance in Gliomas: Emerging Role of Mitochondria. Curr. Pharm. Des. 2011,

17, 2421-2427. (13)

Gogvadze, V.; Orrenius, S. and Zhivotovsky, B. Mitochondria in Cancer Cells: What Is So Special About Them? Trends Cell Biol. 2008, 18, 165-173.


37

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(14)

Page 38 of 41

Hockenbery, D.; Nunez, G.; Milliman, C.; Schreiber, R. D. and Korsmeyer, S. J. Bcl-2 Is an Inner Mitochondrial Membrane Protein that Blocks Programmed Cell Death. Nature 1990, 348, 334-336.

(15)

Adams, J. and Cory, S. The Bcl-2 Protein Family: Arbiters of Cell Survival.

Science 1998, 281, 1322-1326. (16)

Liscovitch, M. and Lavie, Y. Cancer Multidrug Resistance: A Review of Recent Drug Discovery Research. IDrugs 2002, 5, 349-355.

(17)

Izquierdo, M. Short Interfering RNAs as a Tool for Cancer Gene Therapy. Cancer

Gene Ther. 2004, 12, 217-227. (18)

Igney, F. H. and Krammer, P. H. Death and Anti-Death: Tumour Resistance to Apoptosis. Nat. Rev. Cancer 2002, 2, 277-288.

(19)

Liu, C. S.; Chang, J. C.; Kuo, S. J.; Liu, K. H.; Lin, T. T.; Cheng, W. L. and Chuang, S. F. Delivering Healthy Mitochondria for the Therapy of Mitochondrial Diseases and Beyond. Int. J. Biochem. Cell B. 2014, 53, 141-146.

(20)

Elliott, R. L.; Jiang, X. P. and Head, J. F. Mitochondria Organelle Transplantation: Introduction of Normal Epithelial Mitochondria into Human Cancer Cells Inhibits Proliferation and Increases Drug Sensitivity. Breast Cancer

Res. Treat. 2012, 136, 347-354. (21)

McCully, J. D.; Levitsky, S.; Pedro, J. and Cowan, D. B. Mitochondrial Transplantation for Therapeutic Use. Clin. Transl. Med. 2016, 5, 16.

(22)

Zorova, L. D.; Popkov, V. A.; Plotnikov, E. Y.; Silachev, D. N.; Pevzner, I. B.; Jankauskas, S. S.; Babenko, V. A.; Zorov, S. D.; Balakireva, A. V.; Juhaszova, M.; Sollott, S. J. and Zorov, D. B. Mitochondrial Membrane Potential. Anal.

Biochem. 2018, 552, 50-59. (23)

Danon, D.; Goldstein, L.; Marikovsky, Y. and Skutelsky, E. Use of Cationized Ferritin as a Label of Negative Charges on Cell Surfaces. J. Ultrastruct. Res. 1972, 38, 500-510.

(24)

Hammond, P. T. Building Biomedical Materials Layer-by-Layer. Mater. Today 2012, 15, 196-206.

(25)

Deng, Z. J.; Morton, S. W.; Ben-Akiva, E.; Dreaden, E. C.; Shopsowitz, K. E. and Hammond, P. T. Layer-by-Layer Nanoparticles for Systemic Codelivery of an


38

Page 39 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

Anticancer Drug and siRNA for Potential Triple-Negative Breast Cancer Treatment. ACS Nano 2013, 7, 9571-9584. (26)

Posey, A. D., Jr.; Kawalekar, O. U. and June, C. H. Measurement of Intracellular Ions by Flow Cytometry. Curr. Protoc. Cytom. 2015, 72, 9.8.1-9.8.21.

(27)

Nakagawa, M.; Schneider, E.; Dixon, K. H.; Horton, J.; Kelley, K.; Morrow, C. and Cowan, K. H. Reduced Intracellular Drug Accumulation in the Absence of PGlycoprotein (Mdr1) Overexpression in Mitoxantrone-Resistant Human MCF-7 Breast Cancer Cells. Cancer Res. 1992, 52, 6175-6181.

(28)

Van Zijl, C.; Lottering, M. L.; Steffens, F. and Joubert, A. In Vitro Effects of 2‐ Methoxyestradiol on MCF‐12A and MCF‐7 Cell Growth, Morphology and Mitotic Spindle Formation. Cell Biochem. Funct. 2008, 26, 632-642.

(29)

Smiley, S. T.; Reers, M.; Mottola-Hartshorn, C.; Lin, M.; Chen, A.; Smith, T. W.; Steele, G. and Chen, L. B. Intracellular Heterogeneity in Mitochondrial Membrane Potentials Revealed by a J-Aggregate-Forming Lipophilic Cation JC1. Proc. Natl. Acad. Sci. USA 1991, 88, 3671-3675.

(30)

Kean, T. and Thanou, M. Biodegradation, Biodistribution and Toxicity of Chitosan. Adv. Drug Deliv. Rev. 2010, 62, 3-11.

(31)

Xiong, L.; Yang, T.; Yang, Y.; Xu, C. and Li, F. Long-Term in Vivo Biodistribution Imaging and Toxicity of Polyacrylic Acid-Coated Upconversion Nanophosphors. Biomaterials 2010, 31, 7078-7085.

(32)

Tan, Z. and Chen, S. Electrostatic Correlations and Fluctuations for Ion Binding to a Finite Length Polyelectrolyte. J. Chem. Phys. 2005, 122, 044903.

(33)

Whitehead, K. A.; Langer, R. and Anderson, D. G. Knocking Down Barriers: Advances in siRNA Delivery. Nat. Rev. Drug Discov. 2009, 8, 129.

(34)

Gary, D. J.; Puri, N. and Won, Y.-Y. Polymer-Based siRNA Delivery: Perspectives on the Fundamental and Phenomenological Distinctions from Polymer-Based DNA Delivery. J. Control. Release 2007, 121, 64-73.

(35)

Dahlman, J. E.; Barnes, C.; Khan, O. F.; Thiriot, A.; Jhunjunwala, S.; Shaw, T. E.; Xing, Y.; Sager, H. B.; Sahay, G.; Speciner, L.; Bader, A.; Bogorad, R. L.; Yin, H.; Racie, T.; Dong, Y.; Jiang, S.; Seedorf, D.; Dave, A.; Sandu, K. S.; Webber, M. J.; Novobrantseva, T.; Ruda, V. M.; Lytton-Jean, A. K. R.; Levins,


39

Nano Letters 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 41

C. G.; Kalish, B.; Mudge, D. K.; Perez, M.; Abezgauz, L.; Dutta, P.; Smith, L.; Charisse, K.; Kieran, M. W.; Fitzgerald, K.; Nahrendorf, M.; Danino, D.; Tuder, R. M.; von Andrian, U. H.; Akinc, A.; Schroeder, A.; Panigrahy, D.; Kotelianski, V.; Langer, R. and Anderson, D. G. In Vivo Endothelial siRNA Delivery Using Polymeric Nanoparticles with Low Molecular Weight. Nat. Nanotechnol. 2014, 9, 648-655. (36)

Vonarbourg, A.; Passirani, C.; Saulnier, P. and Benoit, J.-P. Parameters Influencing the Stealthiness of Colloidal Drug Delivery Systems. Biomaterials 2006, 27, 4356-4373.

(37)

Perrault, S. D.; Walkey, C.; Jennings, T.; Fischer, H. C. and Chan, W. C. Mediating Tumor Targeting Efficiency of Nanoparticles through Design. Nano

Lett. 2009, 9, 1909-1915. (38)

McCully, J. D.; Cowan, D. B.; Pacak, C. A.; Toumpoulis, I. K.; Dayalan, H. and Levitsky, S. Injection of Isolated Mitochondria During Early Reperfusion for Cardioprotection. Am. J. Physiol. Heart Circ. Physiol. 2009, 296, H94-H105.

(39)

McCully, J.; Rousou, A.; Parker, R. and Levitsky, S. Age and Gender Differences in Mitochondrial Oxygen Consumption and Free Matrix Calcium During Ischemia/Reperfusion and Calcium with Cardioplegia and Diazoxide. Ann.

Thorac. Surg. 2007, 83, 1102-1109.


40

Page 41 of 41 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nano Letters

TOC GRAPHIC


41

Mitochondrial Surface Engineering for Multidrug Resistance Reversal

Recommend Documents